A strain of Neurospora crassa DZ01 and its application in fermented Eucommia ulmoides leaf feed

Abstract

This invention relates to the Neurospora crassa strain DZ01 and its application in fermented Eucommia ulmoides leaf feed. It effectively solves the problem of significantly increasing the content of nutrients and bioactive components in Eucommia ulmoides leaf feed by using Neurospora crassa strain DZ01, while effectively reducing the content of anti-nutritional components such as lignocellulose, tannins, and phytic acid, thus greatly improving the feed value and health benefits of Eucommia ulmoides leaves for livestock and poultry. A Neurospora crassa strain DZ01, with preservation number CGMCC No: 40194, combines liquid fermentation of seed culture with solid-state fermentation, resulting in high biomass yield per unit volume, richer metabolites in the solid-state fermentation culture, low water content in the culture medium, no need for wastewater treatment, and less environmental pollution, meeting the national needs for developing ecological agriculture and pollution-free food industrialization.

Description

Technical Field

[0001] The invention relates to microorganisms and fermented feed thereof, in particular to a Neurospora crassa DZ01 strain and application thereof in fermenting eucommia leaf feed. Background Art

[0002] With the rapid economic development and the continuous improvement of people's living standards, the market demand for livestock products has increased significantly, and insufficient feed sources have become an important factor restricting the development of animal husbandry. In 2021, my country's total soybean imports were 96.537 million tons, and the total corn imports were 28.35 million tons, and they showed an increasing trend year by year. Among them, 70% of imported soybeans and 50% of imported corn were used for feed, indicating that there is a serious gap in protein feed and energy feed in my country. Therefore, the development of new protein feed resources and feed and feed additives with special effects is of great significance to promote the healthy and rapid development of my country's animal husbandry industry and meet the market's growing demand for animal products.

[0003] Eucommia ulmoides Eucommia ulmoides ) is a perennial deciduous tree belonging to the Eucommia family and the Eucommia genus. It is a rare traditional Chinese medicinal material unique to my country. "Shennong's Herbal Classic" records that Eucommia is warm in nature, sweet in taste and non-toxic. Eucommia leaves are not only rich in nutrients such as protein, trace elements, vitamins, but also have pharmacological and physiological functions. Studies have shown that Eucommia leaves and Eucommia bark have similar active ingredients and have similar pharmacological effects in anti-inflammatory, bactericidal, anti-oxidant, and improving body immunity. Adding Eucommia leaf feed to the diet can significantly improve the immune function of the animal body, enhance resistance to disease, promote animal health, improve production performance, increase feed utilization efficiency, and improve meat quality and flavor. In 2012, my country has included Eucommia leaves and Eucommia bark in the "Feed Raw Materials Catalog". As a type of functional feed raw material, Eucommia leaves and their extracts are used in livestock, poultry, aquatic products and some ruminant feeds with significant effects and broad market prospects.

[0004] Eucommia leaves are rich in cellulose, hemicellulose and lignin. These lignocellulose components are cross-linked with each other, which hinders the release and utilization of the nutrients and biological efficacy components in Eucommia leaves. Tannins in Eucommia leaves are easily combined with nutrients in feed, resulting in insufficient utilization of nutrients and reducing the nutritional value of feed. Excessive tannin content also affects the palatability of feed, leading to a decrease in animal feed intake. Phytic acid in Eucommia leaves affects protein and mineral metabolism and the activity of digestive enzymes in monogastric animals. By treating Eucommia leaves with microbial fermentation technology, the lignocellulose components of Eucommia leaves can be degraded by means of microbial fermentation and the release of various bioactive substances by microorganisms during growth and metabolism, significantly increasing the content of nutrients and biological efficacy components in Eucommia leaves, effectively reducing the content of anti-nutritional components such as lignocellulose, tannins, and phytic acid, and greatly improving the feeding value and livestock and poultry health value of Eucommia leaves.

[0005] At present, there is a lack of research at home and abroad on the use of microorganisms to ferment Eucommia ulmoides feed, the development of high-quality and efficient Eucommia ulmoides feed products, and the increase of the application scope and application effect of Eucommia ulmoides feed in livestock and poultry breeding production. Neurospora crassa ) is a member of the phylum Ascomycoya, class Ascomycetes, order Sordariales, family Sordariaceae, genus Neurocystis. Neurospora ) fungi, the cellulase, laccase and various bioactive substances produced by its metabolism lay a good foundation for its fermentation of woody plant feed resources with high lignocellulose content. Therefore, it is of great value to breed a new strain of Neurospora crassa with the function of fermenting Eucommia ulmoides leaves and the application of this strain in fermenting Eucommia ulmoides leaves feed, but there has been no public report so far. Summary of the invention

[0006] In view of the above situation, in order to overcome the defects of the prior art, the purpose of the present invention is to provide a strain of Neurospora crassa DZ01 and its application in fermenting Eucommia ulmoides leaf feed, which effectively solves the problem of using Neurospora crassa DZ01 strain to ferment Eucommia ulmoides leaf feed, significantly improves the content of nutrients and biologically effective components in Eucommia ulmoides leaf feed, effectively reduces the content of anti-nutritional components such as lignocellulose, tannins, phytic acid, etc. in Eucommia ulmoides leaf feed, and greatly improves the feeding value and livestock and poultry health value of Eucommia ulmoides leaf.

