Polypeptide CPP-K4 derived from HNRNPK targeted in human pluripotent stem cells and application of polypeptide CPP-K4

Abstract

The invention provides polypeptide CPP-K4 derived from HNRNPK targeted in human pluripotent stem cells and application of the polypeptide CPP-K4, and belongs to the technical field of molecular biology, ESRG in hPSCs can be combined with the HNRNPK and regulate the stability of the HNRNPK, research finds that the ESRG maintains self-renewal and pluripotency of the hPSCs through the HNRNPK, on the basis, the polypeptide CPP-K4 derived from the HNRNPK is designed and synthesized, and combination of the ESRG and the HNRNPK can be specifically prevented; the polypeptide CPP-K4 can specifically target long-chain non-coding RNA-ESRG which is specifically and highly expressed in the hPSCs to differentiate the hPSCs, the action molecular mechanism of the ESRG in the hPSCs is expected to be further disclosed, a foundation is laid for clarification of self-renewal and pluripotent mechanisms of the hPSCs and realization of directional differentiation and clinical application of the hPSCs, and the polypeptide CPP-K4 has important scientific significance and research value.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology, and specifically relates to a polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells and an application thereof. Background Art

[0002] Human pluripotent stem cells (hPSCs) have unlimited self-renewal ability and can differentiate into all types of cells in the human body. hPSCs mainly include human embryonic stem cells and human induced pluripotent stem cells. It is currently believed that hiPSCs (induced pluripotent stem cells) have similar characteristics to hESCs (human embryonic stem cells), which can avoid the ethical issues of hESCs establishment and individual specific hiPSCs may avoid immune rejection after transplantation, making hiPSCs expected to become an ideal "seed cell" for tissue and organ regeneration and repair.

[0003] Exploring the self-renewal and pluripotency mechanisms of hPSCs is of great significance for understanding human embryonic development and cell differentiation mechanisms, and is also the basis for hPSCs to be used in cell replacement therapy and tissue engineering. It has been found that the maintenance of hPSCs self-renewal and pluripotency is regulated by multiple factors (such as transcription factors, signaling pathways, epigenetic factors, metabolome, etc.), but the self-renewal and pluripotency mechanisms of hPSCs have not yet been fully elucidated and deserve further exploration.

[0004] lncRNA ESRG is a gene discovered and named by our research team in the early stage. It is unique to humans and primates and can be used as a marker for detecting early human reprogrammed cells, as well as a marker for undifferentiated hPSCs and for detecting hPSCs remaining in differentiated cells. The specificity of ESRG expression suggests that it may play a unique role as a new marker in maintaining the stemness of hPSCs.

[0005] HNRNPK is an RNA binding protein that regulates mRNA splicing, stability, transcription, and participates in post-translational modification. The protein contains three KH domains (K homology domain, KH), a nuclear localization signal (nuclear localization signal, NLS), a nuclear shuttling domain (nuclear shuttling domain, KNS), and a KI domain (K protein interactive region, KI). However, to date, the function of HNRNPK in hPSCs has not been reported, which deserves further study, especially its biological significance in binding to ESRG, which is highly expressed in hPSCs. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells and its application, which can specifically prevent the binding of ESRG and HNRNPK. The polypeptide CPP-K4 can specifically target the long non-coding RNA-ESRG specifically and highly expressed in hPSCs to differentiate hPSCs.

[0007] To achieve the above object, the present invention first provides a polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells, wherein the amino acid sequence of the polypeptide CPP-K4 is shown in SEQ ID NO.1.

[0008] Based on a general inventive concept, the present solution also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells in blocking the binding of ESRG and HNRNPK.

[0009] Based on a general inventive concept, the present solution also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in clearing undifferentiated human pluripotent stem cells remaining in differentiated cells.

[0010] Based on a general inventive concept, the present invention also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting human pluripotent stem cells in the preparation of an anti-tumor drug.

[0011] Preferably, the tumor is caused by residual undifferentiated human pluripotent stem cells in differentiated cells.

[0012] Preferably, the present solution also provides a use of a polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells in transferring ESRG from the nucleus to the cytoplasm.

[0013] The mechanism of treatment of this regimen is as follows:

[0014] In view of the important problem when hPSCs are used in regenerative medicine, that is, the tumorigenic risk caused by the residual undifferentiated hPSCs in differentiated cells, therefore, taking advantage of the characteristic that ESRG is specifically and highly expressed only in hPSCs among normal cells or tissues, a peptide with good specificity and few side effects derived from HNRNPK was designed to block the binding of ESRG and HNRNPK and eliminate the residual undifferentiated hPSCs in differentiated cells, effectively preventing the potential tumorigenic risk of hPSCs therapeutic products, laying the foundation for the safe application of hPSCs in clinical treatment in the future, and having important clinical translation value.

[0015] After adding CPP-K4, the localization of ESRG in the cell nucleus decreased, while the localization in the cytoplasm increased, which blocked part of the binding of ESRG to HNRNPK in the cell nucleus, and part of ESRG was taken out of the cell nucleus.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] (1) Taking advantage of the fact that ESRG is highly expressed only in hPSCs in normal cells or tissues, a peptide CPP-K4 derived from HNRNPK with good specificity and few side effects was designed to block the binding of ESRG and HNRNPK and eliminate the undifferentiated hPSCs remaining in differentiated cells, effectively preventing the potential tumorigenic risk of hPSCs therapeutic products, laying the foundation for the safe application of hPSCs in clinical treatment in the future, and having important clinical translation value.

[0018] (2) This study further reveals the molecular mechanism of ESRG in hPSCs, laying a foundation for clarifying the self-renewal and pluripotency mechanism of hPSCs, achieving the directed differentiation of hPSCs and clinical application, and has important scientific significance and research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 is the binding relationship between ESRG and HNRNPK in Experimental Example 1, A is the specific binding site of ESRG and HNRNPK predicted by catRAPID website, B is the localization of ESRG and HNRNPK observed by RNA-FISH technology combined with immunofluorescence, C is WB detection of HNRNPK in RNA pull-down samples, silver staining gel, RIP combined with qRT-PCR experiment to detect the binding of ESRG and HNRNPK in hPSCs, D is a schematic diagram of the structure of HNRNPK protein, EF are the specific binding regions of ESRG and HNRNPK in 293T cell line detected by RIP combined with qRT-PCR experiment and RNA pull-down, GH are the binding of ESRG and K4 of HNRNPK in 293T cell line detected by RIP combined with qRT-PCR experiment and RNA pull-down, * indicates P < 0.05, *** indicates P < 0.001, Bar = 100 μm;

[0021] Figure 2 is the binding relationship between ESRG and HNRNPK in Experimental Example 1, A is the expression of stemness factors detected after knocking down the expression of HNRNPK in H9 cells, B is the observation of the morphology of hPSCs H9 cells after HNRNPK knockdown, C is the expression of stemness factors detected after overexpressing HNRNPK in H9 cells, D is the AP staining detection of AP activity of H9 cells after knocking down HNRNPK, E is the CCK8 detection of H9 cell proliferation after knocking down HNRNPK, F is the use of flow cytometry to detect the level of cell apoptosis after knocking down HNRNPK in H9 cells, G is the qRT-PCR detection of the expression of endoderm, mesoderm and ectoderm markers after knocking down HNRNPK in H9 cells, ** indicates P < 0.01, *** indicates P < 0.001;

[0022] Figure 3 is the binding relationship between ESRG and HNRNPK in Experimental Example 1, A is the expression of stemness factors detected after knocking down the expression of HNRNPK in RC1 cells, B is the morphology of hPSCs RC1 cells after HNRNPK knockdown, Bar=100μm, C is the expression of stemness factors detected after overexpressing HNRNPK in RC1 cells, D is the detection of AP activity of RC1 cells after knocking down HNRNPK, Bar=100μm, E is the proliferation of RC1 cells detected by CCK8 after knocking down HNRNPK, ** indicates P<0.01, *** indicates P<0.001;

[0023] Figure 4 Figure 1 shows the binding relationship between ESRG and HNRNPK in Experimental Example 1. A shows the protein level of HNRNPK detected by WB after knocking down / overexpressing ESRG in H9 and RC1 cells, respectively. B shows the protein level of HNRNPK detected by WB after incubating H9 and RC1 cells (siControl vs siESRG) with CHX (20 μg / ml) for different time periods. C shows the protein level of HNRNPK detected by WB after incubating H9 and RC1 cells (siControl vs siESRG) with MG132 (20 μM). The protein level of HNRNPK was detected by WB 4 hours after siESRG. D was incubated with MG132 (20 μM) in H9 and RC1 cells, and then immunoprecipitated with HNRNPK antibody, and the precipitated complex was detected with Ub antibody. E was found using the Biogrid database to identify the ubiquitin ligase RNF8 that interacts with HNRNPK. F was detected by WB after knocking down H9 and RC1 cells with siRNARNF8 and siRNAESRG. G was detected by Co-IP after H9 and RC1 cells were treated with siControl or siESRG.

[0024] Figure 5In Experimental Example 2, ESRG plays a role in maintaining the self-renewal and pluripotency of hPSCs by binding to HNRNPK. A shows that HNRNPK was overexpressed while ESRG was knocked down in H9 and RC1 cells, and the protein levels of stemness factors and AKT-related pathway proteins were detected by WB. B shows that the cell morphology and growth were observed after ESRG was knocked down and HNRNPK was overexpressed in H9 and RC1 cells. C shows that AP activity was detected after ESRG was knocked down and HNRNPK was overexpressed in H9 and RC1 cells. D shows that the apoptosis rate was counted by flow cytometry after ESRG was knocked down and HNRNPK was overexpressed in H9 and RC1 cells. E shows that DNA damage of cells was detected by comet assay after ESRG was knocked down and HNRNPK was overexpressed in H9 and RC1 cells. Olive Tail Moment stands for olive tail moment, and the distance between the center of the "comet head" and the center of the "comet tail" was calculated. ** indicates P<0.01, *** indicates P<0.001, and Bar=100μm.

[0025] Figure 6 The polypeptide CPP-K4 in Experimental Example 4 blocks the interaction between ESRG and HNENPK. A is the morphology of H9 cells after the addition of HNRNPK-derived peptide K4. B is the AP activity detected after the addition of HNRNPK-derived peptide K4 in H9 cells. Bar=100 μm. C is the protein expression of stemness factors in H9 cells detected after the addition of HNRNPK-derived peptide K4. D is the localization of HNRNPK-derived polypeptide K4 and ESRG in H9 cells detected simultaneously by RNA-FISH and immunofluorescence techniques. Bar=100 μm. DETAILED DESCRIPTION

[0026] In order to make the technical problems, technical solutions and advantages to be solved by the present invention more clear, a detailed description will be given below with reference to the accompanying drawings and specific embodiments.

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0028] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; unless otherwise specified, the reagents used in the examples are commercially available.

[0029] Experimental Example 1

[0030] Investigate the binding relationship between ESRG and HNRNPK.

[0031] The catRAPID website was used to predict whether ESRG and HNRNPK bind. catRAPID mainly uses the secondary structure and hydrogen bonds of RNA and protein to predict the possibility of RNA and protein binding.

