Method for producing sterols and sulfated derivatives thereof through fermentation and improving sulfation degree

Abstract

The invention discloses a method for producing sterols and sulfated derivatives thereof through fermentation and improving sulfation degree, and belongs to the field of bioengineering. The yeast engineering bacteria for fermentation production of sterols and sulfated derivatives thereof are constructed by taking yeast as an original strain and knocking out and introducing genes. The engineered yeast can efficiently produce 7-dehydrocholesterol and cholesterol, especially cholesterol sulfate, the shake flask fermentation yield of the engineered yeast is close to 249.0 mg / L, and the fermentation yield of a 5L fermentation tank can reach 544.7 mg / L. By highly expressing key rate-limiting enzyme in a metabolic pathway, enhancing precursor supply and enhancing cofactor PAPS supply, the yield and sulfation degree of the cholesterol sulfate are improved, and the pichia pastoris is utilized to efficiently generate the cholesterol sulfate, so that the method has the characteristics of short period, environmental protection and resource conservation. The yeast engineering bacterium for high-yield production of cholesterol sulfate has a wide application prospect, and provides important reference for production of other sulfated products.

Description

Technical Field

[0001] The invention relates to the field of bioengineering, and in particular to a method for producing sterols and sulfated derivatives thereof by fermentation and increasing the degree of sulfation. Background Art

[0002] Cholesterol sulfate (CS) is a sulfated product of cholesterol with a molecular formula of C 27 H 46 O4S is an important steroid sulfate in the human body. It is widely distributed in the human body, such as the skin, adrenal glands, liver, lungs, brain and endometrium. CS participates in a variety of physiological processes (such as regulating keratinocyte differentiation, participating in skin barrier formation, regulating T cell signaling and brain metabolism, etc.), and plays an important role in the occurrence and development of certain diseases and even cancer. In addition, CS also participates in the occurrence and development of a variety of diseases by regulating the activity of functional proteins.

[0003] At present, the supply of CS depends on the chemical conversion of cholesterol extracted from wool oil, which is heavily dependent on limited natural resources. The bioconversion method is not restricted by many conditions and is green and environmentally friendly. In recent years, with the development of synthetic biology technology, if microbial cell factories are used to synthesize CS, it can improve efficiency, reduce costs, break the limitations of natural conditions and effectively alleviate the contradiction between supply and demand.

[0004] At present, there are literature reports on the key genes for the synthesis of CS in the human body, which lays a good foundation for the heterologous synthesis of CS. With the development of synthetic biology, many natural products can be expressed in Pichia pastoris, such as terpenes, flavonoids and other substances. As a recognized safe strain, Pichia pastoris has a good understanding of its genetic background, metabolic pathways, and regulatory mechanisms through years of research. At the same time, Pichia pastoris is a eukaryotic organism with a fast growth rate, high environmental tolerance, and simple fermentation conditions. It can now be widely used as an ideal host bacteria to express heterologous proteins and produce bio-based compounds. Although CS has many application prospects, its low yield currently limits its application in different fields. Synthesizing natural products through microorganisms is a very environmentally friendly and efficient way. At present, there are no reports on the use of Pichia pastoris cell factories to produce CS and increase its sulfation degree.

[0005] Sulfation reactions catalyzed by different sulfo (-SO3H) transferases are one of the most important modification reactions in nature. In addition to CS, many compounds, such as chondroitin sulfate, heparin sulfate, and naringenin sulfate, rely on sulfation modification for their biological activity. 3′-Phosphoadenosine-5′-phosphosulfate (PAPS) is the only active sulfonic acid donor for all biological sulfation reactions, and an adequate supply of 3′-Phosphoadenosine-5′-phosphosulfate is a prerequisite for the efficient biosynthesis of these sulfated compounds. However, the enzymatic and microbial synthesis of sulfonated natural products is still limited because the sulfate donor 3′-Phosphoadenosine-5′-phosphosulfate is expensive, unstable in vitro, and has low intracellular utilization in microorganisms such as Escherichia coli and yeast, which seriously hinders the industrialization of microbial synthesis of sulfated products.

[0006] Currently, there are no reports on enhancing PAPS biosynthesis in vivo by systematic metabolic engineering to promote the production of sulfated compounds by microorganisms. Therefore, it is urgent to explore various strategies to increase the supply of PAPS to effectively utilize microorganisms to produce these sulfated compounds and increase their sulfation degree. Summary of the invention

[0007] In order to solve the deficiencies in the prior art, the present invention provides a method for producing sterols and sulfated derivatives thereof by fermentation and increasing the degree of sulfation.

[0008] The yeast engineering strain first used gene editing technology to knock out the coding genes of sterol C-22 desaturase ERG5 and sterol C-24 methyltransferase ERG6, and introduced genes including the coding gene of Δ(24)-sterol reductase DHCR24 (to construct a yeast engineering strain producing 7-dehydrocholesterol), the coding gene of 7-dehydrocholesterol reductase DHCR7 (the coding genes of Δ(24)-sterol reductase DHCR24 and 7-dehydrocholesterol reductase DHCR7 were introduced to construct a cholesterol-producing yeast engineering strain), and the coding gene of hydroxysteroid sulfatase SULT2B1b, and then the starting strain for cholesterol sulfate production was constructed, and then the 3-hydroxy-3-methylglutaryl-CoA reductase 1 was highly expressed. tHMG1 was used to relieve the rate-limiting step of the mevalonate pathway, and finally the genes encoding ATP sulfurylase MET3 and adenosine-5'-phosphosulfate kinase MET14, which are related to the synthesis of the cofactor PAPS, were overexpressed. Combined with the knockout of the gene encoding 3'-phosphoadenine sulfate reductase MET16, which is related to PAPS consumption, the sulfation degree of cholesterol was increased. The gene encoding the lipid synthesis transcription factor INO4 was further introduced to obtain strain CHS04 as the final engineered strain.

[0009] The present invention provides a yeast engineering bacterium for fermenting and producing sterols and sulfated derivatives thereof, wherein the sterol is 7-dehydrocholesterol or cholesterol, the sulfated derivative of the sterol is cholesterol sulfate, and the yeast engineering bacterium is any one of the following:

[0010] (1) Using yeast as a starting strain, first knocking out the coding gene of sterol C-22 desaturase ERG5 and the coding gene of sterol C-24 methyltransferase ERG6 to obtain strain 1, and introducing the coding gene of Δ(24)-sterol reductase DHCR24 into strain 1 to construct a yeast engineered strain that produces 7-dehydrocholesterol;

[0011] (2) The strain 1 is introduced with the coding gene of Δ(24)-sterol reductase DHCR24 and the coding gene of 7-dehydrocholesterol reductase DHCR7 to construct a cholesterol-producing yeast engineered bacterium;

[0012] (3) The cholesterol-producing yeast engineered bacteria described in (2) are modified to obtain a cholesterol sulfate-producing yeast engineered bacteria, wherein the genetic modification method includes any one of the following:

[0013] (I) introducing the gene encoding SULT2B1b, 3-hydroxy-3-methylglutaryl coenzyme A reductase 1 tHMG1, ATP sulfurylase MET3, and adenosine-5'-phosphosulfate kinase MET14; and knocking out the gene encoding 3'-phosphoadenine sulfate reductase MET16;

[0014] (II) introducing the gene encoding hydroxysteroid sulfotransferase SULT2B1b and the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase 1 tHMG1;

[0015] (III) Introduction of a gene encoding hydroxysteroid sulfotransferase SULT2B1b.

