A kind of molecular marker primer and method for differentiating long handle almond, Mongolian almond and elm leaf plum

A long-stalked almond and molecular marker technology, applied in biochemical equipment and methods, microbiological determination/inspection, DNA/RNA fragments, etc., can solve problems such as complex structure and composition, low copy number of plant mtDNA, limited application range, etc. , to achieve the effects of improving detection speed and efficiency, fast and simple detection system, and simple identification method

Active Publication Date: 2022-05-13
INNER MONGOLIA AGRICULTURAL UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the plant DNA barcodes, available genomic DNAs include nuclear genomic DNA (nrDNA), chloroplast genomic DNA (cpDNA) and mitochondrial genomic DNA (mtDNA). Among them, nrDNA has the fastest evolution rate and is a fully autonomous genetic system in the nucleus. The structure and composition are extremely complex, each gene family forms a functional regulatory network, and many genes have multiple copies, and there are problems such as orthologs and paralogs
However, mtDNA is prone to gene rearrangement, duplication and loss, and the copy number of plant mtDNA is low, so it is difficult to extract and purify. Therefore, the application range of nrDNA and mtDNA in plant identification is limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of molecular marker primer and method for differentiating long handle almond, Mongolian almond and elm leaf plum
  • A kind of molecular marker primer and method for differentiating long handle almond, Mongolian almond and elm leaf plum
  • A kind of molecular marker primer and method for differentiating long handle almond, Mongolian almond and elm leaf plum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] 1. Collection of Leaf Samples

[0053] The samples were identified and collected by the Inner Mongolia Forest Tree Breeding Center, and 5 fresh, healthy, and pest-free leaf samples were collected from different origins of almonds, Mongolian almonds, and eucalyptus. As described in Table 1.

[0054] Table 1 Leaf samples and sources of almonds, Mongolian almonds and Yuyemei

[0055]

[0056] 2. Extraction of total genomic DNA from leaf samples

[0057] The total genomic DNA of the leaf sample was extracted by the plant DNA rapid extraction kit, and its quality was detected based on 1.2% agarose gel electrophoresis, and the results showed as follows: figure 1 As mentioned above, the brightness and uniformity of the electrophoresis strips and the light spots of the sample port are all good, indicating that the samples are of high purity and no pollution, and can be directly used in subsequent molecular biology experiments.

[0058] 3. PCR amplification for the target ...

Embodiment 2

[0074] Embodiment 2 result analysis

[0075] After the PCR product was purified, two-way sequencing was performed, and the sequences of the leaf sample group of Long handle almond, Mongolian almond leaf sample group and Yuyemei leaf sample group were compared. The result of the alignment of the trnK-UUU fragment sequence of the chloroplast gene with the sample group of Yuyemei leaves is as follows:

[0076] Almonds with long handles:

[0077] ACTCGAACCCGGAACTAGTCGGATGGAGTAGATAATTTCCTTGATTAGAAAATTTTAAATAAAATAGGGAAAAA(A) + CCCCTCCCCAAACCGTGCTTGCATTTTTCATTGCACACGGCTTTCCCTATGTATACATCTAAAATTCAGTCCCTTCCCTATACACGACTCTAAGAAAGTTGAATACTCAGTTGATCGACCCTCAATCTTACTGTATGAACATTTCATAATAGAAATAAATGCAAATTTTTT(ATAGAAATAAATGCAAATTTTTT) + GTTATCTCTTTCATTATTTAAAGA G AATTCCATTTCTACGATCGCATAACCAATTATTCATAATTGATTAGATCATTGATGCAAAAAATA T CCAAATACCAAATCCGACCTCTATAAAATTTCTTAAAAGTAAAAGTATAAGAAGCTCTTGGGAAGACCAA A GAAAGAATCTGTTCTTCTTCCGTAAAGAATTCTTCCAATAATTTAGAACCTAATCTTTTCAAAAAAGTTCGTACAGTACTTTTTGTGTTTAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

A kind of molecular marker primer and method for distinguishing long handle almond, mongolian almond and elm leaf plum, described molecular marker primer comprises forward primer and reverse primer; The sequence of described forward primer tKF: ACTCGAACCCGGAACTAG, described reverse primer Sequence of tKR: CGACCGATTTCTGCGTAT. The identification method comprises the following steps: (1) collection of leaf samples; (2) extraction of total genomic DNA from leaf samples; (3) using molecular marker primers for identifying almonds, Mongolian almonds and elm leaf plums, to step (2) The target gene in the total genomic DNA of the leaf sample is amplified to obtain the amplified product; (4) the amplified product in step (3) is purified and sequenced; (5) the sequenced result in step (4) is carried out comparative analysis. The base difference based on the trnK‑UUU intergenic region can be used as a molecular marker primer for the germplasm differentiation of Amygdalus lanceolata, Amygdalus mongolica and Prunus ulmoides, and the identification method is simple and easy to operate.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, it relates to a molecular marker primer and a method for identifying long-handled almonds, Mongolian almonds and elm leaf plums. Background technique [0002] Long handle almond (Prunus pedunculata Pall), Mongolian almond (Prunus mongolica Maxim) and elm leaf plum (Prunus triloba Lindl) are unique economic forest tree species in my country. Extremely cold and drought resistant, it is the preferred tree species for ecological construction in semi-arid desertification areas in my country. After research, it was found that the oil content of long-stalked almond seeds is about 56%, which is higher than that of Mongolian almonds and elm plums. Its oil is rich in unsaturated fatty acids (96%-98%), ranking first among all vegetable oils. More than 70%, it belongs to high oleic vegetable oil, which is equivalent to olive oil known as "the queen of edible vegetable oil", and is a functi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 包文泉敖敦
Owner INNER MONGOLIA AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap