Giardia immunomagnetic bead-immunofluorescence detection kit based on beta-giardia and preparation method thereof

Abstract

The invention discloses a giardia immunomagnetic bead-immunofluorescence detection kit based on beta-giardin and a preparation method of the giardia immunomagnetic bead-immunofluorescence detection kit, and provides a newly identified giardia specific cyst outer wall protein antigen beta-giardin. The immunomagnetic bead-immunofluorescence detection method prepared on the basis of beta-giardin protein of giardia has the advantages of high specificity, high sensitivity, good stability, simplicity and convenience in operation, diversity of detection samples, low false detection rate and the like. The detection result is suitable for rapid diagnosis and detection in a clinical field, and the detection method can reduce the risk of occurrence and transmission of giardia disease to a great extent.

Description

Technical Field

[0001] The invention discloses a Giardia immunomagnetic bead-immunofluorescence detection kit based on beta-giardia and a preparation method thereof, relates to a cyst enrichment and immunofluorescence detection method utilizing a biotin-streptavidin coupling reaction and based on the Giardia cyst outer wall protein beta-giardin, and belongs to the technical field of immunology. Background Art

[0002] Giardiasis is caused by Giardia Giardia duodenalis ) is a zoonotic parasitic disease caused by parasites in the intestines of mammals. The fecal cyst test is currently the gold standard for the diagnosis of giardiasis and is also the most widely used diagnostic method. This method has the advantages of simplicity and low cost, but it has the disadvantages of being time-consuming and labor-intensive, with high missed detection and false detection rates, and high requirements for the professionalism of the testers and testing conditions. It is not suitable for widespread promotion in practice. The commonly used laboratory examination methods for diagnosing giardiasis are nested PCR detection methods and microscopic examinations. These methods require professional operators, specific instruments and equipment, long detection time, and cumbersome steps, etc., which are not suitable for grassroots field operations.

[0003] Traditional immunomagnetic beads are composite materials covered with a polymer surface containing superparamagnetic substances using a core-shell synthesis method. They are stable and can be later labeled. Functional groups on the surface of these substances, such as amino, carboxyl, and thiol, are used for covalent or non-covalent coupling of antibodies. They can be used to bind to corresponding antigens or antibodies, so that they can move in a directional manner under the attraction of an external magnetic field, thereby achieving the purpose of separation, detection, and purification of genes, proteins, cells, microorganisms, etc.

[0004] The giardia protein family is a class of surface glycoprotein antigens unique to Giardia, among which β-giardin is located on the outer wall of Giardia cysts and can be exposed to the environment. It has the advantages of high specificity and stable properties, and is an ideal target for the diagnosis of giardiasis. At present, no relevant reports have been found on the preparation of immunomagnetic beads-immunofluorescence diagnostic technology using β-giardia of Giardia as a target for the detection of Giardia cysts. Summary of the invention

[0005] One of the purposes of the present invention is to provide a Giardia immunomagnetic bead-immunofluorescence detection kit based on β-giardiacin and a preparation method, which is simple, fast, and has high antibody binding efficiency compared to traditional coupling methods, and provides technical support for the magnetic bead enrichment technology of Giardia.

[0006] One of the purposes of the present invention is to provide a polyclonal antibody for identifying the β-giardin protein on the outer wall of Giardia cysts. The polyclonal antibody can bind to the β-giardin on the outer wall of Giardia cysts, providing technical support for subsequent detection of Giardia.

[0007] The β-giardia immunomagnetic bead-immunofluorescence detection kit of Giardia described in the present invention is composed of the following substances: β-giardin-streptavidin-biotin magnetic beads 100 mg; 1×PBST 100mL; Poly-L-lysine pre-treated slides; 4% paraformaldehyde 10 mL; 3% bovine serum albumin 10 mL; β-giardin polyclonal antibody 100 μL; 100 μL of FITC-labeled goat anti-mouse IgG antibody.

[0008] The method for preparing a Giardia immunomagnetic bead-immunofluorescence detection kit based on β-giardia described in the present invention comprises the following steps: 1) According to the gene sequence of Giardia β-giardin, specific primers were designed, and the target fragment of Giardia β-giardin was amplified by polymerase chain reaction (PCR) to obtain the Giardia specific antigen gene β-giardin; Design specific primer sequences as follows: F: CGG CCGGAATTC ATGTCTATGTTCACCTCCACCC; R: CGG CCGCTCGAG TTAGTGCTTTGTGACCATCGAGAG; 2) Expressing and purifying Giardia β-giardin protein and preparing polyclonal antibodies of the protein, coupling the prepared β-giardin polyclonal antibodies to magnetic beads using a streptavidin-biotin binding reaction to prepare β-giardin immunomagnetic beads; 3) Take an appropriate amount of sample and add it to the EP tube, take an appropriate amount of coupled streptavidin-biotin anti-β-giardin immunomagnetic beads and mix them for 60 minutes. Then, place it on the magnetic stand, wait for the magnetic beads to be adsorbed on the magnetic stand, discard the supernatant, wash the magnetic beads 3 times with 500μL PBST, resuspend the magnetic beads with an appropriate amount of PBST, and calculate the number of magnetic beads captured; 4) The enriched Giardia cyst samples were coated onto a glass slide pretreated with poly-lysine. After fixation, blocking, β-giardin antibody incubation, fluorescent secondary antibody labeling and sealing, the enriched Giardia cysts were observed under a fluorescence microscope.

[0009] The present invention discloses a Giardia specific antigen gene β-giardin ( Giardia duodenalis , referred to as BG) (GenBank: NC_051859.1), its gene sequence is as shown in SEQ ID NO.1; its amino acid sequence is as shown in SEQ ID NO.2.

[0010] The target fragment size of the amplified Giardia specific antigen gene β-giardin of the present invention is 819 bp. The sequence of the protein is analyzed and predicted by NCBI, ExPASy and Prot Param databases. The protein encodes 272 amino acids, has a molecular weight of 30.9 kDa, a theoretical isoelectric point of 5.25, and it is speculated that the protein contains an N-terminal signal peptide.

[0011] The invention discloses a method for obtaining a Giardia specific antigen gene β-giardin, comprising the following steps: designing specific primers according to the gene sequence of Giardia β-giardin, amplifying a target fragment of Giardia β-giardin by polymerase chain reaction (PCR), and obtaining the Giardia specific antigen gene β-giardin.

[0012] The invention discloses an immunomagnetic bead-immunofluorescence detection method for enriching Giardia β-giardin protein and detecting Giardia cysts in feces. The method comprises the following steps: expressing and purifying Giardia β-giardin protein and preparing polyclonal antibodies of the protein; coupling the prepared β-giardin polyclonal antibodies to magnetic beads by streptavidin-biotin binding reaction to prepare β-giardin immunomagnetic beads; comparing the binding efficiency of the biotin-streptavidin binding mode with that of traditional carboxylated magnetic beads; and developing an immunomagnetic bead-immunofluorescence detection method for diagnosing and detecting Giardia infection on the basis of the method.

[0013] The positive effects of the present invention are: providing a newly identified Giardia-specific cyst outer wall protein antigen β-giardin; the immunomagnetic bead-immunofluorescence detection method prepared based on Giardia β-giardin protein has the advantages of strong specificity, high sensitivity, good stability, simple operation, diversity of detection samples, low false detection rate, etc. The detection results are suitable for rapid diagnosis and detection in clinical sites, and the detection method can greatly reduce the risk of occurrence and spread of giardiasis.

[0014] The antibody of Giardia outer wall protein is coupled to the surface of magnetic beads through the specific binding of biotin-streptavidin. Compared with the traditional coupling method, this coupling method has the advantages of simplicity, speed, high antibody binding efficiency and low cost, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 PCR amplification of β-giardin gene (M: DNA marker (DL1000); 1: β-giardin PCR product); Figure 2 This is a double enzyme digestion identification diagram of the expression vector pGEX-4T-1-β-giardin (M: DNA marker (DL1000); 1: double enzyme digestion product of the pGEX-4T-1-β-giardin expression vector); Figure 3 This is the inducible expression diagram of the recombinant protein pGEX-4T-1-β-giardin (M: protein marker; 1: induced supernatant of the recombinant protein pGEX-4T-1-β-giardin; 2: induced precipitate of the recombinant protein pGEX-4T-1-β-giardin; 3: uninduced whole bacteria of the recombinant protein pGEX-4T-1-β-giardin; 4: pGEX-4T-1 vector); Figure 4 It is the purification diagram of the recombinant protein pGEX-4T-1-β-giardin (M: protein marker; 1: purified recombinant protein pGEX-4T-1-β-giardin); Figure 5 Western blot identification of the recombinant protein pGEX-4T-1-β-giardin (1: induced precipitation of the recombinant protein pGEX-4T-1-β-giardin; 2: Giardia whole trophozoite protein); Figure 6 This is a picture of cysts enriched by immunomagnetic beads; Figure 7 This is the encapsulation elution diagram of the immunomagnetic beads; Figure 8 This is the result of the sensitivity experiment; Fig. 9 This is a test diagram of some clinical samples; Fig.10 Comparison of magnetic bead efficiency between the two coupling methods; Fig.11 This is the result of immunofluorescence detection. DETAILED DESCRIPTION

[0016] The present invention is further described by way of the following examples, but the present invention is not limited in any way. Without departing from the technical solution of the present invention, any modification or change made to the present invention that is easily implemented by a person of ordinary skill in the art will fall within the scope of the claims of the present invention. Example 1

[0017] Acquisition and identification of Giardia specific antigen genes; PCR amplification of the Giardia β-giardin gene; According to the gene sequence of Giardia β-giardin (GenBank: NC_051859.1), the specific primer sequences were designed as follows: F: CGG CCGGAATTC ATGTCTATGTTCACCTCCACCC; R: CGG CCGCTCGAG TTAGTGCTTTGTGACCATCGAGAG; (The underlined part is the restriction site, and the part before the underline is the protective base). The target fragment of Giardia β-giardin was amplified by polymerase chain reaction (PCR). The results showed that a fragment of 819 bp (including the target fragment of β-giardin, restriction site and protective base) was successfully amplified. (As Figure 1 shown) Construction of pGEX-4T-1-β-giardin expression vector The recombinant plasmid pGEX-4T-1-β-giardin was double-digested and identified using two endonucleases, BamH I and EcoR I, and separated and identified by 1% agarose gel electrophoresis. The results showed that the pGEX-4T-1-β-giardin expression vector (such as Figure 2 as shown).

[0018] Inducible expression of recombinant protein pGEX-4T-1-β-giardin The bacterial suspension of pGEX-4T-1 and the bacterial suspension of the correctly sequenced recombinant expression vector pGEX-4T-1-β-giardin were cultured in 6 mL LB medium respectively. When they grew to OD600 = 0.6, 1 / 1000 IPTG was added for induction for 6 hours, followed by sonication, and the expressed protein was identified by SDS-PAGE analysis. The results showed that the recombinant protein pGEX-4T-1-β-giardin was highly expressed in the induced precipitate, and a clear target band was visible at about 61 kDa, indicating that the recombinant protein pGEX-4T-1-β-giardin was successfully induced (e.g. Figure 3 as shown).

[0019] Purification of recombinant protein pGEX-4T-1-β-giardin The recombinant protein pGEX-4T-1-β-giardin, which was successfully induced to express, was purified by gel purification and then analyzed and identified by SDS-PAGE. The results showed that a clear and single target band of the purified β-giardin protein was observed at about 61 kDa, indicating that the recombinant protein pGEX-4T-1-β-giardin was successfully purified (e.g. Figure 4 as shown).

[0020] Preparation of polyclonal antibody against Giardia β-giardin 100 μg of recombinant protein pGEX-4T-1-β-giardin was diluted into 100 μL solution, and then fully mixed and emulsified with an equal volume of Freund's complete adjuvant, and then 6-8 week-old BALB / c mice were first immunized by multiple subcutaneous injections. Seven days later, the same dose of protein was fully mixed and emulsified with Freund's incomplete adjuvant for secondary immunization, and 14 days later, the third immunization was performed. Seven days after the third immunization, blood was collected from the retinal venous plexus of the mice, and the serum was collected and the titer was determined and stored at -40°C.

[0021] Determination of the titer and concentration of polyclonal antibodies against Giardia β-giardin The serum of BALB / c mice after three immunizations was collected, and the antibody titer was determined by indirect ELISA with purified β-giardin protein. The results showed that the antibody titer of β-giardin reached 1:128000.

[0022] Determination of protein content by BCA method: The protein content of the Giardia β-giardin polyclonal antibody prepared by the method of the present invention was determined at 562 nm using an ELISA instrument. The result showed that the concentration of the Giardia β-giardin polyclonal antibody was 30 mg / mL.

[0023] Western-blot analysis and identification of recombinant protein pGEX-4T-1-β-giardin The Western-blot detection method was used to detect the serum samples of BALB / c mice immunized with the recombinant protein pGEX-4T-1-β-giardin and the whole protein of Giardia trophozoites as antigens. The results showed that a clear band was observed at about 61 kDa when the recombinant protein pGEX-4T-1-β-giardin was detected, and a clear band was observed at about 35 kDa when the whole protein of Giardia trophozoites was detected (e.g. Figure 5 As shown), it shows that the recombinant protein pGEX-4T-1-β-giardin has good immunogenicity. Example 2

[0024] Preparation of immunomagnetic beads 100 μg of recombinant protein pGEX-4T-1-β-giardin was diluted into 100 μL solution, and then fully mixed and emulsified with an equal volume of Freund's complete adjuvant, and then 6-8 week-old BALB / c mice were first immunized by multiple subcutaneous injections. Seven days later, the same dose of protein was fully mixed and emulsified with Freund's incomplete adjuvant for secondary immunization, and 14 days later, the third immunization was performed. Seven days after the third immunization, blood was collected from the retinal venous plexus of the mice, and the serum was collected and the titer was determined and stored at -40°C.

[0025] After thoroughly mixing the streptavidin magnetic beads with a mixer, take 2 mg of magnetic beads into a 1.5 mL centrifuge tube with a pipette, place the centrifuge tube on a magnetic rack to completely separate the solid and liquid, and remove the supernatant. Wash the magnetic beads 2-3 times with PBST and store at 4°C.

[0026] Antibody diluent: 3% BSA, 3g bovine serum albumin BSA plus PBST to 100mL.

[0027] After the prepared polyclonal antibody was diluted to a certain multiple into 1 mL of solution, biotin N-hydroxysuccinimide ester (NHS-biotin) was added to adjust the final concentration to 2 mM, and the solution was incubated at 4°C for 1 h with inversion mixing.

[0028] The biotinylated antibody in step (4) is coupled to the streptavidin magnetic beads in step (2) at room temperature, inverted and mixed, and incubated for 1 hour to prepare streptavidin-biotin anti-β-giardin immunomagnetic beads. Example 3

[0029] Immunomagnetic bead detection process Sample processing: Dissolve the fecal sample with an appropriate amount of water, and use a pestle to crush the fecal sample in the sample tube to fully dissolve the fecal sample in the water. Then centrifuge the fecal solution at 3000rpm for 10min, collect the precipitate after centrifugation, and dissolve it with an appropriate amount of water for testing.