[0016] Preferably, the present invention also provides a method for increasing the sulfation degree of the sulfation product, which comprises overexpressing the coding gene of the endogenous ATP sulfurylase MET3 and the coding gene of the adenosine-5'-phosphosulfate kinase MET14 in the cholesterol sulfate-producing strain, combined with knocking out the coding gene of the endogenous 3'-adenine phosphate sulfate reductase MET16; the cholesterol sulfate-producing strain is the cholesterol sulfate-producing yeast engineered bacterium in (3), and the genetic modification method is the modification method in (II).

[0017] Preferably, the starting strain is Pichia pastoris, Saccharomyces cerevisiae or Yarrowia lipolytica. More preferably, the starting strain is Pichia pastoris, such as Pichia pastoris GS115 strain.

[0018] The GenBank number of the gene encoding the sterol C-22 desaturase ERG5 is XP_002492734.1, the GenBank number of the gene encoding the sterol C-24 methyltransferase ERG6 is XP_002492594.1, the nucleotide sequence of the gene encoding the Δ(24)-sterol reductase DHCR24 is shown in SEQ ID NO.1, the nucleotide sequence of the gene encoding the 7-dehydrocholesterol reductase DHCR7 is shown in SEQ ID NO.2, the nucleotide sequence of the gene encoding the hydroxysteroid sulfotransferase SULT2B1b is shown in SEQ ID NO.3, the GenBank number of the gene encoding 3-hydroxy-3-methylglutaryl-coenzyme A reductase 1_tHMG1 is M22002.1, the GenBank number of the gene encoding ATP sulfurylase MET3 (PAS_chr1-4_0253) is 8196926, the GenBank number of the gene encoding adenosine-5'-phosphosulfate kinase MET14 (PAS_chr3_0667) is 8200367, the nucleotide sequence of the gene encoding 3'-phosphoadenine sulfate reductase MET16 is shown in SEQ ID NO.4, and the GenBank number of the gene encoding lipid synthesis transcription factor INO4 is NM_001183362.1.

[0019] The present invention also provides a method for constructing the yeast engineering bacteria for producing sterols and their sulfated derivatives by fermentation. The yeast engineering bacteria for producing sterols and their sulfated derivatives by fermentation is the yeast engineering bacteria for producing cholesterol sulfate in (3), the genetic modification method is the modification method in (I), and the construction method comprises the following steps:

[0020] (1) knocking out the coding gene of sterol C-22 desaturase ERG5 in the genome of Pichia pastoris GS115-Cas9 (obtained by introducing the Cas9 protein coding gene into the genome of Pichia pastoris GS115 strain) to obtain strain C01, knocking out the coding gene of sterol C-24 methyltransferase ERG6 to obtain strain C02, integrating the coding gene of Δ(24)-sterol reductase DHCR24 to obtain strain DHC01, i.e., the yeast engineered strain producing 7-dehydrocholesterol; integrating the coding gene of Δ(24)-sterol reductase DHCR24 and the coding gene of 7-dehydrocholesterol reductase DHCR7 into C02 at the same time to obtain strain CH01, i.e., the yeast engineered strain producing cholesterol;

[0021] (2) Integrate the gene encoding hydroxysteroid sulfotransferase SULT2B1b into strain CH01 to obtain strain CHS01;

[0022] (3) Integrating the gene sequence encoding 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 into strain CHS01 to obtain strain CHS02;

[0023] (4) The endogenous 3′-phosphoadenine sulfate reductase MET16 coding gene sequence in strain CHS02 is knocked out, and then the ATP sulfurylase MET3 coding gene and the adenosine-5′-phosphosulfate kinase MET14 coding gene are integrated into the genome for overexpression to obtain strain CHS03, and then the lipid synthesis transcription factor INO4 coding gene is introduced to obtain the final strain CHS04, which is the yeast engineered bacterium for producing cholesterol sulfate by fermentation.

[0024] The promoters used in the construction process are pTEF and pGAP (ZL202210093958.4), and pADH2; the terminators are tAOX1 (ZL202210093958.4) and t0547. The sequences of promoter pADH2 and terminator t0547 refer to Gao, JC et a1., Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9. ACS Synth. Biol. 2022, 11(2), 623-633.

[0025] The present invention also provides the use of the yeast engineering bacteria that ferments and produces cholesterol sulfate in the preparation of sterols and their sulfated derivatives. The present invention also provides a method for preparing sterols and their sulfated derivatives, fermenting and culturing the yeast engineering bacteria that ferments and produces sterols and their sulfated derivatives, and extracting and obtaining sterols and their sulfated derivatives, that is, fermenting and culturing the yeast engineering bacteria that produces 7-dehydrocholesterol to extract 7-dehydrocholesterol; fermenting and culturing the yeast engineering bacteria that produces cholesterol to extract cholesterol; fermenting and culturing the yeast engineering bacteria that produces cholesterol sulfate to extract cholesterol sulfate.

[0026] The specific fermentation culture method is as follows: inoculate the yeast engineering bacteria in 50 mL YPG medium at a volume percentage of 1%-5%, ferment at 30° C. and 250 rpm for 3 days, and add 2% glycerol once after 36 hours.

[0027] The present invention has the following advantages over the prior art:

[0028] (1) The yeast engineering bacteria of the present invention can efficiently produce 7-dehydrocholesterol, cholesterol, and especially cholesterol sulfate, with a shake flask fermentation yield of 249.0 mg / L and a 5L fermentation tank fermentation yield of 544.7 mg / L.

[0029] (2) The present invention increases the metabolic flux in the cholesterol sulfate biosynthesis pathway by highly expressing key rate-limiting enzymes in the metabolic pathway, enhancing precursor supply, and modifying the cofactor PAPS.

[0030] (3) The present invention improves the supply of PAPS by systematically modifying the cofactor, thereby greatly increasing the sulfation degree of cholesterol. The method of increasing the sulfation degree of the present invention has significant guiding significance for the microbial synthesis and production of other sulfated products such as chondroitin sulfate, sulfated heparin, sulfated flavonoids and sulfated polypeptides.