[0007] The technical solution provided by the present invention is a strain of Neurospora crassa DZ01, which is classified and named as Neurospora crassa ( Neurospora crassa ), deposited in the General Microbiology Center of China Microorganism Culture Collection Committee on May 26, 2022, with the deposit number CGMCC No: 40194, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The method for using the Neurospora crassa DZ01 strain in fermented eucommia leaf feed comprises the following steps:

[0009] (1) Preparation of culture medium:

[0010] ① Preparation of test tube slant culture medium (PDA culture medium): weigh 200 g potato, 20 g glucose, 2% agar, dilute to 1000 mL with distilled water, sterilize at 121°C for 20 min to prepare test tube slant culture medium (PDA culture medium);

[0011] ②Prepare liquid fermentation seed medium: glucose 30.0g, peptone 20.0g, NaNO33.0g, MgSO40.5g, KCl 0.5g, FeSO40.01g, K2HPO41.0g, distilled water to 1000mL, natural pH, sterilize at 121℃ for 20min;

[0012] ③ Eucommia leaf solid fermentation medium: Mix the culture medium raw materials with a mass ratio (m / m) of 90% Eucommia leaf dry powder, 5% molasses, 3% ammonium sulfate, and 2% BHT (butylated hydroxytoluene) evenly, add water to make the water content reach 58-65%, natural pH, and sterilize at 121℃ for 120min;

[0013] Preparation of the Eucommia leaf powder: Collect the Eucommia leaf powder randomly from the high, middle and low parts of 3-5 year old Eucommia saplings in July to August, dry or air-dry under natural conditions to a moisture content of less than 10%, and crush through a 30-mesh sieve;

[0014] The molasses is a by-product of the sugar industry. The product contains not only nutrients such as sugars, proteins, vitamins, and minerals, but also biologically active substances such as oligosaccharides, phospholipids, and phenols. In the field of animal husbandry, molasses can be used as an energy feed to improve the production performance and feed conversion efficiency of animals. In the fermentation medium, it is usually an energy and nutritional source for the growth and metabolism of microorganisms. The commercially available molasses is a viscous, dark brown, semi-fluid substance with a total sugar content of 48.0-49.0% and a crude protein content of 3-6%.

[0015] The ammonium sulfate is a commercially available feed additive. The pure product is colorless and transparent orthorhombic crystals. The aqueous solution is acidic and easy to absorb moisture. After absorbing moisture, it solidifies into blocks. The content of effective ingredients is ≥95.0%. It is usually a nitrogen nutrient source for microbial growth and metabolism in the fermentation medium.

[0016] The BHT (butylated hydroxytoluene) is a commercially available feed additive used as a feed antioxidant. It is colorless, white or off-white crystal or crystalline powder, with an active ingredient content of ≥ 98.5%. It can be used as a fermentation aid in the fermentation medium to affect the content of antioxidant substances in microbial metabolites.

[0017] (2) Expansion culture

[0018] Take one ring of Neurospora crassa DZ01 strain and inoculate it on a test tube slant medium (PDA medium) for amplification culture, and culture it in the dark at 28-30°C for 115-120 hours;

[0019] (3) Seed liquid fermentation culture

[0020] 140-160 mL of liquid fermentation seed culture medium is placed in a container, spore powder of Neurospora crassa DZ01 strain amplified and cultured in a test tube slant culture medium (PDA culture medium) is inoculated, and cultured in the dark for 70-75 hours at 28-30° C. and a shaking speed of 180-220 r / min;

[0021] (4) Solid fermentation of Eucommia ulmoides leaves

[0022] Sterilize the constant temperature incubator, stainless steel fermentation tray, mat cloth, cover cloth, shovel, measuring cup and other fermentation utensils, first spread the mat cloth on the bottom of the stainless steel fermentation tray and cover the four edges of the fermentation tray, weigh the solid fermentation medium of Eucommia leaves, cover the fermentation tray with a thickness of 8 cm, measure the seed culture solution with a measuring cup at a ratio of 6-8% of the total mass of the solid fermentation medium of Eucommia leaves, pour it into the solid fermentation medium of Eucommia leaves, stir evenly, cover the surface of the culture medium with a cover cloth, and then put the fermentation tray into the incubator; set the temperature of the constant temperature incubator to 29-31°C from 0 to 72h, and set the temperature to 27-29°C after 72h, and incubate for 1 h. The humidity in the incubator is maintained at 75-85% for 0-48 hours, 68-72% for 49-72 hours, and the natural relative humidity is maintained after 72 hours. After 96 hours of fermentation, observe every 24 hours. When the surface of the culture medium is covered with hyphae and the hyphae penetrate into the bottom of the culture medium, and the culture medium forms a bacterial block, it indicates that the fermentation culture is completed. Send the fermentation culture into a boiling fluidized bed drying oven and dry it below 60°C. Or place the fermentation culture indoors and let the bacterial block dry naturally. When the moisture content reaches below 10%, crush it into powder that can pass through a 30-mesh sieve and package it to make fermented Eucommia leaf feed.

[0023] The present invention uses Neurospora crassa ( Neurospora crassa ) DZ01 strain is used as the fermentation strain, and the solid fermentation process is adopted. On the basis of liquid fermentation and culturing seeds, the advantages of solid fermentation per unit volume biomass output is higher than that of liquid fermentation, the metabolites in the solid fermentation culture are richer, the water content of the fermentation medium is low, no wastewater treatment is required, and there is less environmental pollution. The results show that after fermentation, the nutritional components and biological efficacy components of Eucommia leaf feed are significantly increased, and the contents of anti-nutritional components such as lignocellulose, tannins, and phytic acid are significantly reduced, which greatly enhances the feeding value and livestock and poultry health value of Eucommia leaf feed. After the country prohibits the addition of antibiotics in feed and breeding, the Eucommia leaf feed prepared by fermenting Neurospora crassa DZ01 strain created by the present invention has the potential and efficacy to replace antibiotics and chemical synthetic drugs, which meets the needs of the country to vigorously develop ecological agriculture and the industrialization of pollution-free food, can be industrialized and promoted, has broad market prospects, and huge economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a characteristic diagram of the plate colonies of the Neurospora crassa DZ01 strain of the present invention.