[0032] Figure 1 A prediction result shows that ESRG and HNRNPK bind to each other (the red grid indicates the binding position, and the darker the color, the stronger the binding ability). In order to better understand the molecular mechanism of ESRG binding to HNRNPK in hPSCs, RNA-FISH technology combined with immunofluorescence experiment was used to detect the subcellular localization of ESRG and HNRNPK proteins in hPSCs H9 cells. The results showed that ESRG RNA and HNRNPK protein were co-localized in the cell nucleus ( Figure 1 B); RNA pull-down and RIP confirmed that ESRG and HNRNPK can bind to each other in hPSCs (H9 cells and RC1 cells) from both positive and negative aspects ( Figure 1 C) and draw a schematic diagram of the structure of HNRNPK protein ( Figure 1 D), which mainly contains 3 KH domains, 1 nuclear localization signal, 1 signal site that promotes HNRNPK nuclear shuttling, and 1 KI domain. It is currently known that the KH1 domain can bind to DNA and RNA, while KH2 and KH3 can only bind to RNA. HNRNPK is divided into 3 truncations based on the distribution of domains and labeled with Flags, namely K1, K2, and K3. These 3 truncations and ESRG were transfected into 293T cells for RIP and RNA pull-down experiments, and it was found that ESRG bound to the K3 truncations of HNRNPK ( Figure 1 EF). It was found that the K3 truncated form of HNRNPK contained an RGG domain, which was further transformed into the truncated form K4, and it was found that ESRG bound to it ( Figure 1 GH):

[0033] Flag tag: 5′-GACTACAAAGACGATGACGACAAG-3′; (SEQ ID NO.2)

[0034] K1:

[0035] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGGAAACTGAACAG CCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCTAAGGTACC-3′;(SEQID NO.3)

[0036] K2:

[0037] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGCCTACCTTGGAAGAGG GCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGAATGCTTAAATTACCAACACTATAAAGGAAGTGACTTTGACTGCGAGTTGAGGCTGTTGATTCATCAGAGTCTAGCAGGAGGAATTATTGGGGTCAAAGGTGCTAAAATCAAAGAACTTCGAGAGAACACTCAAACCACCATCAAGCTTTTCCAGGAATGCTGTCCTCATTCCACTGACAGAGTTGTTCTTATTGGAGGAAAACCCGATAGGGTTGTAGAGTGCATAAAGATCATCCTTTAAGGTACC-3′;(SEQ ID NO.4)

[0038] K3:

[0039] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGGATCTTATATCTGAGTC TCCCATCAAAGGACGTGCACAGCCTTATGATCCCAATTTTTACGATGAAACCTATGATTATGGTGGTTTTACAATGATGTTTGATGACCGTCGCGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTGGTTTTGACAGAATGCCTCCTGGTCGGGGTGGGCGTCCCATGCCTCCATCTAGAAGAGATTATGATGATATGAGCCCTCGTCGAGGACCACCTCCCCCTCCTCCCGGACGAGGCGGCCGGGGTGGTAGCAGAGCTCGGAATCTTCCTCTTCCTCCACCACCACCACCTAGAGGGGGAGACCTCATGGCCTATGACAGAAGAGGGAGACCTGGAGACCGTTACGACGG CATGGTTGGTTTCAGTGCTGATGAAACTTGGGACTCTGCAATAGATACATGGAGCCCATCAGAATGGCAGATGGCTTATGAACCACAGGGTGGCTCCGGATATGATTATTCCTATGCAGGGGGTCGTGGCTCATATGGTGATCTTGGTGGACCTATTATTACTACACAAGTAACTATTCCCAAAGATTTGGCTGGATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATCCGTCATGAGTCGGGAGCTTCGATCAAAATTGATGAGCCTTTAGAAGGATCCGAAGATCGGATCATTACCATTACAGGAACACAGGACCAGATACAGAATGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTATTCTGGAAAGTTTTTCTAAGGTACC-3′;(SEQ ID NO.5)

[0040] K4:

[0041] 5′-GCTAGCGCCACCATGGACTACAAAGACGATGACGACAAGATGTTTGATGACCGTCG CGGACGCCCAGTGGGATTTCCCATGCGGGGAAGAGGTGGTTTTGACAGAATGCCTCCTG GTCGGGGTGGGTAAGGTACC-3′; (SEQ ID NO. 6)