[0031] (4) The present invention utilizes Pichia pastoris to efficiently produce cholesterol sulfate, which has the characteristics of short cycle, environmental protection and resource conservation. The yeast engineering bacteria for high production of cholesterol sulfate and the method for increasing the sulfation degree of the sulfation product of the present invention have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The metabolic flow chart for the biosynthesis of 7-dehydrocholesterol (7-DHC), cholesterol, and cholesterol sulfate (CS).

[0033] Figure 2 Schematic diagram of the expression cassette for key enzymes in pathway modification.

[0034] Figure 3 The map of plasmid Int-pADH2-BamHI-tAOX1.

[0035] Figure 4 The map of plasmid Int-pGAP-BglII-tAOX1.

[0036] Figure 5 The map of plasmid Int-pTEF-BamHI-t0547.

[0037] Figure 6 The map of plasmid Int-(tAOX1-BglII-XhoI-pGAP)-(pTEF-HindIII-NdeI-t0547)

[0038] Figure 7It is a comparison chart of the dehydrocholesterol and cholesterol production in the shake flask culture of the strain in Example 1; wherein A and B are respectively comparison charts of the dehydrocholesterol (7-DHC) and cholesterol (Cholesterol) production in the shake flask culture of the strain in Example 1; C is a GC-MS detection mass spectrometry ion response value chart and mass spectrum chart of dehydrocholesterol and cholesterol.

[0039] Figure 8 The graph (A) shows a comparison of cholesterol sulfate production in shake flask cultures of different strains in Example 5 and a graph of mass spectrometry ion response values ​​and mass spectra of cholesterol sulfate detected by LC-MS (B). DETAILED DESCRIPTION

[0040] The metabolic flow chart of biosynthesis of 7-dehydrocholesterol, cholesterol, and cholesterol sulfate is as follows Figure 1 As shown, the key enzyme expression cassettes for pathway modification are as follows Figure 2 The detailed synthetic route is shown in the examples.

[0041] Example 1: Construction of 7-dehydrocholesterol-producing Pichia pastoris strain DHC01 and cholesterol-producing Pichia pastoris strain CH01

[0042] The Int refers to the insertion site of the Pichia pastoris GS115 genome. The auxiliary plasmids Int-pGAP-tAOX1 and Int-(tAOX1-BglII-XhoI-pGAP)-(pTEF-HindIII-NdeI-t0547) used are composed of a universal backbone (containing the prokaryotic plasmid replication initiation site ori and the ampicillin resistance gene), 500 bp homology arms upstream and downstream of the site, and pGAP-BglII-tAOX1 or (tAOX1-BglII-XhoI-pGAP)-(pTEF-HindIII-NdeI-t0547) (see the plasmid map). Figure 4 , Figure 6 ); the auxiliary plasmids HZP-sgRNA, HHP-sgRNA and HGP-sgRNA are composed of a universal skeleton, a resistance gene expression cassette, sgRNA corresponding to the site and a BsaI restriction site (see the authorized patent <A yeast engineering bacterium for fermentation and production of α-santalene and its application>, patent number: CN202210093958.4 for the map plasmid), Z, H, and G represent bleomycin resistance gene, hygromycin resistance gene and G418 resistance gene respectively; P is plasmid.

[0043] Starting from the auxiliary plasmid HZP-sgRNA, sgRNA-ERG5 was introduced using the restriction site BsaI in the vector to obtain the guide RNA recombinant expression vector HZP-sgRNA-ERG5. Starting from the auxiliary plasmid HHP-sgRNA, sgRNA-ERG6 was introduced using the restriction site BsaI in the vector to obtain the guide RNA recombinant expression vector HZP-sgRNA-ERG6. {Primers ERG5_UP-F / ERG5_UP-R and ERG5_DN-F / ERG5_DN-R were designed to amplify the upstream and downstream fragments of the target gene ERG5, and after fusion PCR, they were used as donors for knocking out ERG5 (ERG5 GenBank No. XP_002492734.1), and they and the corresponding recombinant gRNA plasmid HZP-sgRNA-ERG5 were transformed into Pichia pastoris cells GS115-Cas9 (obtained by integrating Cas9 protein into Pichia pastoris GS115) to obtain the recombinant strain C01. Primers ERG6_UP-F / ERG6_UP-R and ERG6_DN-F / ERG6_DN-R were designed to amplify the upstream and downstream fragments of the target gene ERG6, and after fusion PCR, they were used as donors for knocking out ERG6 (ERG6 GenBank No. XP_002492594.1). They were transformed into Pichia pastoris cells C01 and the corresponding recombinant gRNA plasmid HHP-sgRNA-ERG6 to obtain the recombinant strain C02.

[0044] Starting from the auxiliary plasmid Int12-pGAP-tAOX1 (Int12: left gene PAS_chr3_1202, right gene PAS_chr3_0618), the BglII restriction site was introduced into the Δ(24)-sterol reductase DHCR24 encoding gene (sequence as shown in SEQ ID NO.1) to obtain the recombinant vector Int12-pGAP-GgDHCR24-tAOX1; starting from the auxiliary plasmid Int12-(tAOX1-BglII-XhoI-pGAP)-(pTEF-Hind[II-NdeI-t0547), the BglII and XhoI double restriction sites in the vector were used to introduce the Δ(24)-sterol reductase DHCR24 encoding gene and the HindIII and NdeI double restriction sites were used to introduce the 7-dehydrocholesterol reductase DHCR7 encoding gene (sequence as shown in SEQ ID NO.2) to obtain the recombinant vector Int12-(tAOXl-GgDHCR24-pGAP)-(pTEF-DrDHCR7-t0547); starting from the auxiliary plasmid HZP-sgRNA, sgRNA-Int12 was introduced using the restriction site BsaI in the vector to obtain the recombinant vector HZP-sgRNA-Int12. Then, the recombinant vectors Int12-pGAP-GgDHCR24-AOX1t and Int12-(tAOX1-GgDHCR24-pGAP)-(pTEF-DrDHCR7-t0547) were used as templates to design donor primers, and PCR was performed to obtain the corresponding Int12-donor, which was transformed into Pichia pastoris cell C02 (ERG5 and ERG6 were knocked out of the genome of Pichia pastoris GS115-Cas9 strain) with the corresponding recombinant gRNA plasmid HZP-sgRNA-Int12 to obtain recombinant strains DHC01 and CH01, respectively. The specific implementation is as follows:

[0045] (1) Construction of donor DNA and guide RNA recombinant expression vectors HZP-sgRNA-ERG5 and HZP-sgRNA-ERG6 for knocking out endogenous ERG5 and ERG6

[0046] Primers ERG5_UP-F / ERG5_UP-R and ERG5_DN-F / ERG5_DN-R were designed to amplify the upstream and downstream fragments of the target gene ERG5, and used as donors for knocking out ERG5 after fusion PCR. The primer sequences used are as follows:

[0047] ERG5_UP-F:AGGATGCTGACCTTTTCGATAAGCC,

[0048] ERG5_UP-R: ctcagtgtttcctAGTTCCAGCTATTGTTGAGGAGTTGC;

[0049] ERG5_DN-F:aatagctggaactAGGAAACACTGAGATACAGGCCTCC,

[0050] ERG5_DN-R: GATATTCAGCTCGGGAATTGGCATC.

