Kit for rapidly detecting seven genital tract pathogens by one-tube method

Abstract

The invention discloses a kit for rapidly detecting seven genital tract pathogens by a one-tube method. The kit comprises a primer and a probe aiming at ureaplasma urealyticum, a primer and a probe aiming at ureaplasma parvum, a primer and a probe aiming at chlamydia trachomatis, a primer and a probe aiming at gonococcus, a primer and a probe aiming at mycoplasma genitalium, a primer and a probe aiming at mycoplasma hominis and a primer and a probe aiming at trichomonas vaginalis. In addition, the invention also discloses a method for rapidly detecting seven common genital tract pathogens by a one-tube method. According to the method, the detection sensitivity is greatly improved, the operation is simple, and seven genital tract pathogens can be simultaneously detected in a short time.

Description

Technical Field

[0001] The invention belongs to the technical field of biological reagents, and in particular relates to a kit for rapidly detecting seven reproductive tract pathogens using a one-tube method. Background Art

[0002] Sexually transmitted diseases (STDs) are a public health burden worldwide. STDs can cause serious fetal and neonatal mortality, ectopic pregnancy, infertility, and genital tumors. Many STDs are often asymptomatic in the early stages of infection, increasing the likelihood of undetected transmission.

[0003] Sexually transmitted infections are caused by various microorganisms such as bacteria, viruses, yeasts, and protozoa. Common STIs include, but are not limited to, Ureaplasma urealyticum (UU), Ureaplasma parvum (UP), Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG), Mycoplasma genitalium (MG), Trichomonas vaginalis (TV), Mycoplasma hominis (MH), Candida albicans (CA), Gardnerella vaginalis (GV), and human herpesvirus type 1 (HSV-1) and type 2 (HSV-2), among others. Sexually transmitted infections present with similar clinical symptoms, making clinical identification of pathogens very difficult. Due to their high infection rates and co-infection cases, it is important to find the exact pathogen of STIs.

[0004] Currently, the gold standard for detecting reproductive tract infections in clinical practice is still the culture method. However, the difficulty with the culture method is that most of these microorganisms are difficult to culture, and the culture conditions are harsh. Some cannot even be cultured, which leads to a high false negative rate and a long culture and identification time, which will delay the time for clinical reporting.

[0005] Currently, the most common method for detecting such microorganisms is nucleic acid amplification, which has high identification specificity, high sensitivity, low false negative rate, and fast report generation. The main technology used is the fluorescent PCR method, such as the reagents that Shengxiang Biotechnology Co., Ltd. has obtained a license for; there are also constant temperature amplification methods, such as the products that Rendu Biotechnology Co., Ltd. has obtained a license for; there are also methods that use melting curve analysis, such as the STI seven-in-one test method launched by Seegene, South Korea.

[0006] Some patents for detecting genital pathogens have been reported in the published patent literature, but the technical solutions in these patents have some shortcomings more or less. For example, patent CN102191321B adopts a constant temperature amplification method to detect Ureaplasma urealyticum, and adopts specific adsorption of pathogen rRNA to detect, and the detection limit can reach 50CFU / reaction, but the limitation of this method is that only one pathogen can be detected in one tube, and it is impossible to add an internal standard to monitor the amplification process, and the operation is cumbersome during the actual experiment. For example, patent US9540681B2 mentions that the use of PTOCE technology can reach up to 20 pathogens in one tube, but there is almost no disclosure of the sensitivity of the method, and another obvious defect of this method is that its primer cutting efficiency is slow, resulting in a long detection time. For example, patent CN105734176B discloses a method for simultaneously detecting nine reproductive tract pathogens. It uses a specific primer probe plus a universal primer to simultaneously detect nine targets, and also uses a melting curve method. However, an obvious disadvantage of this method is that the PCR reaction time is long. According to the procedure disclosed in the patent, the time required on the Hongshi real-time fluorescence amplification instrument is as long as 2.5 hours, and its detection sensitivity has not been disclosed.

[0007] Therefore, it is necessary to develop a method that is highly sensitive, easy to operate, and can quickly detect multiple reproductive tract pathogens in one tube. Summary of the invention

[0008] In view of the deficiencies of the prior art and actual needs, the present invention provides a highly sensitive and efficient detection kit and a detection method for simultaneously detecting reproductive tract pathogens.

