Method for controlling soybean plant height and / or delaying soybean flowering time and its application

Abstract

The present invention relates to the field of biotechnology, and specifically provides a method for controlling soybean plant height and / or delaying soybean flowering time and its application. Among them, the method for controlling soybean plant height comprises: knocking out or overexpressing the GmFTIP26 gene in soybean; the above-mentioned GmFTIP26 gene has the nucleotide sequence shown in SEQ ID NO: 1. The method for delaying soybean flowering time comprises: knocking out the GmFTIP26 gene in soybean; the above-mentioned GmFTIP26 gene has the nucleotide sequence shown in SEQ ID NO: 1. Applying the technical scheme of the present invention, by knocking out or overexpressing the GmFTIP26 gene in soybean, regulating soybean plant height and / or delaying soybean flowering time, the plant can be made to better adapt to the local growth environment, which helps to improve soybean yield and quality.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for controlling soybean plant height and / or delaying soybean flowering time and application thereof. Background Art

[0002] The purpose of cultivating an ideal plant type is to achieve high crop yields by combining multiple beneficial genetic traits into one variety. Plant height is an important feature of an ideal plant type. Controlling soybean plant height to adapt its growth to the environment is of great significance for increasing soybean yield. Under adverse weather conditions (such as strong winds, heavy rains, etc.), the short plant height of soybeans: 1) can reduce losses caused by lodging, thereby improving the stability of yield; 2) can improve the efficiency of water and nutrient utilization, and its more compact growth habit makes the root system more concentrated, which helps to effectively absorb nutrients and water in the soil layer; 3) can increase the planting density per unit area, thereby increasing the effective planting area and ultimately increasing the yield per unit area; 4) in some cases, the growth period may be extended due to the relatively slow growth rate, so that the plant can obtain more photosynthetic accumulation under a reasonable environment, promoting the increase in later production; 5) it is usually easier to manage in agricultural production (such as fertilization, irrigation, etc.), and it is also convenient for mechanized harvesting, thereby reducing management costs. In general, the characteristic of shorter soybean plant height can improve crop resistance, resource utilization efficiency and economic benefits under certain conditions. Therefore, during breeding and cultivation, appropriate selection of dwarf varieties will help achieve high and stable yields.

[0003] Flowering is a core developmental process in the life cycle of plants. Plants must integrate internal factors and external cues to determine the optimal flowering time. This process is essential for the successful reproduction of all flowering plants, and because it has an important impact on the yield of crop species, it is also of great significance in crop species. Delaying the flowering time of soybeans: 1) It can extend the growth period of soybeans, allowing plants to obtain more photosynthetic accumulation during the growing season, which helps to increase the biomass and yield of individual plants; 2) It can better adapt to adverse environmental conditions such as drought or low temperature. This can reduce the risk of flowering under unsuitable climatic conditions; 3) It can avoid the peak period of some common pests and diseases, reduce the risk of pests and diseases, thereby reducing the use of pesticides and increasing the friendliness of the ecological environment; 4) In different planting areas, choosing late flowering varieties can better adapt to local climatic conditions and increase the success rate of planting. In summary, the late flowering characteristics of soybeans give them certain advantages in agricultural production, especially in responding to climate change and increasing crop yields.

[0004] At present, there are many genes that control soybean plant height, such as GmDW1, GmLHY and Dt2. Similarly, there are many genes that delay soybean flowering time, such as GmFT2a, GmFT5a and GmFT4. In addition to the above-mentioned genes that are known to regulate soybean plant height and flowering time, there are still a large number of genes, especially genes that can regulate both soybean plant height and flowering time, which are unknown. Summary of the invention

[0005] The main purpose of the present invention is to provide a method for controlling soybean plant height and / or delaying soybean flowering time and its application, so as to solve the problem that there is a lack of methods for controlling soybean plant height and / or delaying soybean flowering time in the prior art.

[0006] To achieve the above object, according to a first aspect of the present invention, a method for controlling soybean plant height is provided, the method comprising: knocking out or overexpressing the GmFTIP26 gene in soybean; the GmFTIP26 gene has a nucleotide sequence shown in SEQ ID NO: 1.