[0051] Primers ERG6_UP-F / ERG6_UP-R and ERG6_DN-F / ERG6_DN-R were designed to amplify the upstream and downstream fragments of the target gene ERG6, and used as donors for knocking out ERG6 after fusion PCR. The primer sequences used are as follows:

[0052] ERG6_UP-F: GGAAGTTATTGTGAATGCAGAATGCG,

[0053] ERG6_UP-R: catgtctgccatgTTTCGGTAATAAAACGAGTGTTGAGTAG;

[0054] ERG6_DN-F:gtttattaccgaaaCATGGCAGACATGGACGACGATATC,

[0055] ERG6_DN-R:ACCAGTGCTCTAACGATTGGATTGTC.

[0056] Guide RNA recombinant expression vector HZP-sgRNA-ERG5

[0057] Starting from the auxiliary plasmid HZP-sgRNA, sgRNA-ERG5 was introduced using the restriction site BsaI in the vector, and the recombinant vector HZP-sgRNA-ERG5 was obtained by T4 enzyme ligation. The primer sequences used are as follows:

[0058] ERG5-sgRNA-F: ACGCAACTCCAACAATGATAGCCA,

[0059] ERG5-sgRNA-R: AAACTGGCTATCATTGTTGGAGTT.

[0060] Starting from the auxiliary plasmid HHP-sgRNA, sgRNA-ERG6 was introduced using the restriction site BsaI in the vector and connected by T4 enzyme to obtain the recombinant vector HHP-sgRNA-ERG6. The primer sequences used are as follows:

[0061] ERG6-sgRNA-F: ACGCGTCACCAACTTCAATACCGT,

[0062] ERG6-sgRNA-R:AAACACGGTATTGAAGTTGGTGAC.

[0063] (2) Transformation and construction of endogenous ERG5 knockout strain C01 and endogenous ERG6 knockout strain C02

[0064] The donor DNA donor (obtained by fusion PCR) for knocking out ERG5 was transformed into Pichia pastoris GS115-Cas9 with the corresponding recombinant gRNA plasmid HZP-sgRNA-ERG5 to obtain the recombinant strain C01. The resistance plasmid was discarded by passage several times.

[0065] The ERG6 knockout donor DNA donor (obtained by fusion PCR) and the corresponding recombinant gRNA plasmid HHP-sgRNA-ERG6 were simultaneously transformed into Pichia pastoris cell C01 to obtain the recombinant strain C02. The resistance plasmid was discarded by passage several times.

[0066] (3) Construction of 7-dehydrocholesterol and cholesterol recombinant expression vectors

[0067] The Δ(24)-sterol reductase DHCR24 encoding gene and the 7-dehydrocholesterol reductase DHCR7 encoding gene were synthesized by GenScript Biotech Co., Ltd. Using the synthesized genes as templates, primers DHCR24-F / DHCR24-R and DHCR7-F / DHCR7-R were designed to amplify the target genes DHCR24 and DHCR7, respectively. The target genes were assembled with the corresponding restriction digested vectors using the seamless cloning method and transformed into the Escherichia coli DH5α strain to obtain the recombinant vectors Int12-pGAP-GgDHCR24-AOX1t and Int12-(tAOX1-GgDHCR24-pGAP)-(pTEF-DrDHCR7-t0547). The primer sequences used are as follows:

[0068] DHCR24-F: tgaacaactatcaaaacacaCAAACGATGTCAGCCGTTTGGTCCTTGG,

[0069] DHCR24-R: rgcattctgacatcctcttgaagatctTTAGTGTCTAGCAGCCTTACAAATC;

[0070] DHCR7-F: cattttagttattcgccaacGCCACCATGATGGCTCTCTGATAGAGTTAG,

[0071] DHCR7-R:taagcgaaactacgtacGCATATGTTAGAAAATGTTTGGCAACAATCT.

[0072] (4) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int12

[0073] Using plasmid HZP-sgRNA as a template, primers Int12-sgRNA-F and Int12-sgRNA-R (ZL202210093958.4) were used, and the Int12-sgRNA was introduced using the restriction site BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-Int12 was obtained by T4 enzyme ligation.

[0074] (5) Transformation and construction of 7-dehydrocholesterol-producing strain DHC01 and cholesterol-producing strain CH01

[0075] Using the recombinant vectors Int12-pGAP-GgDHCR24-tAOX1 and Int12-(tAOX1-GgDHCR24-pGAP)-(pTEF-DrDHCR7-t0547) as templates, PCR was performed using primers Int12-donor-F and Int12-donor-R (ZL202210093958.4) to obtain the corresponding linearized fragment Int12-donor, which was simultaneously transformed into Pichia pastoris cell C02 with the corresponding recombinant gRNA plasmid HZP-sgRNA-Int12 to obtain recombinant strains DHC01 and CH01. At the same time, the resistance plasmid was discarded by passage several times.

[0076] Example 2: Construction of the recombinant Pichia pastoris strain CHS01 producing cholesterol sulfate

[0077] Starting from the auxiliary plasmid Int1-pADH2-BamHI-tAOX1 (map as shown Figure 3As shown; Int1: PAS_FragB_0066 on the left, PAS_FragB_0067 on the right), the restriction site was introduced into the hydroxysteroid sulfotransferase SULT281b coding gene (sequence as shown in SEQ ID NO.3) to obtain the recombinant vector Int1-, pADH2-HsSULT281b-tAOX1; starting from the auxiliary plasmid HZP-sgRNA, sgRNA-Int1 was introduced using the restriction site BsaI in the vector to obtain the recombinant vector HZP-sgRNA-Int1. Then, the recombinant vector Int1-, pADH2-HsSULT281b-tAOX1 was used as a template to design donor primers, and PCR was performed to obtain the corresponding Int1-donor, which was transformed into the cholesterol-producing Pichia pastoris cell CH01 (constructed in Example 1) with the corresponding recombinant gRNA plasmid HZP-sgRNA-Int1 to obtain the recombinant strain CHS01, which was specifically implemented as follows:

[0078] (1) Construction of cholesterol sulfate recombinant expression vector

[0079] The gene encoding steroid sulfotransferase SULT2Blb was synthesized by GenScript Biotech Co., Ltd. Using the synthesized gene as a template, primers SULT2Blb-F / SULT2Blb-R were designed to amplify the target gene SULT2Blb, which was assembled with the corresponding enzyme-cut vector using the seamless cloning method and transformed into the Escherichia coli DH5α strain to obtain the recombinant vector Int1-pADH2-HsSULT281b-tAOX1. The primer sequences used are as follows:

[0080] SULT2B1b-F:atttactttacgaaacaaacgATGGACGGCCCTGCCGAACCGCAAATC,

[0081] SULT2B1b-R: tggcattctgacatcctcttgaTCAGGATGGCCGGGGATGGGGCGTC.

[0082] (2) Construction of guide RNA recombinant expression vector HZP-sgRNA-Int1

[0083] Using plasmid HZP-sgRNA as a template, primers Int1-sgRNA-F and Int1-sgRNA-R (ZL202210093958.4) were used, and the restriction site BsaI in the vector HZP-sgRNA was used to introduce Int1-sgRNA, and the recombinant vector HZP-sgRNA-Int1 was obtained by T4 enzyme ligation.

[0084] (3) Transformation and construction of cholesterol sulfate-producing strain CHS01

[0085] Using the recombinant vector Int1--pADH2-HsSULT281b-tAOX1 as a template, using primers Int1-donor-F and Int1-donor-R (ZL202210093958.4), PCR was performed to obtain the corresponding linearized fragment Int1-donor, which was simultaneously transformed into the cholesterol-producing Pichia pastoris cell CH01 with the corresponding recombinant gRNA plasmid HZP-sgRNA-Int1 to obtain the recombinant strain CHS01. At the same time, the resistance plasmid was discarded by passage several times. Example 3: Construction of the recombinant strain CHS02 of Pichia pastoris producing cholesterol sulfate

[0086] The expression cassette of the highly expressed gene tHMG1 and the corresponding gRNA plasmid were constructed and transferred into the above-mentioned recombinant strain CHS01. After transformation, the Pichia pastoris recombinant strain CHS02 was obtained. The specific implementation is as follows:

[0087] (1) Construction of tHMG1 recombinant expression vector and guide RNA expression vector HZP-sgRNA-Int15

[0088] Using the Saccharomyces cerevisiae genome as a template, primers tHMG1-F / tHMG1-R were designed to amplify the target gene tHMG1 (GenBank No. M22002.1), and the primers were assembled with the vector Int15-pGAP-tAOX1 (Int15: left gene PAS_chr3_0987, right gene PAS_chr3_0989) after BgllI digestion using the seamless cloning method. The recombinant vector Int15-pGAP-tHMG1-tAOX1 was obtained by transformation of Escherichia coli. The primer sequences used are as follows:

[0089] tHMG1-F: aatcaattgaacaactatcaaaacacaGATGGCTGCAGACCAATTGGTG,

[0090] tHMG1-R: aggcaaatggcattctgacatCCTCTTGAGTTAGGATTTAATGCAGGTG.

[0091] Starting from the auxiliary plasmid HZP-sgRNA, using primers Int15-sgRNA-F and Int15-sgRNA-R (Gao, JCet al., Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9.ACS Synth.Bi01.2022, 11(2), 623-633), Int15-sgRNA was introduced using the restriction site BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-Int15 was obtained by T4 enzyme ligation.

[0092] (2) Construction of the recombinant Pichia pastoris strain CHS02

[0093] Using the recombinant vector Int15-pGAP-tHMG1-tAOX1 as a template and primers Iht15-donor-F and Int15-donor-R (Gao, JCet al., Synthetic biology toolkit for marker-less integrationof multigene pathways into Pichia pastoris via CRISPR / Cas9. ACSSynth. Biol. 2022.11 (2), 623-633), PCR was performed to obtain the corresponding linearized fragment Int15-donor, which was simultaneously transformed into Pichia pastoris cells CHS01 with the corresponding recombinant gRNA plasmid HZP-sgRNA-Int15 to obtain the recombinant strain CHS01-1. At the same time, the resistance plasmid was discarded by passage several times.

[0094] Example 4: Construction of the recombinant Pichia pastoris strain CHS03 producing cholesterol sulfate

[0095] The fusion fragment for knocking out MET16, the expression cassette for co-expressing genes MET3 and MET14, and the corresponding gRNA plasmids were constructed respectively, and they were successively transferred into the above-mentioned recombinant strain CHS02. After successive rounds of transformation, the Pichia recombinant strains CHS02-1 and CHS03 were obtained respectively. The specific implementation is as follows:

[0096] (1) Construction of a fusion fragment and guide RNA expression vector HZP-sgRNA-METl6 for knocking out the endogenous 3′-phosphoadenine sulfate reductase encoding gene METl6

[0097] Using the Pichia pastoris genome as a template, primers MET16_UP-F / MET16_UP-R and MET16_DN-F / MET16_DN-R were designed to amplify the upstream and downstream fragments of the target gene MET16 (sequence as shown in SEQ ID NO.4), and the fragment with MET16 knocked out (sequence as shown in SEQ ID NO.5) was obtained by fusion PCR technology. The primer sequences used are as follows:

[0098] MET16_UP-F:CTGGATGTGTGTAAATAGTTGATTTCG,

[0099] MET16_UP-R:ccttaacctttctcGTCAAGATTAATCCGTTAGCATCCTG;

[0100] MET16_DN-F:cggattaatcttgacGAGAAAGGTTAAGGTGGTCCACTTG,

[0101] MET16_DN-R-GTAAGTTGATAGAGAGCAGACTTCGAG.

[0102] Starting from the auxiliary plasmid HZP-sgRNA, primers MET16-sgRNA-F and MET16-sgRNA-R were designed, and MET16-sgRNA was introduced using the restriction site BsaI in the vector HZP-sgRNA, and the recombinant vector HZP-sgRNA-MET16 was obtained by T4 enzyme ligation. The primer sequences used are as follows:

[0103] MET16-sgRNA-F:ACGCGTGAGGGTTCAACTTTTACG,

[0104] MET16-sgRNA-R-AAACCGTAAAAGTTGAACCCTCAC.

[0105] (2) Construction of the recombinant Pichia pastoris strain CHS02-1

[0106] The corresponding MET16 knockout fragment Δmet16-donor was obtained by fusion PCR, and it and the corresponding recombinant gRNA plasmid HZP-sgRNA-MET16 were simultaneously transformed into Pichia pastoris cells CHS02 to obtain the recombinant strain CHS02-1. At the same time, the resistance plasmid was discarded after several passages.