[0025] Figure 2 It is an agarose gel PCR electrophoresis diagram of the ITS sequence of Neurospora crassa DZ01 strain of the present invention.

[0026] Figure 3 This is a diagram showing the Blast comparison results of ITS sequencing of Neurospora crassa DZ01 strain of the present invention. DETAILED DESCRIPTION

[0027] The specific implementation modes of the present invention are described in detail below in combination with embodiments and specific situations.

[0028] The present invention discloses a strain of Neurospora crassa DZ01, which is classified and named as Neurospora crassa ( Neurospora crassa ), deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 26, 2022, with the deposit number CGMCCNo: 40194, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing;

[0029] The Neurospora crassa DZ01 strain is based on Neurospora crassa ( Neurospora crassa ) was used as the original strain. Using ultraviolet microbial mutagenesis technology, a strain of Neurospora crassa DZ01 that can ferment Eucommia ulmoides leaf feed was selected. The fermentation of Eucommia ulmoides leaf feed by this strain can significantly increase its nutritional components and biological efficacy components, and significantly reduce the content of anti-nutritional components such as lignocellulose, tannins, and phytic acid, greatly enhancing the feeding value and livestock and poultry health value of Eucommia ulmoides leaf feed. The strain was observed for morphological characteristics, microbial culture experiments, and molecular biological identification, and was classified and named Neurospora crassa ( Neurospora crassa ) DZ01 strain, the specific breeding method includes:

[0030] 1. Materials:

[0031] 1.1 Bacterial strains

[0032] Neurospora crassa Neurospora crassa ) The original strains were from the Institute of Microbiology, Chinese Academy of Sciences;

[0033] 1.2 Culture medium

[0034] Test tube slant medium (PDA medium): weigh 200 g potato, 20 g glucose, 2% agar, dilute to 1000 mL with distilled water, sterilize at 121°C for 20 min to prepare test tube slant medium;

[0035] Mutagenic medium (plate culture medium): weigh 10 g sucrose, 0.1 g CaCl2, 0.1 g NaCl, 1 g NH4NO3, 5 g ammonium tartrate, 4 ug biotin, 0.5 g MgSO4.7H2O, 1 g KH2PO4, 1 mL trace element solution, 2% agar, distilled water to 1000 mL, pH 6.0, sterilize at 121°C for 20 min to prepare mutagenic medium (plate culture medium);

[0036] Preparation of the trace element solution: weigh 88 mg of NaB4O7.10H2O, 393 mg of CuSO4.5H2O, 910 mg of Fe2(SO4)3.10H2O, and 8807 mg of ZnSO4.7H2O, dilute to 1000 mL with distilled water, and sterilize at 121° C. for 20 min;

[0037] Liquid fermentation seed medium: glucose 30.0 g, peptone 20.0 g, NaNO3 3.0 g, MgSO4 0.5 g, KCl 0.5 g, FeSO4 0.01 g, K2HPO4 1.0 g, distilled water to 1000 mL, sterilized at 121 ° C for 20 min;

[0038] Eucommia leaf solid fermentation medium: evenly mix the culture medium raw materials with a mass ratio (m / m) of 90% Eucommia leaf dry powder, 5% molasses, 3% ammonium sulfate, and 2% BHT (butylated hydroxytoluene), add water to make its moisture content reach 58-65%, and sterilize at 121°C for 120 min.

[0039] Preparation of the Eucommia leaf powder: Collect the Eucommia leaf powder randomly from the high, middle and low parts of 3-5 year old Eucommia saplings in July to August, dry or air-dry under natural conditions to a moisture content of less than 10%, and crush through a 30-mesh sieve;

[0040] The molasses is a by-product of the sugar industry. The product contains not only nutrients such as sugars, proteins, vitamins, minerals, etc., but also bioactive substances such as oligosaccharides, phospholipids, phenols, etc. In the field of animal husbandry, molasses can be used as energy feed to improve animal production performance and feed conversion efficiency. In the fermentation medium, it is usually an energy and nutrition source for microbial growth and metabolism. The commercially available molasses is a viscous, dark brown, semi-fluid substance with a total sugar content of 48.0-49.0% and a crude protein content of 3.0-6.0%.

[0041] The ammonium sulfate is a commercially available feed additive. The pure product is colorless and transparent orthorhombic crystals. The aqueous solution is acidic and easy to absorb moisture. After absorbing moisture, it solidifies into blocks. The content of effective ingredients is ≥95.0%. It is usually a nitrogen nutrient source for microbial growth and metabolism in the fermentation medium.

[0042] The BHT (butylated hydroxytoluene) is a commercially available feed additive, mainly used as a feed antioxidant, colorless, white or off-white crystal or crystalline powder, with an active ingredient content of ≥ 98.5%, and can be used as a fermentation aid in the fermentation medium to affect the content of antioxidant substances in microbial metabolites;

[0043] 2. Screening Method

[0044] 2.1 Activation of original strains

[0045] Take one ring of the original strain of Neurospora crassa and inoculate it on a test tube slant medium (PDA medium) and culture it at 28℃ in the dark for 120h;

[0046] 2.2 Preparation of mutagenic spore suspension

[0047] Take one tube of activated cultured Neurospora crassa test tube slant culture medium, place the spores of Neurospora crassa cultured in the test tube slant into a 250mL sterile conical flask containing glass beads and 50mL distilled water in a clean bench, shake at 28°C and a shaker speed of 200r / min for 30min, observe that the spore mass is completely opened, take the spore suspension and dilute it with sterile distilled water, count it with a hemocytometer, and prepare a spore suspension with a concentration of 1×10 4 Pieces / mL;

[0048] 2.3 Ultraviolet mutagenesis treatment

[0049] Take 1 mL of the prepared spore suspension and apply it on the mutagenesis medium (plate medium), open the cover of the plate, blow dry in the clean bench, place the plate under a 30W ultraviolet lamp at 30 cm, set the irradiation time to 0, 240s, 300s, 360s, 420s, 480s, 540s, 600s, cover the plate after irradiation and quickly wrap it up, do three parallel cultures for each group, culture at 28°C in the dark for 144h, observe and record the mycelium growth every 24h, calculate the mycelium growth rate at each irradiation time, and select the irradiation time when the mycelium growth rate is 70-80% as the optimal ultraviolet irradiation dose;

[0050] 2.4 Plate initial screening

[0051] Select the materials to be separated that have been irradiated with the optimal dose of ultraviolet rays, grow rapidly on the plate culture medium, have transparent mycelium, are colorless or slightly red, and have round conidia, are orange-yellow or pink, and perform parallel streaking, fan-shaped streaking or other forms of continuous streaking on the sterile mutagenesis medium (plate culture medium). The number of microbial cells will decrease with the increase in the number of streaking times, and gradually disperse until the microorganisms can be completely dispersed; after culturing at 28°C in the dark, single colonies are obtained on the surface of the plate culture medium, and single colonies with relatively large colonies are selected for re-cultivation on the plate culture medium, and the cultivation is repeated 3 times, and the selected target colonies are selected to obtain plate screening strains numbered DZ01, DZ02, DZ03, DZ04, and DZ05;

[0052] 2.5 Fermentation rescreening

[0053] The five strains obtained from the initial screening on the plate were subjected to a 500 mL triangular flask solid fermentation test. 20-30 g of Eucommia ulmoides leaf solid fermentation medium was placed in a 500 mL triangular flask, and the single colony obtained from the initial screening on the plate was inoculated and cultured at 28°C for 96 h. The cellulase activity was used as the breeding index for the secondary screening of the strain fermentation, and the cellulase activity was measured. The results are shown in Table 1.

[0054] Table 1 Ability of fermentation-screened strains to produce cellulase

[0055] Strain number DZ01 DZ02 DZ03 DZ04 DZ05 Enzyme activity (μ / g) 5.76 3.89 4.38 4.55 3.65

[0056] Table 1 shows that the DZ01 strain obtained by the initial plate screening has the strongest ability to produce cellulase, indicating that this strain has the best potential for degrading lignocellulosic anti-nutritional components in the process of fermenting Eucommia ulmoides leaf feed. The definition of cellulase activity and its detection method are implemented in accordance with GB / T 23881-2009 (filter paper method for determination of feed cellulase activity).

[0057] 2.6 Genetic stability of DZ01 strain

[0058] According to the "fermentation re-screening" method, the DZ01 strain solid fermentation Eucommia leaf feed test was carried out. The test was carried out for 5 generations of fermentation culture, and the cellulase activity was measured respectively. The results are shown in Table 2:

[0059] Table 2 Genetic stability of cellulase production by DZ01 strain

[0060] Strain generation F1 F2 F3 F4 F5 Enzyme activity (μ / g) 5.76 5.77 5.74 5.75 5.73

[0061] As shown in Table 2, the cellulase activity of DZ01 strain can be maintained at about 5.76 μ / g after five consecutive generations of fermentation of Eucommia leaf feed, indicating that the cellulase production of DZ01 strain has good genetic stability.

[0062] 2.7 Identification and preservation of DZ01 strain

[0063] DZ01 strain is cultured on a plate culture medium. The colony growth has loose mesh long hyphae with stripes on the wall. The mycelium is transparent, colorless or slightly red, with septa, branches, multiple nuclei, and a diameter of 0.015mm. Asexual reproduction can form conidia, which are generally oval, without stripes on the wall, and form branched chains at the top of aerial hyphae with a diameter of 0.006mm. Conidia are orange or pink. The characteristics of DZ01 strain culture on a plate culture medium are as follows: Figure 1 As shown in Figure 2, it can be seen that the DZ01 strain meets the basic morphological characteristics and biological characteristics of fungi.

[0064] The fungal endogenous transcribed spacer (ITS) of the DZ01 strain was identified and the genome was sequenced. A small amount of the DZ01 strain cultured on the plate medium was taken, and the extracted DNA sample was used as the amplification template for the PCR reaction. The universal fungal primers ITS1 and ITS4 were used for amplification. PCR reaction system (25.0μL): PCR Mix 21.0μL, 1.0µL each of forward and reverse primers (5p), and 2.0µL of template (ng / μL). PCR reaction conditions: 96℃ pre-denaturation for 5min, 96℃ denaturation for 20s, 56℃ annealing for 30s, 72℃ extension for 30s, for a total of 35 cycles. Extend at 72℃ for 10min, and finally store at a constant temperature of 4℃ for later use. The agarose gel PCR electrophoresis of the ITS sequence of the DZ01 strain is shown in the figure below. Figure 2 As shown. The PCR amplification product after gel recovery and purification was sequenced by BGI Technology Service Co., Ltd. The full length of the ITS gene of the DZ01 strain is 560bp, and the sequencing results are as follows:

[0065] TGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGC

[0066] CTCGGGCGCTGGCGGTCCGGAAAGGCCTTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTG

[0067] CCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAA

[0068] CTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATC

[0069] AGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCC

[0070] GTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC

[0071] The ITS sequencing results of strain DZ01 were submitted to the GenBank website for BLAST homology comparison analysis. Figure 3 shown. Figure 3 The results showed that the ITS gene sequence of the DZ01 strain provided by the present invention was similar to that of Neurospora crassa ( Neurospora crassa )(genbank:MH860307.1) with a similarity of more than 99%. Based on the morphological characteristics, biological characteristics and ITS sequence analysis of strain DZ01, it was identified as Neurospora crassa ( Neurospora crassa ) strain, deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on May 26, 2022, with the deposit number CGMCC No: 40194, address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0072] The method for using the Neurospora crassa DZ01 strain in fermented eucommia leaf feed comprises the following steps:

[0073] (1) Preparation of culture medium:

[0074] ① Preparation of test tube slant culture medium (PDA culture medium): weigh 200 g potato, 20 g glucose, 2% agar, dilute to 1000 mL with distilled water, sterilize at 121°C for 20 min to prepare test tube slant culture medium (PDA culture medium);

[0075] ②Prepare liquid fermentation seed medium: glucose 30.0g, peptone 20.0g, NaNO33.0g, MgSO40.5g, KCl 0.5g, FeSO40.01g, K2HPO41.0g, distilled water to 1000mL, natural pH, sterilize at 121℃ for 20min;

[0076] ③ Eucommia leaf solid fermentation medium: Mix the culture medium raw materials with a mass ratio (m / m) of 90% Eucommia leaf dry powder, 5% molasses, 3% ammonium sulfate, and 2% BHT (butylated hydroxytoluene) evenly, add water to make the water content reach 58-65%, natural pH, and sterilize at 121℃ for 120min;

[0077] (2) Expansion culture

[0078] Take one ring of Neurospora crassa DZ01 strain and inoculate it on a test tube slant medium (PDA medium) for amplification culture, and culture it at 28°C in the dark for 120 hours;

[0079] (3) Seed liquid fermentation culture

[0080] 150 mL of liquid fermentation seed medium was placed in a 500 mL Erlenmeyer flask, and spore powder of Neurospora crassa DZ01 strain cultured in a test tube slant medium (PDA medium) was inoculated and cultured in the dark at 28°C and a shaking speed of 200 r / min for 72 h.

[0081] (4) Solid fermentation of Eucommia ulmoides leaves

[0082] Sterilize a constant temperature incubator, a stainless steel fermentation tray, a mat, a cover cloth, a shovel, and a measuring cup. First, spread the mat cloth on the bottom of the stainless steel fermentation tray and cover the four edges of the fermentation tray. Weigh the solid fermentation medium of Eucommia leaves and cover the fermentation tray to a thickness of 8 cm. Use a measuring cup to measure the seed culture solution and pour it into the solid fermentation medium of Eucommia leaves at a ratio of 6 to 8% of the total mass of the solid fermentation medium of Eucommia leaves. Stir evenly, cover the surface of the culture medium with a cover cloth, and then put the fermentation tray into a constant temperature incubator. Set the temperature of the constant temperature incubator to 30°C from 0 to 72h, and set the temperature to 28°C after 72h. The humidity in the incubator is maintained at 80% for 0 to 48 hours, and at 70% for 49 to 72 hours. After 72 hours, the relative humidity of the constant temperature incubator is maintained at a natural relative humidity. After 96 hours of fermentation, observe every 24 hours. When the surface of the culture medium is covered with hyphae and the hyphae penetrate into the bottom of the culture medium, and the culture medium forms a bacterial block, it indicates that the fermentation culture is completed. Send the fermentation culture into a boiling fluidized bed drying oven and dry it below 60°C. Or place the fermentation culture indoors and let the bacterial block dry naturally. When the moisture content reaches below 10%, crush it into a powder that can pass through a 30-mesh sieve and package it to make fermented eucommia leaf feed.

[0083] The fermented eucommia leaf feed of the present invention can be effectively used for livestock and poultry breeding. The present invention adopts a solid fermentation process, based on the liquid fermentation and culturing seeds, combined with the advantages that the biomass output per unit volume of solid fermentation is higher than that of liquid fermentation, the metabolites in the solid fermentation culture are richer, the water content of the fermentation medium is low, no wastewater treatment is required, and the environmental pollution is less. After fermentation, the eucommia leaf feed has significantly increased nutritional components and biological efficacy component contents, and the content of anti-nutritional components such as lignocellulose, tannins, and phytic acid is significantly reduced, which greatly enhances the feeding value and livestock and poultry health value of the eucommia leaf feed. The relevant experimental data are as follows:

[0084] 1. Effect of Eucommia ulmoides leaf fermentation on its feeding value and livestock and poultry health value

[0085] 1.1 Experimental methods

[0086] 1000 kg of samples before and after fermentation were randomly selected and packed into 4 sample bags, each bag weighing 500 g. The nutrient content, anti-nutrient content and biological efficacy content of Eucommia ulmoides leaves before and after fermentation were measured respectively, and the average of the parallel sample test results was taken.

[0087] 1.2 Determination method

[0088] The crude protein, free amino acids, crude fat and organic matter contents of nutrients were tested according to the testing methods of GB / T6432-2018, GB / T30987-2020, GB / T6433-2006 and GB / T6438-2007 respectively. The crude fiber, neutral detergent fiber, acid detergent fiber, acid detergent lignin, phytic acid and tannin contents of anti-nutritional ingredients were tested according to the testing methods of GB / T6434-2006, GB / T20806-2006, NY / T1459-2007, GB / T20805-2006, GB5009.153-2016 and GB / T27985-2011 respectively. The active ingredients chlorogenic acid and total flavonoids were tested according to the methods of GB / T22250-2008 and NY / T2010-2011; aucubin and geniposide were tested according to the method of Liu Jing et al. (Liu Jing, Lv Haitao. Study on the extraction process of aucubin and geniposide from Eucommia ulmoides leaves by orthogonal test method [J]. Central South Pharmacy, 2010, 8(9): 661-664.); total polyphenols were tested according to the method of Zhang Linjie et al. (Zhang Linjie, Peng Sheng , Zhang Changwei, et al. Optimization of ultrasonic-assisted extraction of total polyphenols from Eucommia ulmoides leaves by response surface methodology [J]. Food Industry Science and Technology, 2014, 35(8): 228-233.) The detection method of lycopene was used according to the detection method of Li Chenchen et al. (Li Chenchen, Chen Gang, Su Wei, et al. Study on the production of lycopene and antioxidant activity of Neurospora crassa cultured on solid [J]. China Brewing, 2017, 36(4): 30-35.).

[0089] 1.3 Test results

[0090] The nutrient content, anti-nutritional content and biological efficacy content of Eucommia leaf feed before and after fermentation were tested by Henan Hairuizheng Testing Technology Co., Ltd. The test results are shown in Table 3.

[0091] Table 3 Results of determination of components in Eucommia leaf feed before and after fermentation

[0092] project Before fermentation After fermentation Detection basis Crude protein% 13.25 16.70 GB / T6432-2018 Free amino acid mg / g 1.24 3.61 GB / T30987-2020 Crude fat% 7.35 9.24 GB / T6433-2006 Organic matter% 90.37 91.85 GB / T6438-2007 Crude fiber % 10.35 7.66 GB / T6434-2006 Neutral detergent fiber% 43.50 33.91 GB / T20806-2006 Acid detergent fiber% 33.80 25.51 NY / T1459-2007 Acid detergent lignin% 16.45 12.20 GB / T20805-2006 Phytic acid mg / g 4.30 2.12 GB5009.153-2016 Tannin% 1.60 0.55 GB / T27985-2011 Chlorogenic acid% 2.48 4.05 GB / T22250-2008 Total flavonoids% 3.05 4.49 NY / T2010-2011 Aucubin% 1.36 1.75 Liu Jing et al. Study on the extraction technology of aucubin and geniposide from Eucommia ulmoides leaves by orthogonal test method [J]. Central South Pharmacy, 2010, 8(9): 661-664 Geniposidic acid% 2.23 2.66 Liu Jing et al. Study on the extraction technology of aucubin and geniposide from Eucommia ulmoides leaves by orthogonal test method [J]. Central South Pharmacy, 2010, 8(9): 661-664 Total polyphenols% 8.75 10.10 Zhang Linjie et al. Optimization of ultrasonic-assisted extraction of total polyphenols from Eucommia ulmoides leaves by response surface methodology[J]. Food Processing Science and Technology, 2014, 35(8): 228-233 Lycopene mg / g 0 1.95 Li Chenchen et al. Study on the production of lycopene and antioxidant activity of Neurospora crassa in solid culture[J]. China Brewing, 2017, 36(4): 30-35

[0093] The changes in the nutritional content, anti-nutritional content and biological efficacy content of Eucommia leaf feed before and after fermentation are shown in Table 4.

[0094] Table 4 Changes in the content of components of Eucommia leaf feed before and after fermentation

[0095] project Before fermentation After fermentation Change ratio (+ indicates increase, - indicates decrease) Crude protein% 13.25 16.70 ＋26.04% Free amino acid mg / g 1.24 3.61 ＋191.13% Crude fat% 7.35 9.24 ＋25.71% Organic matter% 90.37 91.85 ＋1.64% Crude fiber % 10.35 7.66 －25.99% Neutral detergent fiber% 43.50 33.91 －22.05% Acid detergent fiber% 33.80 25.51 －24.53% Acid detergent lignin% 16.45 12.20 －25.84% Phytic acid mg / g 4.30 2.12 －50.70% Tannin% 1.60 0.55 －65.63% Chlorogenic acid% 2.48 4.05 ＋63.31% Total flavonoids% 3.05 4.49 ＋47.21% Aucubin% 1.36 1.75 ＋28.68% Geniposide% 2.23 2.66 ＋19.28% Total polyphenols% 8.75 10.10 ＋15.43% Lycopene mg / g 0 1.95 ＋195.00%

[0096] Eucommia leaves are rich in crude protein, amino acids, crude fat, organic matter and other nutrients required by animals, and are an excellent woody feed resource. Eucommia leaves are fermented by Neurospora crassa DZ01 strain, and part of the non-protein nitrogen contained therein is converted into bacterial protein through the metabolism of microorganisms, while the protein in the Eucommia leaves is degraded into small peptides, free amino acids, etc., which not only increases the crude protein content in the fermented Eucommia leaf feed, but also improves the digestibility and utilization rate of amino acids. The crude fat and organic matter content in the Eucommia leaf feed are also improved. The results in Table 4 show that compared with before fermentation, the crude protein content in the fermented Eucommia leaf feed increased by 26.04%, the free amino acid content increased by 191.13%, the crude fat content increased by 25.71%, and the organic matter content increased by 1.64%, indicating that the fermentation of Eucommia leaf feed by Neurospora crassa DZ01 strain significantly improves the nutritional value of Eucommia leaf feed.