[0007] Furthermore, the above knockout was performed by gene editing to obtain soybeans with GmFTIP26 gene knockout.

[0008] Furthermore, the CRISPR-Cas9 gene editing system was used to perform the above knockout.

[0009] Furthermore, the CRISPR-Cas9 gene editing system includes an sgRNA having a nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[0010] Furthermore, the overexpression method comprises: introducing an overexpression vector into the soybean; preferably, the overexpression vector contains the GmFTIP26 gene and a strong promoter.

[0011] Furthermore, the strong promoter is selected from any one of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0012] In order to achieve the above object, according to a second aspect of the present invention, there is provided an application of the above method for controlling soybean plant height in controlling soybean plant height.

[0013] To achieve the above object, according to a third aspect of the present invention, a method for delaying flowering time of soybean is provided, the method comprising: knocking out the GmFTIP26 gene in soybean; the GmFTIP26 gene has a nucleotide sequence shown in SEQ ID NO: 1.

[0014] Furthermore, the above knockout was performed by gene editing to obtain soybeans with GmFTIP26 gene knockout.

[0015] Furthermore, the CRISPR-Cas9 gene editing system was used to perform the above knockout.

[0016] Furthermore, the CRISPR-Cas9 gene editing system includes an sgRNA having a nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7.

[0017] In order to achieve the above object, according to a fourth aspect of the present invention, there is provided a use of the above method for delaying the flowering time of soybean in delaying the flowering time of soybean.

[0018] By applying the technical solution of the present invention, knocking out or overexpressing the GmFTIP26 gene in soybean can control the plant height of soybean; wherein the above-mentioned GmFTIP26 gene has the nucleotide sequence shown in SEQ ID NO: 1. When the GmFTIP26 gene in soybean is knocked out, the soybean plant height becomes shorter, and when the GmFTIP26 gene in soybean is overexpressed, the soybean plant height becomes taller. The increase or decrease in soybean plant height may affect the growth, development and yield of soybean plants. Soybean plants with taller plant heights may be more susceptible to being blown down by the wind, while soybean plants with shorter plant heights may be affected by insufficient light. Therefore, by regulating the plant height of soybeans, the plants can be made more adaptable to the local growth environment and the yield and quality can be improved. Therefore, the regulation of plant height also helps to improve the production efficiency of soybeans. In addition, knocking out the GmFTIP26 gene in soybeans can also delay the flowering time of soybeans, increase the time of plant vegetative growth, increase the biomass of soybeans, and thus increase yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The accompanying drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the accompanying drawings:

[0020] Figure 1 The GmFTIP26 overexpression vector map according to an embodiment of the present invention is shown. The vector includes a T-DNA region, RB and LB refer to the right and left borders of the T-DNA region, respectively; the T-DNA region includes a GmFTIP26 expression frame driven by a 35S promoter and a Bar expression frame driven by a 35S promoter.

[0021] Figure 2The GmFTIP26 knockout vector map according to an embodiment of the present invention is shown. The vector includes a T-DNA region, RB and LB refer to the right and left borders of the T-DNA region, respectively; the T-DNA region includes an SgRNA expression frame driven by a GmU6 promoter and a Bar expression frame driven by a 35S promoter.

[0022] Figure 3 The target sequence and schematic diagram of GmFTIP26 knockout according to an embodiment of the present invention are shown. The GmFTIP26 gene sequence does not contain introns, SgRNA1 is located at the 303-322 base sequence at the start codon +1, and SgRNA2 is located at 717-736 bp, wherein SEQ ID NO: 12:

[0023] GAAGCGGCCGCAAGAACCACTTCCTCGGGAGGGTTAAGCTCTACGGAAC;

[0024] SEQ ID NO: 13: CGTCGGAAATGCAGTTCACCCGAGGTG;

[0025] SEQ ID NO: 14: GAAGCGGCCGCAAGAACCACTTCCTCGG;

[0026] SEQ ID NO: 15: GGTTAAGCTCTACGGAAC;

[0027] SEQ ID NO: 16: GCTCGGAAATGCAGTTCCAACC.