[0009] To achieve the above object, the present invention adopts the following technical solutions: In a first aspect, the present invention provides a kit for rapid detection of seven common reproductive tract pathogens by a one-tube method, the kit comprising primers and probes for Ureaplasma urealyticum, primers and probes for Ureaplasma parvum, primers and probes for Chlamydia trachomatis, primers and probes for Neisseria gonorrhoeae, primers and probes for Mycoplasma genitalium, primers and probes for Mycoplasma hominis, and primers and probes for Trichomonas vaginalis; Among them, the forward primer for Ureaplasma urealyticum, Ureaplasma parvum, and Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.1, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.3; The forward primer for Chlamydia trachomatis and Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.2, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.4; The forward primer for gonococci is the nucleotide sequence shown in SEQ ID NO.5, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.6; The forward primer for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.7, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.8; The probe for Ureaplasma urealyticum and Ureaplasma microti is the nucleotide sequence shown in SEQ ID NO.11; The probe for Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.12; The probe for Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.13; The probe for gonococci is the nucleotide sequence shown in SEQ ID NO.14; The probe for Chlamydia trachomatis is the nucleotide sequence shown in SEQ ID NO.15; The probe for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.16.

[0010] In one or more embodiments, the kit further comprises primers and probes for an internal reference gene, wherein the forward primer for the internal reference gene is a nucleotide sequence as shown in SEQ ID NO.9, and the reverse primer is a nucleotide sequence as shown in SEQ ID NO.10; and the probe for the internal reference gene is a nucleotide sequence as shown in SEQ ID NO.17.

[0011] In the present invention, the sequences of the above primers and probes are shown in Table 1.

[0012] Table 1 Sequences of primers and probes

[0013] In one or more embodiments, the probe in the kit also carries a fluorescent marker gene. The present invention does not limit the fluorescent marker of the probe. Preferably, the fluorescent marker gene is 6-FAM, VIC, ROX or Cy5.

[0014] In one or more embodiments, the probe for Ureaplasma urealyticum and Ureaplasma microti is fluorescently labeled with FAM; the probe for Mycoplasma genitalium and Mycoplasma hominis is fluorescently labeled with VIC; the probe for Neisseria gonorrhoeae and Chlamydia trachomatis is fluorescently labeled with ROX; the probe for Trichomonas vaginalis is fluorescently labeled with Cy5; and the probe for the internal reference gene is fluorescently labeled with Cy5.

[0015] In a second aspect, the present invention provides a method for rapid detection of seven common reproductive tract pathogens in a one-tube method, comprising the following steps: (1) Extracting nucleic acid from samples of reproductive tract pathogens to be tested; (2) using the 16S or 16S-like rDNA of the relevant pathogen in the extracted sample as a template and an exogenous internal standard as a system quality control, performing asymmetric PCR amplification, and then performing fluorescent melting curve analysis; the PCR amplification uses the primers and probes in the kit described in any one of the present invention; (3) After the melting curve program is completed, the sample detection results are judged based on the Tm value of the corresponding probe.

[0016] In one or more embodiments, the reproductive tract pathogen sample to be detected in step (1) can be a reproductive tract secretion swab sample or a fresh urine sample.

[0017] In one or more embodiments, the concentration ratio of the forward primer to the reverse primer in the asymmetric PCR amplification in step (2) is 1:3 to 1:20.

[0018] In one or more embodiments, the program of asymmetric PCR amplification in step (2) is: 50°C for 2 min; 95°C for 1 min; 95°C for 5 s, 60°C for 15 s, for a total of 40 cycles.

[0019] In one or more embodiments, the fluorescence melting curve analysis program in step (2) is: 95°C for 3 min; 40°C for 3 min; 40-90°C, 0.3°C / s with continuous.

[0020] In one or more embodiments, the exogenous internal standard in step (2) is an artificially constructed plasmid, and its sequence can be SEQ ID NO.18: AAAACAGGTCCACCTGGTAACGTCACATCACTGCACTACTTCTCTTCGACACTGATTGGAAACTGGACGCAACCGCAACCGCTTATGCTTAAGGTTGCAGCCTCGACGCTATTGTTCTTCTTCGCCATCCTCGGT ATCCCCCAAGCCGCCATGACGGATTACGTTTAGCATTGTGGTTACGAATTCCTTTCTGAATCTAGCCATTTGCACTAGCTTCCATATTTTCAACCAATTCCGGAACTATTGGACTTTCGGTGGTGTGCCGGCCAA.

[0021] In one or more embodiments, the asymmetric PCR amplification system is shown in Table 2: Table 2 Asymmetric PCR amplification system

[0022] The present invention extracts the total nucleic acid of 16S or 16S-like ribosomal DNA of sexually transmitted infection pathogens in the sample, and then uses specific primer probes to quickly detect seven corresponding pathogens: Ureaplasma urealyticum, Ureaplasma parvum, Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma genitalium, Mycoplasma hominis, and Trichomonas vaginalis, and uses a melting curve analysis method to analyze whether the corresponding pathogens exist in the sample. Since the number of copies of ribosomal DNA in microorganisms is at least one, and some even have 6 copies per cell genome, using 16S or 16S-like ribosomal rDNA as a template to detect the target, theoretically, the detection limit can be as low as 1 bacterium / reaction.

[0023] Compared with the prior art, the present invention has the following beneficial effects: (1) The detection sensitivity is greatly improved. The method of the present invention is about 100 times more sensitive than the control reagent. (2) The entire operation process of the present invention is simple, and the amplification time plus the melting curve analysis time is as short as 1 hour; (3) The present invention can detect seven sexually transmitted infection pathogens in one tube at the same time. Conventional methods can only detect up to three targets in one tube. The method of the present invention increases the number of targets and has a large throughput. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The probe and the first set of primer specific results are described in the primer probe of the first target region in Example 2.

[0025] Figure 2 The probe and the third set of primer specific results are described in the primer probe of the third target region in Example 2.

[0026] Figure 3 This is a schematic diagram of the results of testing NG samples using the reagent of the present invention in Example 3.

[0027] Figure 4 Schematic diagram of the results of the comparison patent reagent in Example 3 on NG samples. DETAILED DESCRIPTION

[0028] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0029] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific embodiments rather than for limiting the scope of protection of the present invention.

[0030] When the embodiment gives a numerical range, it should be understood that, unless otherwise specified in the present invention, the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those of ordinary skill in the art to which the present invention belongs.

[0031] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0032] The examples involve the addition amounts, contents and concentrations of various substances, wherein the percentages described therein, unless otherwise specified, are all by mass percentages.

[0033] The internal standard plasmid template DNA sequence involved in the following examples is shown in SEQ ID NO.18.

[0034] The present invention will be further described below in conjunction with embodiments: Example 1: Extraction of ribosomal DNA from reproductive tract pathogens

[0035] The samples were extracted using a nucleic acid extractor from swabs and urine samples of clinically positive patients. The extraction reagents were purchased from the MagBio Swab DNA / RNAKit III of Zhuhai Biotech Co., Ltd. to obtain 16S or 16S-like rDNA of each pathogen. Other kits that can extract nucleic acids can also be used. The specific process is as follows: (1) Prepare a 96-well deep-well plate and magnetic rod set that matches the nucleic acid extraction equipment; (2) Aliquoting reagents: Follow steps (3) to (7) below to dispense the reagents into the corresponding wells of a 96-well deep-well plate; Note: The location of the heating module may vary for different devices, and the location of the reagent dispenser should be adjusted based on actual conditions.

[0036] (3) Add 15 μl / well of magnetic bead suspension, 10 μl / well of proteinase K, and 200 μl / well of sample to the wells in columns A2-H2 and A8-H8 of a 96-well deep-well plate, respectively; (4) Add 600 μl / well of washing solution WB to the wells in columns A3-H3 and A9-H9 of a 96-well deep-well plate. (5) Add elution buffer EB at 50 μl / well into the wells of columns A6-H6 and A12-H12 of a 96-well deep-well plate. (6) Add lysis buffer LB at 600 μl / well into the wells of columns A2-H2 and A8-H8 of a 96-well deep-well plate. (7) Place the 96-well deep-well plate with the sample added into an appropriate automatic nucleic acid extraction device; (8) Take out the magnetic rod cover and insert the magnetic rod cover into the appropriate position of the nucleic acid automated extraction equipment; (9) Set up the extraction program and run it according to the program shown in Table 3: Table 3 Extraction procedure

[0037] The number of magnetic attraction is related to the magnetic strength of the magnetic rod. If there is a serious amount of residual magnetic beads, the number of magnetic attraction should be appropriately increased.