[0030] Enrichment process: Take an appropriate amount of diluted stool sample and add it to a new EP tube. Take an appropriate amount of coupled streptavidin-biotin anti-β-giardin immunomagnetic beads (gently mixed in advance) and mix them, place them on a rotator, and react at room temperature for 60 minutes. After the enrichment is completed, place it on a magnetic rack, wait for 2-3 minutes for the magnetic beads to be adsorbed on the magnetic rack, and gently pipette the supernatant in the EP tube into another EP tube. Then use 500μL PBST to gently wash the immunomagnetic beads 3 times, resuspend the magnetic beads with an appropriate amount of PBST, and pipette 10μL onto a blood cell counting plate to calculate the number of magnetic beads captured (such as Figure 6 , Figure 7 As shown); the formula for calculating the capture rate of immunomagnetic beads is as follows: Capture rate (%) = number of Giardia cysts captured by immunomagnetic beads / (number of cysts in supernatant + number of cysts captured by immunomagnetic beads) × 100% Example 4

[0031] To explore the effect of different numbers of worms on the capture efficiency of immunomagnetic beads, the Giardia cysts in gerbil feces were captured and 2 mg of streptavidin-biotin anti-β-giardin immunomagnetic beads were used for the capture experiment. First, the number of cysts in each sample was determined, and 1×10 3 , 1×10 4 , 5×10 4 , 1×10 5 and 5×10 5 The capture rate was calculated by repeating the experiment three times.

[0032] like Figure 8 As shown, using 1×10 3 , 1×10 4 , 5×10 4 , 1×10 5 and 5×10 5 The sensitivity of the immunomagnetic beads was determined by 5 gradients of 1000 cysts per ml of solution. It can be seen that the capture rate of 2 mg of immunomagnetic beads can reach more than 70% when the capture system is as low as 1000 cysts per ml of solution, indicating that the sensitivity of the immunomagnetic beads prepared in this experiment is good. 5 The enrichment rate can still reach more than 65% in the system with 5×10 5 The enrichment effect in the system with 100 capsules decreased slightly, indicating that 2 mg of magnetic beads has reached the maximum enrichment amount. Example 5

[0033] The fecal samples of Siberian tigers, raccoon dogs, and ferrets obtained by sampling were dissolved and stirred with an appropriate amount of distilled water, and the samples were thoroughly mixed. After that, the samples were centrifuged at 3000rpm for 10 minutes to collect the precipitate. The precipitate was resuspended with an appropriate amount of PBST, and the prepared streptavidin-biotin anti-β-giardin immunomagnetic beads were put into the enrichment system, and 100 μL of magnetic beads were added to 900 μL of fecal samples resuspended with PBST. After mixing evenly, it was placed on a rotator and captured at room temperature for 60 minutes. The remaining steps are shown in Example 3. The capture rate was calculated to determine the capture performance of the immunomagnetic beads in actual clinical samples. PBST buffer was selected as a negative control.

[0034] The results are as follows Fig. 9As shown, Giardia cysts can be seen in fecal samples of captured Siberian tigers, raccoon dogs, and ferrets under a microscope, indicating that the immunomagnetic beads can have an enrichment effect in fecal samples and have good practical application value. Example 6

[0035] The immunomagnetic bead coupling method prepared by the present invention is shown in Example 2.

[0036] Traditional immunomagnetic bead preparation method: Activation of magnetic beads: Pipette 2 mg of carboxylated magnetic beads into a 1.5 mL centrifuge tube, place the centrifuge tube on a magnetic rack to separate the solid and liquid completely, and remove the magnetic bead storage solution. Add 500 μL of activation buffer MES buffer to the tube, wash three times, then add 200 μL of MES buffer to the tube, then add 150 μL of 50 mg / mL EDC buffer and 50 mg / mL NSH buffer, each, to a total volume of 500 μL, and place on a rotator for activation at room temperature for 30 minutes.