[0028] Figure 4 The detection of the gene level of the GmFTIP26 knockout strain according to an embodiment of the present invention is shown. Two knockout vectors, pGES201-SgRNA1 and pGES201-SgRNA2, were constructed, and Agrobacterium was transformed respectively. The Agrobacterium of the two vectors was mixed and transformed into soybean cotyledon nodes to obtain two knockout transgenic strains, wherein, SEQ ID NO: 20: TGTACAATGACAAGAAGTTCGGCAACGGAAGCGGCCGCAAGAACCACTTCCTCGGGAGGGTTAAGCTCTACGGAACTCAGTTTTCAAGAAGAGGCGAAGAAGCTCTTGTTTACTACA;

[0029] SEQ ID NO: 21:

[0030] ACATGTTACTGTTCTTCAAGCCGTTGCCTTCGCCGGCGTTCTTGGTGAAGGAGCCCTCCCAATTCGAGATGCCTTGAGTCAAAAGTTCTTCTCCGCTTCTTCGAGAACAAATGATGT;

[0031] SEQ ID NO:22:

[0032] GTCGTGGCTGAATCTCCGCCGCCGGTGGTTCATGTTTCGCAGGATCCGCCGTTGGCGGAAATGTGTGAGCCTCCGGCGTCGGAAATGCAGTTCCACCCCGAGGTGAGGAAAATGCAGGCCAA;

[0033] SEQ ID NO:23:

[0034] CAGCACCGACTTAGAGGCGGCGGCCACCAAGTACAAAGCGTCCTAGGCGGCAACCGCCTTTACACACTCGGAGGCCGCAGCCTTTACGTCAAGGTGGGGCTCCACTCCTTTTACGTCCGGTT;

[0035] SEQ ID NO:24:

[0036] TGTACAATGACAAGAAGTTCGGCAACGGAAGCGGCCGCAAGAACCACTTCCTCGGG;

[0037] SEQ ID NO:25:CCGAGGTGAGGAAAATGCAGGCCAA;

[0038] SEQ ID NO:26:TGTACAATGACAAGAAGTTCGGCAACGGAAG;

[0039] SEQ ID NO:17:

[0040] GGTTAAGCTCTACGGAACTCAGTTTTCAAGAAGAGGCGAAGAAGCTCTTGTTTACTACA;

[0041] SEQ ID NO:18:

[0042] GTCGTGGCTGAATCTCCGCCGCCGGTGGTTCATGTTTCGCAGGATCCGCCGTTGGCGGAAATGTGGTGAGCCTCCGGCGTCGGAAATGCAGTTCCACC;

[0043] SEQ ID NO: 19: GAGGTGAGGAAAATGCAGGCCAA.

[0044] Figure 5 The protein level detection of the GmFTIP26 overexpression strain according to an embodiment of the present invention is shown. Protein extraction was performed on the GmFTIP26 overexpression strain, and Western blot detection was performed using anti-Flag, wherein channel 1 represents FTIP26OE-1; channel 2 represents FTIP26OE-2; channel 3 represents FTIP26OE-3; channel 4 represents FTIP26OE-4; and channel 5 represents FTIP26OE-5.

[0045] Figure 6 The flowering time analysis of T2 generation GmFTIP26 knockout transgenic soybean according to an embodiment of the present invention is shown. Figure 6 A in the figure shows the flowering time observation statistics of wild-type W82 and knockout soybean lines under short-day conditions; Figure 6 Panel B shows the flowering time observation statistics of wild-type W82 and knockout soybean lines under long-day conditions; *p<0.05, **p<0.01, ***p<0.001 (t-test).

[0046] Figure 7 Flowering time statistics of wild-type W82, GmFTIP26 knockout and GmFTIP26 overexpression lines according to an embodiment of the present invention when planted at 5 cm, 10 cm, 15 cm and 20 cm spacing are shown, *p<0.05, **p<0.01, ***p<0.001 (t test).

[0047] Figure 8 The plant height statistics (developmental stage, before flowering) of wild-type W82, GmFTIP26 knockout and GmFTIP26 overexpression lines at 5 cm, 10 cm, 15 cm and 20 cm plant spacing according to an embodiment of the present invention are shown, *p<0.05, **p<0.01, ***p<0.001 (t test).

[0048] Fig. 9Plant height statistics (end of flowering) of wild-type W82, GmFTIP26 knockout and GmFTIP26 overexpression lines at 5 cm, 10 cm, 15 cm and 20 cm plant spacing according to an embodiment of the present invention are shown; *p<0.05, **p<0.01, ***p<0.001 (t test). DETAILED DESCRIPTION

[0049] It should be noted that, in the absence of conflict, the embodiments and features of the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0050] Terminology explanation:

[0051] Flowering time: The flowering time in the present invention refers to the time from soybean germination to the opening of the first flower.

[0052] As mentioned in the background technology, the prior art lacks a method for controlling soybean plant height, which is not conducive to soybean adapting to different growth environments, and may further affect the growth and yield of soybean. In the present invention, the inventor attempts to genetically modify soybeans to make their plant height easy to control, and thus proposes the protection scheme of the present invention.

[0053] In a first typical embodiment of the present invention, a method for controlling soybean plant height is provided, the method comprising: knocking out or overexpressing the GmFTIP26 gene in soybean; the GmFTIP26 gene has a nucleotide sequence shown in SEQ ID NO: 1.

[0054] Among them, the sequence of SEQ ID NO: 1 is:

[0055]

[0056] When the GmFTIP26 gene in soybeans is knocked out, the height of soybean plants becomes shorter. The shorter soybean plant height helps reduce the losses caused by lodging, promotes the effective absorption of nutrients and water by soybeans in the soil layer, and increases the effective planting area, thereby further increasing soybean yields. In general, the characteristic of shorter soybean plant height can improve crop resistance, resource utilization efficiency and economic benefits under certain conditions. Therefore, in breeding and cultivation, the appropriate selection of short varieties can help achieve high and stable yields.

[0057] When the GmFTIP26 gene is overexpressed in soybean, the soybean plant becomes taller. A taller plant height helps reduce the occurrence of pests and diseases because taller plants are farther from the ground, which is good for air circulation and reduces the spread of pests and diseases.

[0058] The knockout is performed by gene editing to obtain soybeans with GmFTIP26 gene knockout. In a preferred embodiment of the present invention, the knockout is performed by CRISPR-Cas9 gene editing system. The method for gene knockout has the beneficial effects of simple operation, high efficiency and strong controllability. The soybeans with GmFTIP26 gene knockout have the characteristics of shorter plant height and delayed flowering time. In a preferred embodiment of the present invention, sgRNA has the nucleotide sequence shown in SEQ ID NO: 6 or SEQID NO: 7. The use of this sgRNA to knock out the gene GmFTIP26 has the beneficial effect of high knockout efficiency.

[0059] The overexpression method comprises: transferring an overexpression vector into the soybean; the overexpression vector contains the GmFTIP26 gene and a strong promoter. The function of the strong promoter is to enhance the expression of the target gene. In a preferred embodiment of the present invention, the strong promoter is selected from any one of the following: CaMV 35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

[0060] In a second typical embodiment of the present invention, there is provided an application of the above method in controlling the height of soybean plants.

[0061] The above method for controlling soybean plant height is applied to the soybean field. By knocking out or overexpressing the GmFTIP26 gene in soybeans, the soybean plant height can be shortened or increased, thereby enabling soybeans to adapt to different growth environments and promote soybean growth, thereby further increasing soybean yields.

[0062] In a third typical embodiment of the present invention, a method for delaying flowering time of soybean is provided, which comprises: knocking out the GmFTIP26 gene in soybean; the GmFTIP26 gene has a nucleotide sequence shown in SEQ ID NO:1.

[0063] When the GmFTIP26 gene in soybeans is knocked out, the flowering time of soybeans is delayed. The delayed flowering time of soybeans helps to extend the growth period of soybeans, allowing the plants to obtain more photosynthetic accumulation during the growing season, helping to increase the biomass and yield of individual plants, helping soybeans to better adapt to adverse environmental conditions such as drought or low temperature, reducing the risk of soybean flowering under unsuitable climatic conditions, helping soybeans avoid the peak period of some common diseases and pests, reducing the risk of diseases and pests, thereby reducing the use of pesticides, increasing the friendliness of the ecological environment, and helping soybeans adapt to different planting areas. Choosing late-flowering varieties can better adapt to local climatic conditions and increase the success rate of planting. In summary, the late flowering characteristics of soybeans give them certain advantages in agricultural production, especially in responding to climate change and increasing crop yields.

[0064] In a preferred embodiment of the present invention, the knockout is performed by gene editing to obtain soybeans with GmFTIP26 gene knockout. In a more preferred embodiment of the present invention, the knockout is performed by CRISPR-Cas9 gene editing system; preferably, sgRNA has a nucleotide sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7. The method for gene knockout has the beneficial effects of simple operation, high efficiency and strong controllability.

[0065] In a fourth typical embodiment of the present invention, an application of the above method in delaying the flowering time of soybeans is provided. The above method for delaying the flowering time of soybeans is applied to the field of soybean planting. The delay of the flowering time of soybeans can be achieved by simply knocking out the GmFTIP26 gene in soybeans, which enables soybeans to better cope with climate change, and is of great significance in increasing soybean yields and the like.

[0066] The beneficial effects of the present invention will be further explained in detail below in conjunction with specific embodiments.

[0067] Example 1 Cloning of GmFTIP26 gene

[0068] The search of Soybase database showed that the DNA sequence of GmFTIP26 was located on chromosome 5 of soybean at 2540552-2544587. The nucleotide sequence of GmFTIP26 (Glyma.05G029600) is shown in SEQ ID NO: 1. Primers for cloning GmFTIP26 were designed. PCR amplification was performed using soybean leaf cDNA as a template. The amplification conditions were as follows: 98°C, pre-denaturation for 5 min; 98°C, denaturation for 30 s; 60°C, annealing for 10 s; 72°C, extension for 180 s; amplification cycle number 32; final extension at 72°C for 10 min; storage at 4°C. The PCR product was electrophoresed in a 1% agarose gel, and the target band was recovered using a Promega small agarose gel DNA recovery kit. An appropriate amount of the recovered product was taken and connected to the pTOPO-Blunt vector to transform the competent Escherichia coli. After colony PCR identification, the positive colony plasmid pTOPO-0296 was extracted and sent to the company for sequencing. The nucleotide sequences of the primers for PCR amplification of the GmFTIP26 gene are: upstream primer (SEQ ID NO: 2): ATGATGACGACGCCGTTTCAGCAACCGC; downstream primer (SEQ ID NO: 3): CTACATCAAGCGATCCGAGAGGCTGGGAA.

[0069] Example 2 Construction of expression vectors for overexpression and knockout of GmFTIP26 in soybean

[0070] The expression of the target gene GmFTIP26 in the overexpression vector consists of the 35S promoter and the 3' transcription termination region of the nopaline synthesis gene Nos. The selection marker gene is the Bar gene, which is used to encode the PAT protein. GmFTIP26 was amplified from the plasmid pTOPO-0296 using primers with BamHI and EcoRI restriction sites to obtain the target fragment with restriction sites. The vector was cut with restriction endonucleases, and then the target fragment was connected to the pENT3C-3×Flag vector backbone using homologous recombinases to form the recombinant vector pENT3C-0296-3×Flag. The structure of the overexpression vector is shown in Figure 1 The overexpression vector was introduced into soybean cotyledons, and a total of five overexpression plants were successfully obtained, which were named FTIP26OE-1 (OE-1), FTIP26OE-2 (OE-2), FTIP26OE-3 (OE-3), FTIP26OE-4 (OE-4) and FTIP26OE-5 (OE-5).

[0071] The knockout expression vector was constructed using the reported CRISPR-Cas9 technology. The structure of the vector is shown in Figure 2The steps of constructing the knockout expression vector are as follows: First, the website http: / / crispor.tefor.net / was used to design sgRNA for the coding sequence of GmFTIP26. According to the score, sgRNA1 (having the nucleotide sequence shown in SEQ ID NO: 6) was selected and constructed into the pGES201 vector, and the vector was named pGES201-sgRNA1. sgRNA2 (having the nucleotide sequence shown in SEQ ID NO: 7) was selected and constructed into the pGES201 vector, and the vector was named pGES201-sgRNA2; wherein, the nucleotide sequence of SEQ ID NO: 6 is as follows: CGGGAGGGTTAAGCTCTACG; the nucleotide sequence of SEQ ID NO: 7 is as follows: GGAAATGCAGTTCCACCCCG. Figure 3 The GmFTIP26 knockout target sequence and schematic diagram are shown.

[0072] The primers required for constructing the vector are:

[0073] sgRNA1-F (SEQ ID NO: 8): GGATTGCGTAGAGCTTAACCCTCCCG;

[0074] sgRNA1-R (SEQ ID NO: 9): AAACCGGGAGGGTTAAGCTTCTACGCA;

[0075] sgRNA2-F (SEQ ID NO: 10): GGATTGGAAATGCAGTTCCACCCCG;

[0076] sgRNA2-R (SEQ ID NO: 11): AAACCGGGGTGGAACTGCATTTCCA.

[0077] The upstream primer and the downstream primer were diluted to 10 μM, and then mixed at a ratio of 1:1 for annealing. The annealed primers, pGES201 vector, BsaI, T4 DNA ligase, and ligase buffer were mixed and ligated in a PCR instrument. The final product was transformed into Escherichia coli. After successful sequencing, the vector construction was completed. The knockout vector was introduced into soybean cotyledons, and two knockout plants were successfully obtained, named ftip26-1 (KO-1) and ftip26-2 (KO-2).

[0078] The knockout vector and overexpression vector were introduced into soybean cotyledons respectively using the Agrobacterium method. This experiment was completed by the Modern Agricultural Transgenic Platform of Peking University.

[0079] Example 3 Extraction and PCR detection of transgenic soybean genomic DNA

[0080] Extraction of soybean genomic DNA by CTAB method

[0081] Take about 1 cm of fresh soybean leaves in a 2.0 mL centrifuge tube, add a clean steel ball with a diameter of 6 mm, put it in liquid nitrogen for precooling, and then use a proofer to proof for 1 min at 50 Hz; add 600 μL CTAB extraction buffer, shake it thoroughly, and incubate it at 65°C for 30 min; cool to room temperature, add 600 μL chloroform:isoamyl alcohol (24:1), and mix well; centrifuge at 12000 rpm for 10 min, aspirate the supernatant into a new 1.5 mL centrifuge tube, add 0.7 times the volume (400-420 μL) of isopropanol, gently invert and mix well, and let it stand at room temperature for 10 min; centrifuge at room temperature at 12000 rpm for 10 min, discard the supernatant, add 1 mL 70% ethanol to rinse; centrifuge at room temperature at 12000 rpm for 5 min and blow on a clean bench for 5-10 min; add 50-100 μL ddH2O, dissolve it and store it at 4°C.

[0082] The GmFTIP26 gene was amplified by PCR using soybean genomic DNA as a template. The amplification reaction system is shown in Table 1, and the amplification reaction procedure is shown in Table 2. The nucleotide sequences of the amplification primers are: 0296-F7 (SEQ ID NO: 4): CGCGCATCACCCGAGATGAGAAG; 0296-R7 (SEQ ID NO: 5): GGATTGGCTCGACATCCTAACCCTCAC.

[0083] Table 1:

[0084]

[0085] Table 2:

[0086]

[0087] 10 μL of PCR product was tested by 1% agarose gel electrophoresis, and the amplified fragment length was about 1100 bp. The remaining products were sequenced and compared. The results showed that a total of 2 T1 generation lines were detected with GmFTIP26 gene target knockout, while the wild-type plants were not detected. The sequence comparison results are shown in Figure 4 . This method was used for PCR detection of target genes in the T2 generation and subsequent generations. Main reagents: CTAB extraction buffer: 20g CTAB, 81.9g NaCl were placed in a beaker and dissolved in 600mL deionized water, then 100mL 1M Tris-HCl (pH8.0), 40mL 0.5M EDTA (pH8.0), and finally the volume was adjusted to 1L with deionized water.

[0088] Example 4 Extraction and Western blot detection of soybean leaf protein

[0089] Sample preparation: First, prepare an appropriate amount of extraction solution according to the weight of the sample (for example, 1g of sample is added to 3.5mL of extraction solution) and place it on ice. Grinding: Place the sample in a mortar and grind it with liquid nitrogen, then add the ground sample to the extraction solution and let it stand on ice for 3-4 hours. Centrifugation: Place the mixture in a centrifuge and centrifuge it at 8000rpm for 40 minutes, or at 11100rpm for 20 minutes at 4°C. Extract the supernatant: After centrifugation, extract the supernatant, and the sample preparation is complete.

[0090] Mix 32 μL of supernatant protein solution with 8 μL of 5× protein loading buffer, denature in a PCR instrument for 5 min, and immediately place in an ice bath for 5 min; centrifuge the protein for 5 min, take the supernatant for loading, and perform electrophoresis; prepare transfer buffer, 2 glass dishes, 4 layers of filter paper, 1 PVDF membrane of appropriate size and glass rod, small tweezers, etc.; pretreat PVDF membrane: 15 s in methanol, 5 min in ddH2O, and about 5 min in transfer buffer; soak the sponge pad, SDS-PAGE gel and filter paper in transfer buffer; prepare the transfer "sandwich", and the installation order is: top, white clamp, sponge pad, 2 layers of filter paper, PVDF membrane, gel, 2 layers of filter paper, sponge pad, black clamp, bottom.

[0091] Remove the membrane and wash it in TBST for 3 minutes; block it in blocking solution at 37℃ for 3 hours or at 4℃ overnight; add primary antibody in blocking solution at a ratio of 1:3,000, hybridize for 1 hour or incubate at 4℃ overnight; wash the membrane in TBST 3 times, 8 minutes each time; add antibody in blocking solution at a ratio of 1:5000, hybridize at room temperature for 1 hour; wash the membrane in TBST 3 times, 8 minutes each time; perform chemical color development. The experimental results show that 5 overexpression transgenic lines were obtained with obvious signals (see Figure 5 ).

[0092] Example 5 Analysis of flowering time of T2 generation GmFTIP26 transgenic soybean

[0093] The T1 generation soybeans were self-pollinated to obtain the T2 generation transgenic soybeans. The flowering time of the T2 generation transgenic soybeans was observed. The wild-type W82 and transgenic soybean seeds were placed in flat dishes respectively, and a certain amount of deionized water was added for uniform germination. Seeds with the same degree of germination were planted in culture pots. The flowering time was calculated for 20 days of normal culture at 25°C with 12h of light / 12h of darkness (short day). The flowering time was calculated for 50 days of normal culture at 25°C with 16h of light / 8h of darkness (long day). Under short-day conditions, the GmFTIP26 knockout strain showed a significant late flowering phenotype compared with the W82 strain, with an average late flowering of 3 days ( Figure 6Under long-day conditions, the GmFTIP26 knockout strain showed a significant late flowering phenotype compared with the W82 strain, with an average late flowering time of 5 days ( Figure 6 B in the figure).