[0038] (10) After the automated extraction process is completed, transfer an appropriate amount of the extraction product from the wells in columns A6-H6 and A12-H12 to a 1.5 mL clean nuclease-free centrifuge tube. Add RNase inhibitors to the extracted samples to protect the RNA from degradation. The extracted products are stored at -20°C. Example 2: Primer probe screening

[0039] During the implementation of the present invention, it was found that after the NG primer probe (targeting gonococci) was introduced into the system, non-specific amplification would occur, and the NG primer probe designed with the universal primer probe target region could not be used in the system. Therefore, optimizing and screening NG primer probes with good specificity and sensitivity is a difficulty and focus of the present invention.

[0040] Three target intervals were designed in the experiment, and at least two sets of primers were designed for each target area, as shown below: (1) Primer probe for the first target region Probe: CAACTTGATTGCTTGGTAGCGT (SEQ ID NO. 19); The first set of primers: Forward primer: GGATTAGATACCCTGGTAGTCC (SEQ ID NO. 3); Reverse primer: GTGCGGGTCCCCGTCAATTC (SEQ ID NO. 2); Second set of primers: Forward primer: GCAAATAGGATTAGATACCCTRGTAGTCC (SEQ ID NO. 20); Reverse primer: CGAATTAATCCACATCATCCACC (SEQ ID NO. 21); (2) Primer probe for the second target region Probe: GCAGCCTCCTCTGGGATAACACTG (SEQ ID NO. 22); The first set of primers: Forward primer: CGGGAACTGCGTTCTGAACT (SEQ ID NO. 23); Reverse primer: CCACGCTTTCGGACATGAA (SEQ ID NO. 24); Second set of primers: Forward primer: TGCGTTCTGAACTGGGTGACT (SEQ ID NO. 25); Reverse primer: TCCCCGTCAATTCCTTTGAG (SEQ ID NO. 26); The third set of primers: Forward primer: TAGGGTGCGAGCGTTAATCG (SEQ ID NO. 27); Reverse primer: TCCCCGTCAATTCCTTTGAG (SEQ ID NO. 28); (3) Primer probe for the third target region Probe: CCATCATTCGGTTGGGCACTC (SEQ ID NO. 14); The first set of primers: Forward primer: AACGAGCGCAACCCTTGTC (SEQ ID NO. 29); Reverse primer: CGTGTGAAGCCCCTGGTCATA (SEQ ID NO. 30); Second set of primers: Forward primer: GAGCGCAACCCTTGTCATTAG (SEQ ID NO. 31); Reverse primer: CGGACTACGATCGGTTTTGTG (SEQ ID NO. 32); The third set of primers: Forward primer: GAGCGCAACCCTTGTCATTA (SEQ ID NO. 5); Reverse primer: TTGGCTACCCTCTGTACCGA (SEQ ID NO. 6); (4) Verify each group of NG primer probes above, taking the primer probe of the first target area as an example (the rest are analogous), the amplification system is shown in Table 4, and the sequences of other primer probes in the table are detailed in Table 1: Table 4 Amplification system

[0041] The reaction system amplification program is shown in Table 5: Table 5 Amplification procedures

[0042] The reaction system melting curve analysis program is shown in Table 6: Table 6 Reaction system melting curve analysis program

[0043] After the melting curve program is completed, the specificity of the primers is determined based on the melting curve peak graph.

[0044] Figure 1 The probe and first set of primer specific results described in the primer probe for the first target region; Figure 2 The probe and the third set of primer specific results are described in the primer probe of the third target region. From the results, Figure 1 The specificity is far less than Figure 2 After a large number of subsequent screenings, it was finally determined that the probes described in the primer probe of the third target region and the third set of primers were the optimal combination, and both specificity and sensitivity were very good. Example 3: Sample detection

[0045] (1) Using the sample extracted in Example 1 as a template, multiplex PCR amplification detection and melting curve analysis were performed. At the same time, according to the information such as primers and probes described in patent CN105734176B, corresponding primers and probes were synthesized to conduct comparative experiments.