[0107] (3) Construction of the expression vector of the ATP sulfurylase encoding gene MET3, the expression vector of the adenosine-5'-phosphosulfate kinase encoding gene MET14, and the guide RNA expression vector HHP-sgRNA-Int21

[0108] Primers MET3-F / MET3-R were designed, and the target gene MET3 (GenBank No. 8196926) was amplified from the Pichia pastoris genome. It was assembled with the enzyme-cut vector Int21-(tAOXl-BglII-XhoI-pGAP)-(pTEF-HindIII-NdeI-t0547) (Int21: left gene PAS_chr4_0575, right gene PAS_chr4_0576) using the seamless cloning method, and transformed into Escherichia coli DH5α strain to obtain the recombinant vector Int21-(tAOX1-MET3-pGAP)-(pTEF-Hind[II-NdeI-t0547).

[0109] The primer sequences used are as follows:

[0110] MET3-F:aacaactatcaaaacacactcgagATGCCTGCTCCTCACGGTGGTATTC,

[0111] MET3-R:ttctgacatcctcttgaagatctTTAAAATACAAAAAAGCCATTGTCTTCC.

[0112] Primers MET14-F / MET14-R were designed to amplify the target gene MET14 (GenBank No. 8200367), and it was assembled with the enzyme-cut vector Intnt21-(tAOXl-MET3-pGAP)-(pTEF-Hind[II-NdeI-t0547) using the seamless cloning method, and the Escherichia coli DH5α strain was transformed to obtain the recombinant vector Int21-(tAOX1-MET3-pGAP)-(pTEF-MET14-t0547).

[0113] The primer sequences used are as follows:

[0114] MET14-F: tagttattcgccaacaagcttATGGCTACTAATATTACTTGGCATCC,

[0115] MET14-R: cgaaactacgtacgcatatgTTACAAATGCTTACGGATGATTTTTTCAC.

[0116] Starting from the auxiliary plasmid HHP-sgRNA, using primers Int21-sgRNA-F and Int21-sgRNA-R (Gao, JCet al., Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris via CRISPR / Cas9.ACS Synth.Biol.2022, 11(2), 623-633), Int21-sgRNA was introduced using the restriction site BsaI in the vector HHP-sgRNA, and the recombinant vector HHP-sgRNA-Int21 was obtained by T4 enzyme ligation.

[0117] (4) Construction of the recombinant Pichia pastoris strain CHS03

[0118] Using the recombinant vector Int21-(tAOX1-MET3-pGAP)-(pTEF-MET14-t0547) as a template and primers Int21-donor-F and Int21-donor-R (Gao, JCet al., Synthetic biology toolkit for marker-less integration of multigene pathways into Pichia pastoris yiaCRISPR / Cas9.ACS Synth.Biol.2022, 11(2), 623-633), PCR was performed to obtain the corresponding linearized fragment Int21-donor, which was simultaneously transformed into Pichia pastoris cells CHS02-1 with the corresponding recombinant gRNA plasmid HHP-sgRNA-Int21 to obtain the recombinant strain CHS03. At the same time, the resistance plasmid was discarded by passage several times.

[0119] Example 5: Construction of the recombinant Pichia pastoris strain CHS04 producing cholesterol sulfate

[0120] (1) Construction of the expression vector of the lipid biosynthesis transcription factor encoding gene INO4 and the guide RNA expression vector HGP-sgRNA-Int32

[0121] Primers INO4-F / INO4-R were designed, and the target gene INO4 (GenBank No. NM_001183362.1) was amplified from the Saccharomyces cerevisiae genome. The target gene INO4 was assembled with the vector Int32-pGAP-BglII-tAOX1 (Int32: left gene PAS_chr2-2_0143, right gene PAS_chr2-2_0142) after restriction digestion using the seamless cloning method, and transformed into the Escherichia coli DH5α strain to obtain the recombinant vector Int32-pGAP-INO4-tAOX1. The primer sequences used are as follows:

[0122] INO4-F:ctatttcaatcaattgaacaactatATGACGAACGATATTAAGGAGATAC,

[0123] INO4-R:tgaagatctgtcttcatagttcTCACTGACCACTCTGTCCATCAC.

[0124] Starting from the auxiliary plasmid HGP-sgRNA, using primers Int32-sgRNA-F and Int32-sgRNA-R (primer pair is IntE20-sgRNA-F / IntE20-sgRNA-R, Gao, JCet al., Biosynthesis of catharanthine inengineered Pichiap astoris. Nature Synthesis, 2023, 2: 231), Int32-sgRNA was introduced using the restriction site BsaI in the vector HGP-sgRNA, and the recombinant vector HHP-sgRNA-Int32 was obtained by T4 enzyme ligation.

[0125] (4) Construction of the recombinant Pichia pastoris strain CHS03

[0126] Using the recombinant vector Int33-pGAP-INO4-tAOX1 as a template and primers Int32-donor-F and Int32-donor-R (primer pair is IntE20-donor-F / IntE20-donor-R, Gao, JCet al., Biosynthesis of catharanthine in engineered Pichia pastoris. Nature Synthesis, 2023, 2: 231), PCR was performed to obtain the corresponding linearized fragment Int32-donor, which was simultaneously transformed into Pichia pastoris cells CHS03 with the corresponding recombinant gRNA plasmid HGP-sgRNA-Int32 to obtain the recombinant strain CHS04. At the same time, the resistance plasmid was discarded by passage several times.

[0127] Example 6: Efficient production of cholesterol sulfate by Pichia pastoris engineered strains

[0128] After the recombinant strains in Examples 1-5 were activated on solid YPD plates, single colonies were picked and cultured in 5 mL test tubes, and then transferred to 50 mL shake flasks with a 1% inoculation amount and cultured for 3 days. After that, samples were processed for product analysis. The fermentation tank was fed-batch cultured with CHS04 to obtain a high-concentration fermentation product. The specific implementation is as follows:

[0129] (1) Cultivation of recombinant strains

[0130] Single colonies of GS115-Cas9, DHC01, CH01, CHS01, CHS02, CHS03 and CHS04 were picked from the plates and inoculated into 5 mL YPD (20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract) test tubes for culture at 30 °C, 250 rpm for 12 h, and then inoculated into 50 mL YPG (20 g / L glycerol, 20 g / L peptone, 10 g / L yeast extract) shake flask medium at a 1% inoculum amount. Three parallel cultures of each strain were cultured at 30 °C, 250 rpm for 3 days, and 2% glycerol was added after 36 h.

[0131] As a control of Pichia pastoris DHC01 (producing 7-dehydrocholesterol), Syvdb1 is a cerevisiae strain producing 7-dehydrocholesterol, the fermentation medium is YPD medium, and the other culture conditions are the same.