[0097] Eucommia leaf feed usually contains a high content of anti-nutritional ingredients. The content of lignocellulose components often affects the digestion and absorption of nutrients by monogastric animals. Tannins are easily combined with nutrients in feed, resulting in insufficient utilization of nutrients and reducing the nutritional value of feed. Excessive tannin content also affects the palatability of feed, resulting in a decrease in animal feed intake. Phytic acid in Eucommia leaf feed affects protein and mineral metabolism and the activity of digestive enzymes in monogastric animals. The results in Table 4 show that the content of anti-nutritional ingredients such as crude fiber, neutral detergent fiber, acid detergent fiber, acid detergent lignin, phytic acid, and tannin in Eucommia leaf feed was reduced by 25.99%, 22.05%, 24.53%, 25.84%, 50.70%, and 65.63% respectively compared with before fermentation, indicating that the fermentation of Eucommia leaf feed by Neurospora crassa DZ01 strain significantly improved the feeding value of Eucommia leaf feed.

[0098] In addition to crude protein, amino acids, crude fat, organic matter and other feed nutrients, Eucommia leaf feed is also rich in chlorogenic acid, total flavonoids, aucubin, geniposide, total polyphenols and other unique biological efficacy components. The synergistic effect of these biological efficacy components not only makes Eucommia leaf feed have feeding value, but also has medicinal and health care value. Studies have shown that chlorogenic acid is an effective phenolic antioxidant. At the same time, chlorogenic acid has a certain antibacterial effect on Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Streptococcus dysgalactiae, Salmonella, Streptococcus uberis, etc., which can relieve animal intestinal oxidative stress and inflammatory response, maintain intestinal balance and immune function, and ensure animal intestinal health. Total flavonoids and total polyphenols are the most active antioxidants in Eucommia leaf feed. On the one hand, they improve the activity of antioxidant enzymes and enhance the antioxidant capacity of animal bodies. On the other hand, they can also enhance the immune function of animal bodies. Aucubin and geniposide have antibacterial, anti-inflammatory, antiviral and antioxidant functions on animal bodies. The results in Table 4 show that after fermentation, the chlorogenic acid content in Eucommia leaf feed increased by 63.31%, the total flavonoid content increased by 47.21%, the aucubin content increased by 28.68%, the geniposide content increased by 19.28%, and the total polyphenol content increased by 15.43%. Lycopene is an oxygen-free carotenoid, an isoprene compound composed of 11 conjugated double bonds and 2 non-conjugated double bonds, and has a strong antioxidant effect. Lycopene was not detected before fermentation, and the content reached 1.95 mg / g after fermentation, indicating that the fermentation process not only increased the content of chlorogenic acid, total flavonoids, total polyphenols, aucubin, and geniposide, but also increased the content of lycopene with antioxidant function in Eucommia leaf feed. The fermentation of Eucommia leaf feed by Neurospora crassa DZ01 strain increased the types and contents of the effective ingredients in the fermented Eucommia leaf feed, enhanced the livestock and poultry health value of the product, and helped to improve the application effect and economic value of the product.

[0099] In summary, the present invention provides a strain of Neurospora crassa DZ01 and its application in fermenting Eucommia leaf feed. The strain of Neurospora crassa DZ01 ferments Eucommia leaf feed, significantly improving the content of nutrients such as crude protein, free amino acids, crude fat, and organic matter in Eucommia leaf feed, while significantly reducing the content of anti-nutritional components such as crude fiber, neutral detergent fiber, acid detergent fiber, acid detergent lignin, phytic acid, and tannin, effectively improving the feeding value of Eucommia leaf feed. Eucommia leaf feed also has the characteristics of being both a medicine and a food. The Eucommia leaf feed prepared by fermenting the strain of Neurospora crassa DZ01 contains a large amount of bioactive substances such as chlorogenic acid, flavonoids, polyphenols, aucubin, geniposide, lycopene, etc., which can significantly improve the production performance of livestock and poultry, and enhance the body's immunity and antioxidant capacity. After the country banned the addition of antibiotics in feed and breeding, the Eucommia ulmoides leaf feed fermented by the Neurospora crassa DZ01 strain created by the present invention has the potential and efficacy to replace antibiotics and chemical synthetic drugs in the livestock and poultry breeding process, which meets the needs of the country to vigorously develop ecological agriculture and the industrialization of pollution-free food. The product can be industrialized, promoted and applied, has broad market prospects, and huge economic and social benefits.

Claims

1. A strain of Neurospora crassa ( Neurospora crassa ) DZ01 strain, the preservation number of the Neurospora crassa DZ01 strain is CGMCC No: 40194.

