Unlock instant, AI-driven research and patent intelligence for your innovation.

Use of primer for detecting CYP2E1 gene SNP point rs2480256 in manufacturing kit for evaluating susceptibility of systematic lupus erythematosus

A single nucleotide polymorphism and lupus erythematosus technology, applied in the field of preventing systemic lupus erythematosus and predicting the susceptibility of systemic lupus erythematosus

Inactive Publication Date: 2011-09-14
廖凌虹 +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The ABCG2 gene was identified by analyzing cell lines that were resistant to mitoxantrone but did not overexpress the ABCB1 or ABCC1 genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Use of primer for detecting CYP2E1 gene SNP point rs2480256 in manufacturing kit for evaluating susceptibility of systematic lupus erythematosus
  • Use of primer for detecting CYP2E1 gene SNP point rs2480256 in manufacturing kit for evaluating susceptibility of systematic lupus erythematosus
  • Use of primer for detecting CYP2E1 gene SNP point rs2480256 in manufacturing kit for evaluating susceptibility of systematic lupus erythematosus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0070] Example 1: Detection of the newly discovered single nucleotide polymorphism site 51523T>G in the present invention

[0071] The present invention has newly discovered a single nucleotide polymorphism site 51523T>G located on intron 9 of the ABCG2 gene, and the method for detecting this site is introduced as follows:

[0072] The software Primer3 (http: / / frodo.wi.mit.edu / cgi-bin / primer3 / primer3) can be used to design some specific primers to search for polymorphic sites in related regions. The specificity of the designed primers relative to the human genome sequence was tested with the BLAST™ program (National Center for Biotechnology Information-http: / / www.ncbi.nlm.nih.gov / BLAST). Regardless of the forward or reverse primers, only when they find less than 5 similar sequences under the specific conditions of the BLAST program will they be considered specific and adopted.

[0073] use Gold polymerase kit (Applied Biosystems, CA, USA) and Polymerase chain reaction (P...

Embodiment 2

[0078] Example 2: Detection of SNPs associated with systemic lupus erythematosus on human ABCG2 and CYP2E1 genes

[0079] This example describes a method for detecting and identifying one or more of the SNPs described above. Partial target regions of the human ABCG2 gene and CYP2E1 gene will be used as templates to synthesize PCR products. Table 3 lists several pairs of specific primers, each pair can be used to amplify a specific target region.

[0080] Table 3: Primers for PCR and DNA sequencing of ABCG2 and CYP2E1 genes

[0081] single nucleotide polymorphism site name

forward primer

reverse primer

Sequencing primers

Optimum annealing temperature

51523T>G and rs2231148

CTACCACTCTCCCCAAAGCA (SEQ ID NO: 2)

CGTGGTGGTGGATGTCTGTA (SEQ ID NO: 3)

SEQ ID NO: 2

60℃

rs8192772

GTTCTTGGTTTTCCCAGCTCT (SEQ ID NO: 5)

CTGAGTCTTCCCCATGCTACATAA (SEQ ID NO: 6)

SEQ ID NO: 5

60℃

rs2480256

GAAAACGAGTGTGTGC...

Embodiment 3

[0091] Example 3: A kit for detecting 51523T>G, rs2231148 of the ABCG2 gene and rs8192772 and rs2480256 of the CYP2E1 gene

[0092] This example describes a kit, which is used to detect and determine the sequence of one or several single nucleotide polymorphism sites mentioned above, so as to obtain the genotype of the tested individual. The test results can be used to predict the individual's susceptibility to systemic lupus erythematosus.

[0093] The kit contains the following primers: SEQ ID NO:2, SEQ ID NO:3, SED ID NO:5, SED ID NO:6, SED ID NO:8 and SED ID NO:9. The kit also contains the following reagents for PCR amplification of fragments of the ABCG2 and CYP2E1 genes: 1.5 mM magnesium ions, 200 μM four bases, positive control human template genomic DNA, and polymerase. When using the kit, the total volume of the polymerase chain reaction is 20 microliters, and the polymerase chain reaction is carried out using a thermal cycler according to the following steps: 95 deg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a detection of four sites of single nucleotide polymorphism (SNP) which are arranged on two human body xenobiotics metabolismenzyme genes including ABCG2 and CYP2E1 and which are associated with the systemic lupus erythematosus (SLE). The invention also can use four sites of single nucleotide polymorphism (SNP) to forecast the liability of systemic lupus erythematosus and to determine the drug to cure the systemic lupus erythematosus. The information provided by the invention is helpful for preventing systemic lupus erythematosus (SLE) and for developing effective new treatments.

Description

technical field [0001] The present invention relates to the detection of 2 human heterologous substance metabolizing enzyme genes: 4 single nucleotide polymorphism (SNP) sites associated with systemic lupus erythematosus (SLE) on ABCG2 and CYP2E1, and Application of these single nucleotide polymorphisms to predict susceptibility to systemic lupus erythematosus. The present invention also provides a method helpful for preventing systemic lupus erythematosus, which can also be applied to screening appropriate treatments for different types of systemic lupus erythematosus. Background technique [0002] Systemic lupus erythematosus is a chronic autoimmune disease characterized by the production of autoantibodies that lead to multi-tissue inflammation. SLE can affect any part of the body, but most commonly damages the heart, joints, skin, lungs, blood vessels, liver, kidneys, and nervous system. SLE predominantly affects women of childbearing age, with approximately 9 females o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 张浩沈南廖凌虹吴汪黔生
Owner 廖凌虹