[0037] Coupling of polyclonal antibodies to magnetic beads: Wash the activated carboxylated magnetic beads in the previous step three times with EDC buffer, add 500 μL of 0.1 μg / μL anti-β-giardin polyclonal antibody dilution (500 mL of EDC buffer + 50 μg of polyclonal antibody protein), place on a rotator, and incubate at 37°C for 3 h.

[0038] Blocking: After incubation, wash three times with PBST, and then block the remaining non-specific sites with 0.1% BSA solution prepared in PBS, place on a rotator, and incubate at room temperature for 30 minutes.

[0039] The immunomagnetic bead enrichment method is shown in Example 3. The same stool sample is mixed and then divided into two equal parts. The two types of immunomagnetic beads are used to enrich the Giardia cysts in the samples respectively, and the capture rate is calculated.

[0040] The results are as follows Fig.10 As shown, the enrichment efficiency of the immunomagnetic beads prepared by the present invention is higher than that of the immunomagnetic beads prepared by the traditional coupling method, indicating that the immunomagnetic beads prepared by the present invention have good application value. Example 7

[0041] Immunofluorescence detection of Giardia cysts in stool samples The Giardia cysts in the clinical samples enriched in Example 4 were adhered to a glass slide using polylysine and placed in a 24-well plate, and 1 mL of 4% paraformaldehyde was added to each well for fixation for 10 min; After fixation, the sections were washed three times with PBST for 5 min each time and blocked with 500 μL 3% bovine serum albumin (BSA) for 30 min; After blocking, the prepared β-giardin polyclonal antibody (1:200) was used for antibody incubation at 4°C overnight; after the primary antibody incubation, the sections were washed three times with PBST, each time for 5 min, and 200 μL of FITC-labeled goat anti-mouse IgG antibody was added and incubated at room temperature for 1 h; after the secondary antibody incubation, the sections were washed three times with PBST, each time for 5 min, and the cell nuclei were stained with DAPI, and an appropriate amount of anti-fluorescence decay quencher was added to seal the sections, and finally observed with a fluorescence microscope (such as Fig.11 as shown).

Claims

1. A Giardia immunomagnetic bead-immunofluorescence detection kit based on β-giardiacin, characterized in that It is composed of the following substances: β-giardin-streptavidin-biotin magnetic beads 100 mg; 1×PBST 100mL; Poly-L-lysine pre-treated slides; 4% paraformaldehyde 10 mL; 3% bovine serum albumin 10 mL; β-giardin polyclonal antibody 100 μL; 100 μL of FITC-labeled goat anti-mouse IgG antibody.

2. The method for preparing a Giardia immunomagnetic bead-immunofluorescence detection kit based on β-giardia according to claim 1, comprising the following steps: 1) According to the gene sequence of Giardia β-giardin, specific primers were designed, and the target fragment of Giardia β-giardin was amplified by polymerase chain reaction (PCR) to obtain the Giardia specific antigen gene β-giardin; Design specific primer sequences as follows: F:CGG CCGGAATTC ATGTCTATGTTCACCTCCACCC; R:CGG CCGCTCGAG TTAGTGCTTTGTGACCATCGAGAG; 2) Expressing and purifying Giardia β-giardin protein and preparing polyclonal antibodies of the protein, coupling the prepared β-giardin polyclonal antibodies to magnetic beads using a streptavidin-biotin binding reaction to prepare β-giardin immunomagnetic beads; 3) Take the sample and add it to the EP tube, take the coupled streptavidin-biotin anti-β-giardin immunomagnetic beads and mix them for 60 minutes; then place it on the magnetic rack, wait for the magnetic beads to be adsorbed on the magnetic rack, discard the supernatant, wash the magnetic beads with PBST 3 times, resuspend the magnetic beads with PBST, and calculate the number of magnetic beads captured; 4) The enriched Giardia cyst samples were coated onto a glass slide pretreated with poly-lysine. After fixation, blocking, β-giardin antibody incubation, fluorescent secondary antibody labeling and sealing, the enriched Giardia cysts were observed under a fluorescence microscope.

Images