2. The method for using the Neurospora crassa DZ01 strain according to claim 1 in fermented Eucommia ulmoides leaf feed, characterized in that: The following steps are involved: (1) Preparation of culture medium: ① Preparation of test tube slant culture medium: weigh 200g potato, 20g glucose and 2% agar, dilute to 1000mL with distilled water, sterilize at 121℃ for 20min to prepare test tube slant culture medium; ②Prepare liquid fermentation seed medium: 30.0 g glucose, 20.0 g peptone, 3.0 g NaNO3, 0.5 g MgSO4, 0.5 g KCl, 0.01 g FeSO4 and 1.0 g K2HPO4, distilled water to 1000 mL, natural pH, sterilize at 121°C for 20 min; ③ Eucommia leaf solid fermentation medium: Mix the culture medium raw materials with a mass ratio of 90% Eucommia leaf dry powder, 5% molasses, 3% ammonium sulfate and 2% butylated hydroxytoluene, add water to make the water content reach 58-65%, natural pH, and sterilize at 121℃ for 120min; Preparation of the Eucommia leaf powder: Collect 3-5 year old Eucommia ulmoides saplings from July to August, randomly pick from high, middle or low parts, dry or air-dry under natural conditions to a moisture content of less than 10%, and crush through a 30-mesh sieve; (2) Expansion culture Take one ring of Neurospora crassa DZ01 strain and inoculate it on the test tube slant medium for amplification culture, and culture it in the dark at 28-30℃ for 115-120h; (3) Seed liquid fermentation culture 140-160 mL of liquid fermentation seed culture medium is placed in a container, spore powder of Neurospora crassa DZ01 strain cultured in a test tube slant culture medium is inoculated, and cultured in the dark for 70-75 hours at 28-30° C. and a shaking speed of 180-220 r / min; (4) Solid fermentation of Eucommia ulmoides leaves The constant temperature incubator, stainless steel fermentation tray, mat cloth, cover cloth, shovel and measuring cup fermentation utensils are sterilized, the mat cloth is first spread on the bottom of the stainless steel fermentation tray and the four edges of the fermentation tray are covered at the same time, the solid fermentation medium of Eucommia leaves is weighed and covered with a thickness of 8 cm of the fermentation tray, the seed culture solution is measured with a measuring cup and poured into the solid fermentation medium of Eucommia leaves at a ratio of 6-8% of the total mass of the solid fermentation medium of Eucommia leaves, the culture solution is stirred evenly, the cover cloth is then placed on the surface of the culture medium, and the fermentation tray is then placed in the incubator; the temperature of the constant temperature incubator is set at 29-31°C from 0 to 72h, and the temperature is set at 27-29°C after 72h, and the incubation temperature is kept at 150°C for 24 hours. The humidity in the incubator is maintained at 75-85% for 0-48 hours, 68-72% for 49-72 hours, and the natural relative humidity is maintained after 72 hours. After 96 hours of fermentation, observe every 24 hours. When the surface of the culture medium is covered with hyphae and the hyphae penetrate into the bottom of the culture medium, and the culture medium forms a bacterial block, it indicates that the fermentation culture is completed. Send the fermentation culture into a boiling fluidized bed drying oven and dry it below 60°C. Or place the fermentation culture indoors and let the bacterial block dry naturally. When the moisture content reaches below 10%, crush it into powder that can pass through a 30-mesh sieve and package it to make fermented Eucommia leaf feed.

3. The application method according to claim 2, characterized in that: The following steps are involved: (1) Preparation of culture medium: ① Preparation of test tube slant culture medium: weigh 200g potato, 20g glucose and 2% agar, dilute to 1000mL with distilled water, sterilize at 121℃ for 20min to prepare test tube slant culture medium; ②Prepare liquid fermentation seed medium: 30.0 g glucose, 20.0 g peptone, 3.0 g NaNO3, 0.5 g MgSO4, 0.5 g KCl, 0.01 g FeSO4 and 1.0 g K2HPO4, distilled water to 1000 mL, natural pH, sterilize at 121°C for 20 min; ③ Eucommia leaf solid fermentation medium: Mix the culture medium raw materials with a mass ratio of 90% Eucommia leaf dry powder, 5% molasses, 3% ammonium sulfate and 2% butylated hydroxytoluene, add water to make the water content reach 58-65%, natural pH, and sterilize at 121℃ for 120min; (2) Expansion culture Take one ring of Neurospora crassa DZ01 strain and inoculate it on the test tube slant medium for amplification and culture, and culture it at 28℃ in the dark for 120h; (3) Seed liquid fermentation culture 150 mL of liquid fermentation seed medium was placed in a 500 mL Erlenmeyer flask, and spore powder of Neurospora crassa DZ01 strain cultured in a test tube slant medium was inoculated and cultured in the dark at 28°C and a shaking speed of 200 r / min for 72 h. (4) Solid fermentation of Eucommia ulmoides leaves Sterilize a constant temperature incubator, a stainless steel fermentation tray, a mat, a cover cloth, a shovel and a measuring cup fermentation utensils. First, spread the mat cloth on the bottom of the stainless steel fermentation tray and cover the four edges of the fermentation tray. Weigh the solid fermentation medium of Eucommia leaves and cover the fermentation tray with a thickness of 8 cm. Use a measuring cup to measure the seed culture solution at a ratio of 6 to 8% of the total mass of the solid fermentation medium of Eucommia leaves and pour it into the solid fermentation medium of Eucommia leaves. Stir evenly, cover the surface of the culture medium with a cover cloth, and then put the fermentation tray into a constant temperature incubator. Set the temperature of the constant temperature incubator to 30°C from 0 to 72h, and set the temperature to 28°C after 72h. The humidity of the incubator is maintained at 80% for 0-48 hours, 70% for 49-72 hours, and the natural relative humidity of the constant temperature incubator is maintained after 72 hours. After 96 hours of fermentation, observe every 24 hours. When the surface of the culture medium is covered with hyphae and the hyphae penetrate into the bottom of the culture medium, and the culture medium forms a bacterial block, it indicates that the fermentation culture is completed. The fermentation culture is sent to a boiling fluidized bed drying oven and dried at below 60°C. Or the fermentation culture is placed indoors and the bacterial blocks are naturally air-dried. When the moisture content reaches less than 10%, it is crushed into a powder that can pass through a 30-mesh sieve and packaged to make fermented eucommia leaf feed.

Images