[0132] (2) Detection methods of 7-dehydrocholesterol and cholesterol

[0133] Sample treatment: 500 μL of yeast culture was washed twice with deionized water, the collected yeast cells were treated with 1 mL of 3M HCL at 100°C for 5 min, and the cell debris was washed with distilled water until the pH was neutral. Then, 500 μL of 3M KOH and 500 μL of methanol were added to the cell debris and incubated at 80°C for 90 min for saponification. After cooling, 500 μL of n-hexane was added and extracted with shaking for 2 h. After centrifugation, the n-hexane phase was collected and analyzed by GC-MS.

[0134] GC-MS detection conditions: The extracted n-hexane phase was analyzed using an Agilent 8890-5977B gas chromatograph-mass spectrometer (GCMS) equipped with a mass selective detector (MSD). The gas chromatograph used an Agilent HP-5ms ultra-inert capillary gas chromatograph column (30m×0.25mm, 0.25μm, J&W Scientific, CA). The mass spectrometer was acquired in single ion monitor (SIM) mode. The ion source temperature was 250℃, the injection temperature was 260℃, the oven temperature was maintained at 80℃ for 1min, then increased from 80℃ to 250℃ at a rate of 30℃ / min, and increased from 250℃ to 300℃ at a rate of 10℃ / min, and maintained for 10min. 7-DHC and cholesterol standards were diluted with n-hexane to 1, 0.8, 0.6, 0.4, 0.2, and 0.1mg / L to generate a standard curve.

[0135] (3) Cholesterol sulfate detection method

[0136] Sample treatment: Yeast cells were collected from 500 μL of fermentation broth, washed once with deionized water, resuspended in 1 mL of methanol, and lysed using a grinder. After centrifuging the lysate at 12,000 g for 10 minutes, the supernatant was transferred to a new tube and diluted with a methanol-water solution (80 / 20, v / v) containing 0.1% formic acid (FA). 200 μL of the diluted sample was transferred to each well of a 96-well plate.

[0137] LC-MS detection conditions: The extracts were analyzed using an Agilent RapidFire 4000 high-throughput system combined with an Agilent 6470 triple quadrupole mass spectrometer (RFMS / MS). The samples were loaded onto C18 (Agilent) at a flow rate of 1.5 mL / min in a methanol-water solution (10 / 90, v / v) containing 0.1% FA, and eluted to the mass spectrometer at a flow rate of 0.8 mL / min in an acetonitrile-isopropanol solution (80 / 20, v / v) containing 0.1% FA. An electrospray ion source triple quadrupole mass spectrometer was used and operated in positive multiple reaction monitoring (MRM) mode. The detailed settings of the mass spectrometer parameters are as follows: capillary voltage, 2500 v; gas temperature: 300 ° C; gas flow rate: 81 / min; nebulizer, 50 psi; sheath gas temperature: 350 ° C, sheath gas flow rate: 11 l / min; nozzle voltage: 1500 v. The MRM transitions of CS were 465.4 / 97 and 465.4 / 465.4, respectively. The mass resolution window of the parent ion and the daughter ion was set to one unit (0.7Da). The residence time of each transition was 200ms, the fragmentation energy was 140V, and the collision energy was 38 / 5eV. The CS standard area was used for quantification based on the ratio of each peak area. The CS stock solution was diluted to 1, 0.8, 0.6, 0.4, 0.2, and 0.1 mg / L in 80% methanol-water solution (0.1% formic acid) to prepare a standard curve.

[0138] (4) Fermentation culture of recombinant strain CHS04

[0139] A single colony CHS04 was picked and inoculated into 5mL YPD medium for 24 hours, and then 1mL (2%) of the seed solution was transferred to three 250mL bottles, each containing 50mL of fresh YPD medium, and cultured at 30°C and 250rpm for 24 hours. 150mL of the culture was transferred to a 5-L bioreactor (T&J-type, T&J Bioengineering Co., Ltd., Shanghai, China) containing 2.5LYPG (40g / L glycerol). Fermentation was carried out in the bioreactor at a temperature of 30°C, a rotation speed of 250-600rpm, and an air flow rate of 1-3vvm. The DO was maintained above 20%, and the pH was maintained at 5.5-5.8 by automatically adding 8% ammonia water and 36% acetic acid. When the glycerol concentration in the fermenter dropped to 1g / L, glycerol was continuously fed into the tank. Samples were taken from the bioreactor regularly to measure the OD 600 , glycerol concentration, ethanol concentration, and steroid titer.

[0140] (5) Recombinant Pichia pastoris strain 7-dehydrocholesterol and cholesterol production

[0141] Table 1 Recombinant strain 7-dehydrocholesterol and cholesterol production

[0142]

[0143] The Pichia yeast engineered strain was cultured according to the culture method described in (1), and the yield was determined by the detection method described in (2). The shake flask yield is shown in Tables 1 and Figure 7 A and 7B, the mass spectra were detected as Figure 7 C. Strain DHC01 produced 35.6±2.3mg / L and 36.1±2.9mg / L7-DHC in YPD and YPG medium, respectively. When DrDHCR7 from zebrafish (Danio rerio) was introduced into strain DHC01, strain CH01 produced 107.6mg / L cholesterol. Its cholesterol production was about 2 times higher than the 7-DHC production of the parent strain DHC01 (107.6mg / L vs 36.1mg / L), indicating that the efficient DrDHCR7 enhanced the metabolic flux of sterol synthesis. Therefore, Pichia pastoris is a potential chassis for sterol production.

[0144] (6) Comparison of cholesterol sulfate production by recombinant Pichia pastoris strains

[0145] Table 2 Cholesterol sulfate production of recombinant strains

[0146]

[0147]

[0148] The Pichia yeast engineered strain was cultured according to the culture method described in (1), and the cholesterol sulfate production was determined using the detection method described in (3). The production in the shake flask is shown in Table 2 and Figure 8 As shown in A, the maximum value can reach 249.0 mg / L, and the mass spectrum is as follows Figure 8 B. According to the method shown in (3), the Pichia pastoris engineered strain CHS04 was subjected to batch fermentation. After 65 h, the maximum production of cholesterol sulfate in a 5L fermenter was about 544.7 mg / L, which laid a foundation for the industrial production and application of cholesterol sulfate and sterols, and can also provide a reference for the efficient and green biomanufacturing of other sulfated products.