[0046] (2) The amplification system of this example is prepared as shown in Table 7: Among them, the forward primer for Ureaplasma urealyticum, Ureaplasma parvum, and Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.1, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.3; the forward primer for Chlamydia trachomatis and Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.2, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.4; the forward primer for Neisseria gonorrhoeae is the nucleotide sequence shown in SEQ ID NO.5, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.6; the forward primer for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.7, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.8; the probe for Ureaplasma urealyticum and Ureaplasma parvum is the nucleotide sequence shown in SEQ ID NO.11; the probe for Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.12; the probe for Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.13; the probe for Neisseria gonorrhoeae is the nucleotide sequence shown in SEQ ID NO.14; the probe for Chlamydia trachomatis is the nucleotide sequence shown in SEQ ID NO. The nucleotide sequence of SEQ ID NO.15 is shown in the following table; the probe for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.16; the forward primer of the internal reference gene is the nucleotide sequence shown in SEQ ID NO.9, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.10; the probe for the internal reference gene is the nucleotide sequence shown in SEQ ID NO.17. The probe for Ureaplasma urealyticum and Ureaplasma microti is fluorescently labeled with FAM; the probe for Mycoplasma genitalium and Mycoplasma hominis is fluorescently labeled with VIC; the probe for Neisseria gonorrhoeae and Chlamydia trachomatis is fluorescently labeled with ROX; the probe for Trichomonas vaginalis is fluorescently labeled with Cy5; the probe for the internal reference gene is fluorescently labeled with Cy5.

[0047] Table 7 Amplification system

[0048] (3) The amplification procedure of the reaction system is shown in Table 5; (4) The melting curve analysis procedure of the reaction system is shown in Table 6; (5) The comparison reagent amplification reaction system was prepared according to the description in patent CN105734176B.

[0049] (6) The test results are shown in Table 8: Table 8 Test results

[0050] Figure 3 and Figure 4The following are schematic diagrams of the detection results of NG samples using the reagents of the present invention and the comparative patent CN105734176B. It can be seen from the figure that the sensitivity of the results of NG sample detection using the reagents of the present invention has been significantly improved. From the analysis of the detection results in Table 8 above, the sensitivity of the detection system of the present invention is significantly higher than that of the method described in the comparative patent, and the total detection time of the present invention is about 1 hour, while the detection time required for the comparative patent is 2.5 hours. The present patent has obvious advantages in detection sensitivity and operation time.

[0051] The above is only an implementation method of the present invention. It should be pointed out that ordinary technicians in this field can make changes without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A kit for rapid detection of seven common reproductive tract pathogens using a one-tube method, characterized in that: The kit comprises primers and probes for Ureaplasma urealyticum, primers and probes for Ureaplasma parvum, primers and probes for Chlamydia trachomatis, primers and probes for Neisseria gonorrhoeae, primers and probes for Mycoplasma genitalium, primers and probes for Mycoplasma hominis, and primers and probes for Trichomonas vaginalis; wherein, The forward primer for Ureaplasma urealyticum, Ureaplasma parvum, and Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.1, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.3; The forward primer for Chlamydia trachomatis and Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.2, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.4; The forward primer for gonococci is the nucleotide sequence shown in SEQ ID NO.5, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.6; The forward primer for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.7, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.8; The probe for Ureaplasma urealyticum and Ureaplasma microti is the nucleotide sequence shown in SEQ ID NO.11; The probe for Mycoplasma genitalium is the nucleotide sequence shown in SEQ ID NO.12; The probe for Mycoplasma hominis is the nucleotide sequence shown in SEQ ID NO.13; The probe for gonococci is the nucleotide sequence shown in SEQ ID NO.14; The probe for Chlamydia trachomatis is the nucleotide sequence shown in SEQ ID NO.15; The probe for Trichomonas vaginalis is the nucleotide sequence shown in SEQ ID NO.

16.

2. The kit according to claim 1, characterized in that The kit also includes primers and probes for internal reference genes, wherein: The forward primer of the internal reference gene is the nucleotide sequence shown in SEQ ID NO.9, and the reverse primer is the nucleotide sequence shown in SEQ ID NO.10; the probe of the internal reference gene is the nucleotide sequence shown in SEQ ID NO.

17.

3. The kit according to claim 1 or 2, characterized in that The probe in the kit also carries a fluorescent marker gene, and the fluorescent marker gene is 6-FAM, VIC, ROX or Cy5.

4. The kit according to claim 3, characterized in that The probe for Ureaplasma urealyticum and Ureaplasma microti is fluorescently labeled with FAM; the probe for Mycoplasma genitalium and Mycoplasma hominis is fluorescently labeled with VIC; the probe for Neisseria gonorrhoeae and Chlamydia trachomatis is fluorescently labeled with ROX; the probe for Trichomonas vaginalis is fluorescently labeled with Cy5; and the probe for the internal reference gene is fluorescently labeled with Cy5.

Images