[0042] Two siHNRNPK sequences were designed and synthesized, namely siHNRNPK-1 and siHNRNPK-2:

[0043] siHNRNPK-1: 5'-CGTTATTGTTGGTGGTTTAAA-3' (SEQ ID NO.7)

[0044] siHNRNPK-2: 5'-TGATGTTTGATGACCGTCGCG-3' (SEQ ID NO.8)

[0045] WB results showed that the interference efficiency of siHNRNPK-1 in hPSCs H9 was higher than that of siHNRNPK-2, and the knockdown efficiency exceeded 80%, and the protein levels of stemness factors OCT4 and SOX2 decreased ( Figure 2 A), cells change from tightly packed to sparsely packed ( Figure 2 B). After overexpression of HNRNPK, SOX2 and OCT4 were significantly upregulated ( Figure 2 C). Figure 2 D The results showed that compared with the control group, after knocking down HNRNPK, the enzyme activity of AP decreased and the stemness of cells decreased. CCK8 experimental detection found that after knocking down HNRNPK in hPSCs H9, the cell proliferation ability was significantly reduced ( Figure 2 E). After knocking down HNRNPK, flow cytometry revealed that the level of cell apoptosis increased significantly ( Figure 2 F). qRT-PCR detection showed that after knocking down HNRNPK, the expression of endoderm (OPN, GATA4), mesoderm (GATA2, HAND1), and ectoderm (PAX6, OTX2) markers in hPSCs H9 cells was significantly upregulated ( Figure 2 G). In addition, the same experimental results as those in hPSCs H9 were obtained after knocking down cells using siHNRNPK-1 in hPSCs RC1 (see Figure 3 The above results of interfering with HNRNPK are basically consistent with the previous results of interfering with ESRG, suggesting that HNRNPK, like ESRG, plays an important role in maintaining the self-renewal and pluripotency of hPSCs.

[0046] We further found that after knocking down ESRG in H9 and RC1 cells, the protein level of HNRNPK decreased significantly. After overexpression of ESRG, the protein level of HNRNPK increased ( Figure 4 A), we speculate that ESRG affects the stability of HNRNPK in hPSCs. H9 and RC1 cells (siControl vs siESRG) were treated with cycloheximide (CHX) respectively, and cells were collected at 0, 3, 6, and 9 hours and protein was extracted for WB detection. The results showed that compared with the siControl group, the protein degradation rate of HNRNPK in the siESRG group was faster ( Figure 4 B). 20 μM proteasome inhibitor MG132 was further used to treat ESRG knockdown H9 cells. WB experimental results showed that the HNRNPK protein level in the MG132-added group cells was significantly restored, which was comparable to the HNRNPK protein level in the ESRG uninterrupted group cells ( Figure 4 C).

[0047] Co-IP experiments showed that polyubiquitination chains formed near the HNRNPK band after ESRG knockdown ( Figure 4 D). The above results suggest that ESRG may stabilize HNRNPK protein levels by protecting it from proteasome degradation. We found in the Biogrid database that HNRNPK can bind to the ubiquitin ligase RNF8 ( Figure 4 E), so we speculated that RNF8 might bind to HNRNPK and participate in the maintenance of HNRNPK protein stability by ESRG. To verify this hypothesis, ESRG and RNF8 were simultaneously interfered in hPSCs H9 and RC1 cells. WB results showed that siRNF8 could restore the decrease of HNRNPK protein level induced by siESRG ( Figure 4 F). Co-IP results showed that the binding between HNRNPK and RNF8 was enhanced after knocking down ESRG ( Figure 4 G). The above experimental results can be concluded that ESRG maintains the protein level of HNRNPK in hPSCs H9 and RC1 cells by interfering with the ubiquitin ligase RNF8

[0048] Experimental Example 2

[0049] The aim of this study was to investigate the role of ESRG in maintaining the self-renewal and pluripotency of hPSCs by binding to HNRNPK.