Claims

1. A yeast engineered bacterium for fermenting and producing sterols and their sulfated derivatives, characterized in that: The sterol is 7-dehydrocholesterol or cholesterol, the sulfated derivative of the sterol is cholesterol sulfate, and the engineered yeast is any one of the following: (1) Using yeast as a starting strain, first knocking out the coding gene of sterol C-22 desaturase ERG5 and the coding gene of sterol C-24 methyltransferase ERG6 to obtain strain 1, and introducing the coding gene of Δ(24)-sterol reductase DHCR24 into strain 1 to construct a yeast engineered strain that produces 7-dehydrocholesterol; (2) The strain 1 is introduced with the coding gene of Δ(24)-sterol reductase DHCR24 and the coding gene of 7-dehydrocholesterol reductase DHCR7 to construct a cholesterol-producing yeast engineered bacterium; (3) The cholesterol-producing yeast engineered bacteria described in (2) are modified to obtain a cholesterol sulfate-producing yeast engineered bacteria, wherein the genetic modification method includes any one of the following: (I) introducing the gene encoding SULT2B1b, 3-hydroxy-3-methylglutaryl coenzyme A reductase 1 tHMG1, ATP sulfurylase MET3, and adenosine-5'-phosphosulfate kinase MET14; and knocking out the gene encoding 3'-phosphoadenine sulfate reductase MET16; (II) introducing the gene encoding hydroxysteroid sulfotransferase SULT2B1b and the gene encoding 3-hydroxy-3-methylglutaryl-CoA reductase 1 tHMG1; (III) Introduction of a gene encoding hydroxysteroid sulfotransferase SULT2B1b.

2. The yeast engineered bacteria for fermenting and producing sterols and sulfated derivatives thereof according to claim 1, characterized in that: The starting strain is Pichia pastoris, Saccharomyces cerevisiae or Yarrowia lipolytica.

3. The yeast engineered bacteria for fermenting and producing sterols and sulfated derivatives thereof according to claim 1, characterized in that: The GenBank number of the gene encoding the sterol C-22 desaturase ERG5 is XP002492734.1, the GenBank number of the gene encoding the sterol C-24 methyltransferase ERG6 is XP002492594.1, the nucleotide sequence of the gene encoding the Δ(24)-sterol reductase DHCR24 is shown in SEQ ID NO.1, the nucleotide sequence of the gene encoding the 7-dehydrocholesterol reductase DHCR7 is shown in SEQ ID NO.2, the nucleotide sequence of the gene encoding the hydroxysteroid sulfotransferase SULT2B1b is shown in SEQ ID NO.3, the nucleotide sequence of the gene encoding the 3-hydroxy-3-methylglutaryl-CoA reductase 1 The GenBank number of the gene encoding tHMG1 is M22002.1, the GenBank number of the gene encoding ATP sulfurylase MET3 is 8196926, the GenBank number of the gene encoding adenosine-5'-phosphosulfate kinase MET14 is 8200367, the nucleotide sequence of the gene encoding 3'-phosphoadenine sulfate reductase MET16 is shown in SEQ ID NO.4, and the GenBank number of the gene encoding lipid synthesis transcription factor INO4 is NM001183362.

1.

4. The method for constructing a yeast engineering bacterium for fermenting and producing sterols and sulfated derivatives thereof according to any one of claims 1 to 3, characterized in that: The yeast engineered bacteria for fermenting and producing sterols and sulfated derivatives thereof is the yeast engineered bacteria for producing cholesterol sulfate in (3), the genetic modification method is the modification method in (I), and the construction method comprises the following steps: (1) The gene encoding sterol C-22 desaturase ERG5 in the Pichia pastoris GS115-Cas9 genome was knocked out to obtain strain C01, and the gene encoding sterol C-24 methyltransferase ERG6 was further knocked out to obtain strain C02. The genes encoding Δ(24)-sterol reductase DHCR24 and 7-dehydrocholesterol reductase DHCR7 were simultaneously integrated into C02 to obtain strain CH01; (2) Integrate the gene sequence encoding hydroxysteroid sulfotransferase SULT2B1b into strain CH01 to obtain strain CHS01; (3) Integrating the coding gene sequence of 3-hydroxy-3-methylglutaryl-CoA reductase 1 tHMG1 into strain CHS01 to obtain strain CHS02; (4) The endogenous 3′-phosphoadenine sulfate reductase MET16 coding gene sequence in strain CHS02 was knocked out, and the coding gene sequences of ATP sulfurylase MET3 and adenosine-5′-phosphosulfate kinase MET14 were integrated into the genome of strain CHS02 to obtain strain CHS03; (5) Integrate the coding gene sequence of lipid synthesis transcription factor INO4 into strain CHS03 to obtain strain CHS04, i.e., the cholesterol sulfate-producing yeast engineered bacterium.

5. The method for constructing a yeast engineering bacterium for fermenting and producing sterols and sulfated derivatives thereof as claimed in claim 4, characterized in that: The promoter used in the construction process was pTEF, pADH2 or pGAP; the terminator was tAOX1 or t0547.

6. The method for constructing a yeast engineering bacterium for fermenting and producing sterols and sulfated derivatives thereof according to any one of claims 1 to 3, characterized in that: The yeast engineered bacteria for fermenting and producing sterols and sulfated derivatives thereof is the yeast engineered bacteria for producing 7-dehydrocholesterol in (1), and the construction method comprises the following steps: The coding gene of sterol C-22 desaturase ERG5 in the genome of Pichia pastoris GS115-Cas9 was knocked out to obtain strain C01, and the coding gene of sterol C-24 methyltransferase ERG6 was further knocked out to obtain strain C02, and then the coding gene of Δ(24)-sterol reductase DHCR24 was integrated to obtain strain DHC01, that is, the yeast engineered strain producing 7-dehydrocholesterol.

7. The method for constructing a yeast engineering bacterium for fermenting and producing sterols and sulfated derivatives thereof according to any one of claims 1 to 3, characterized in that: The yeast engineered bacteria for fermenting and producing sterols and sulfated derivatives thereof is the cholesterol-producing yeast engineered bacteria in (2), and the construction method comprises the following steps: The gene encoding sterol C-22 desaturase ERG5 in the Pichia pastoris GS115-Cas9 genome was knocked out to obtain strain C01, and the gene encoding sterol C-24 methyltransferase ERG6 was further knocked out to obtain strain C02. The Δ(24)-sterol reductase DHCR24 and 7-dehydrocholesterol reductase DHCR7 encoding genes were simultaneously integrated into C02 to obtain strain CH01, i.e., the cholesterol-producing yeast engineered bacteria.

8. Use of the engineered yeast according to any one of claims 1 to 3 in the fermentation production of sterols and sulfated derivatives thereof.

9. A method for preparing sterols and sulfated derivatives thereof, characterized in that: Fermentation and cultivation of the engineered yeast bacteria for producing sterols and their sulfated derivatives according to any one of claims 1 to 3, and extraction of sterols and their sulfated derivatives.

10. A method for increasing the degree of sulfation, characterized in that: The endogenous ATP sulfurylase MET3 and adenosine-5'-phosphosulfate kinase MET14 genes were overexpressed in the cholesterol sulfate-producing strain, and the endogenous 3'-phosphoadenine sulfate reductase MET16 gene was knocked out.

Images