[0094] Example 6 Planting of T2 GmFTIP26 transgenic soybean lines in the field with gradient density

[0095] T2 transgenic soybeans were planted in the field. Four density gradients were made, each with five plots. Each plot was 3.6 square meters in area, with a row length of 4 meters, 4 rows, and a row spacing of 0.4 meters (fixed). The plant heights of the four density gradients were set at 5 cm, 10 cm, 15 cm, and 20 cm, respectively. Observations showed that the knockout strains of GmFTIP26 showed obvious late flowering phenotypes at plant spacings of 5 cm, 10 cm, 15 cm, and 20 cm, with an average late flowering time of 4 days ( Figure 7 ), the flowering time of the overexpression line was similar to that of W82.

[0096] Regardless of the strain, the height of the plant shortened with the increase of plant spacing. At plant spacings of 5 cm, 10 cm, 15 cm, and 20 cm, the height of the knockout strain of GmFTIP26 was significantly reduced, while the height of the overexpression strain was significantly increased compared with the wild-type strain W82, both during the development period (before flowering) and after flowering. Figure 8 Plant height of soybean during the developmental stage (before flowering) is shown. Fig. 9 The soybean plant height after the completion of flowering is shown.

[0097] In various assays and analysis experiments covered by this patent, each sample was measured three times in parallel, and the results were expressed as mean ± standard deviation. The difference between each sample and the control was analyzed for significance by a two-tailed t-test (*p<0.05; **p<0.01).

[0098] From the above description, it can be seen that the above-mentioned embodiments of the present invention achieve the following technical effects: the present invention can control the plant height of soybeans by knocking out or overexpressing the GmFTIP26 gene (having the nucleotide sequence shown in SEQ ID NO: 1) in soybeans. When the GmFTIP26 gene in soybeans is knocked out, the soybean plant height becomes shorter, and when the GmFTIP26 gene in soybeans is overexpressed, the soybean plant height becomes taller. The increase or decrease in soybean plant height may affect the growth, development and yield of soybean plants. By regulating the height of soybeans, the plants can be made more adaptable to the local growth environment and the yield and quality can be improved. In addition, knocking out the GmFTIP26 gene in soybeans can also delay the flowering time of soybeans, increase the time of plant vegetative growth, and increase the biomass of soybeans, thereby increasing yield.

[0099] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for controlling soybean plant height, characterized in that: The method comprises: knocking out or over-expressing the GmFTIP26 gene in soybean; the nucleotide sequence of the GmFTIP26 gene is SEQ ID NO:

1.

2. The method according to claim 1, characterized in that The knockout is performed by gene editing to obtain soybeans with GmFTIP26 gene knockout.

3. The method according to claim 2, characterized in that The knockout was performed using the CRISPR-Cas9 gene editing system.

4. The method according to claim 3, characterized in that The CRISPR-Cas9 gene editing system includes sgRNA; the nucleotide sequence of the sgRNA is SEQ ID NO: 6 or SEQ ID NO:

7.

5. The method according to claim 1, characterized in that The overexpression method comprises: transferring an overexpression vector into the soybean.

6. The method according to claim 5, characterized in that The overexpression vector contains the GmFTIP26 gene and a strong promoter.

7. The method according to claim 6, characterized in that The strong promoter is selected from any one of the following: CaMV35S promoter, UBQ10 promoter, Nos promoter, Actin2 promoter, RbcS promoter or 35S enhancer.

8. Use of the method according to any one of claims 1 to 7 in controlling the growth of soybean plants.

9. A method for delaying flowering time of soybean, characterized in that: The method comprises: knocking out the GmFTIP26 gene in soybean; the nucleotide sequence of the GmFTIP26 gene is SEQ ID NO:

1.

10. The method according to claim 9, characterized in that The knockout is performed by gene editing to obtain soybeans with GmFTIP26 gene knockout.

11. The method according to claim 10, characterized in that The knockout was performed using the CRISPR-Cas9 gene editing system.

12. The method according to claim 11, characterized in that The CRISPR-Cas9 gene editing system includes sgRNA; the nucleotide sequence of the sgRNA is SEQ ID NO: 6 or SEQ ID NO:

7.

13. Use of the method according to any one of claims 9 to 12 in delaying the flowering time of soybean.

Images