[0050] A HNRNPK restoration experiment was conducted: knocking down ESRG and overexpressing HNRNPK at the same time, so that the HNRNPK expression level was restored. WB detection found that knocking down ESRG and overexpressing HNRNPK in hPSCs H9 and RC1 cells could restore the intracellular HNRNPK level, and the protein levels of stemness factors OCT4 and SOX2 were also restored, AKT expression was upregulated, and p-AKT (S473) was activated ( Figure 5 A), and the cell morphology and AP activity were partially restored ( Figure 5 BC). Flow cytometry revealed that knocking down ESRG and simultaneously overexpressing HNRNPK in hPSCs H9 and RC1 cells could reduce the level of cell apoptosis ( Figure 5 D). Comet assay showed that knocking down ESRG and overexpressing HNRNPK in hPSCs H9 and RC1 cells reduced DNA damage in cells ( Figure 5 E). The above results further confirmed the speculation that ESRG may play a role through HNRNPK.

[0051] Experimental Example 3

[0052] The peptide CPP-K4 was designed and synthesized.

[0053] In view of the fact that an important problem when hPSCs are used in regenerative medicine is the risk of tumorigenesis caused by the presence of undifferentiated hPSCs in differentiated cells, we have designed a peptide derived from HNRNPK with good specificity and few side effects, taking advantage of the fact that ESRG is only highly expressed in hPSCs in normal cells or tissues, to block the binding of ESRG and HNRNPK and eliminate the undifferentiated hPSCs remaining in differentiated cells, effectively preventing the potential tumorigenic risk of hPSCs therapeutic products, laying the foundation for the safe application of hPSCs in clinical treatment in the future, and having important clinical translation value. We have previously demonstrated that ESRG can interact with the K4 truncation of HNRNPK in hPSCs ( Figure 1 GH), and designed and synthesized its K4 truncation peptide: CPP-K4.

[0054] Experimental Example 4

[0055] The peptide CPP-K4 was used to investigate whether it could block the interaction between ESRG and HNENPK.

[0056] After 24h of single cell plating, 40μmol CPP-K4 was added to the culture medium when changing the medium. After 36h, the morphology of hPSCs H9 cells was observed to change from compact to sparse ( Figure 6 A), the enzyme activity of AP decreases and the stemness of cells decreases ( Figure 6B), the levels of stemness factors OCT4 and SOX2 proteins decreased ( Figure 6 C). RNA-FISH technology combined with immunofluorescence experiments were used to observe whether the subcellular localization of ESRG in hPSCs H9 cells changed after the addition of CPP-K4. The fluorescence results showed that after the addition of 40μmol CPP-K4 for 36h, the localization of ESRG in the cell nucleus decreased, while the localization in the cytoplasm increased ( Figure 6 D) The results of this experiment showed that the addition of the HNRNPK-derived K4 polypeptide blocked the binding of some ESRG to HNRNPK in the cell nucleus, and some ESRG was taken out of the cell nucleus.

[0057] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. For those skilled in the art, improvements and changes obtained without departing from the technical concept of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells, characterized in that: The amino acid sequence of the polypeptide CPP-K4 is shown in SEQ ID NO.

1.

2. A use of the polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells as claimed in claim 1 for blocking the binding between ESRG and HNRNPK.

3. A use of the polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells as claimed in claim 1 for eliminating undifferentiated human pluripotent stem cells remaining in differentiated cells.

4. Use of the polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells as claimed in claim 1 in the preparation of anti-tumor drugs.

5. The use according to claim 4, characterized in that: The tumor is caused by residual undifferentiated human pluripotent stem cells among differentiated cells.

6. Use of the polypeptide CPP-K4 derived from HNRNPK targeting in human pluripotent stem cells as claimed in claim 1 in transferring ESRG from the nucleus to the cytoplasm.

Images