Application of detection reagent for hair follicle development related genes of down producing goat

Abstract

The invention relates to the technical field of gene engineering, in particular to application of a detection reagent for a hair follicle development related gene of a down producing goat. According to the present invention, the Cashmere goat hair follicle development related gene is any one or more of lncRNA MSTRG.20890.1, chi-miR-24-3p and ADAMTS3, and the lncRNA MSTRG.20890.1 and the ADAMTS3 are competitively combined with the chi-miR-24-3p, such that the significant differential expression of the lncRNA MSTRG.20890.1 in the Cashmere goat secondary hair follicle morphogenesis process is found, and the results prove that the lncRNA MSTRG.20890.1 can regulate the proliferation and the migration of dermal fibroblasts through the competitive combination of the lncRNA MSTRG.20890.1 and the ADAMTS3, such that the growth of the Cashmere goat secondary hair follicle morphogenesis can be inhibited therefore, the formation of a dermal papilla structure is inhibited.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering, and in particular to the application of a detection reagent for genes related to hair follicle development in cashmere goats. Background Art

[0002] Cashmere goats are excellent livestock breeds formed through long-term natural selection and artificial breeding. Inner Mongolia cashmere goats have the characteristics of strong adaptability, tolerance to roughage, strong disease resistance, and strong physique. The cashmere produced by Inner Mongolia cashmere goats is soft and shiny, and is known as "soft gold" and "fiber gem" with high economic value. The hair follicles of cashmere goats can be divided into primary hair follicles for growing wool and secondary hair follicles for growing cashmere. Cashmere is one of the important textile raw materials for the textile industry. The process of hair follicle development begins in the embryonic period and is completed after birth. At 45 days of the embryonic period of cashmere goats, the fetal skin forms a complete epidermal structure, and hair follicle formation has not yet begun. At about 55 days of the embryonic period, primary hair follicles begin to form, and the keratinocytes in the basal layer of the epidermis are arranged in a fence shape to form the hair bud structure of the primary hair follicles. At about 65 days of the embryo, the hair bud structure of the primary hair follicle grows downward into the dermis of the skin. At about 75 days of the embryo, the secondary hair follicle morphology begins to occur.

[0003] Long non-coding RNA, abbreviated as lncRNA, is a non-coding RNA with a transcription length of more than 200 nucleotides and lacks protein coding ability. Non-coding RNA is abbreviated as ncRNA. lncRNA is mainly transcribed by RNA polymerase II, so it has a structure similar to mRNA, usually with a 7mC cap structure at the 5' end and some with a poly tail structure at the 3' end. Unlike mRNA, lncRNA has a unique transcription, processing and modification pattern. Recent studies have shown that although lncRNA does not have the function of encoding proteins, it indirectly regulates the expression of protein-coding genes in epigenetic regulation, transcriptional regulation and post-transcriptional regulation. The existing lncRNA involved in hair follicle development cannot reflect the specific regulatory role, so the relationship between the detection reagents for genes related to hair follicle development in cashmere goats and hair follicle development is unknown. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the use of a detection reagent for cashmere goat hair follicle development-related genes.

[0005] The invention discloses a method for preparing a detection kit for detecting hair follicle development of cashmere goats, wherein the cashmere goat hair follicle development-related gene is any one or more of lncRNA MSTRG.20890.1, chi-miR-24-3p, and ADAMTS3, wherein the lncRNA MSTRG.20890.1 competitively binds to the chi-miR-24-3p with the ADAMTS3, and the Fig. 9 As shown;

[0006] The nucleotide sequence of lncRNA MSTRG.20890.1 is as follows Figure 10-12 As shown in SEQ ID NO.45;

[0007] The nucleotide sequence of chi-miR-24-3p is UGGCUCAGUUCAGCAGGAAC, recorded as SEQ ID NO. 46;

[0008] The nucleotide sequence of ADAMTS3 is as follows Figure 13-14 As shown in SEQ ID NO.47.

[0009] Preferably, when the related gene is lncRNA MSTRG.20890.1, the detection reagent is a sequence as shown in SEQ ID NO.24-25.

[0010] Preferably, when the related gene is chi-miR-24-3p, the detection reagent is a sequence as shown in SEQ ID NO.26-28.

[0011] Preferably, when the related gene is ADAMTS3, the detection reagent is a sequence as shown in SEQ ID NO.29-30.

[0012] Use of an agent for inhibiting the expression of the lncRNA MSTRG.20890.1 in the preparation of a hair follicle development promoter.

[0013] Preferably, the agent that inhibits the expression of lncRNA MSTRG.20890.1 is a sequence as shown in SEQ ID NO.1-2, a sequence as shown in SEQ ID NO.3-4, or a sequence as shown in SEQ ID NO.5-6.

[0014] Use of the reagent for promoting the expression of chi-miR-24-3p in the preparation of a hair follicle development promoter.

[0015] Preferably, the agent that promotes the expression of chi-miR-24-3p is the sequence shown in SEQ ID NO.22.

[0016] The invention relates to the use of the reagent for inhibiting the expression of ADAMTS3 in the preparation of a hair follicle development promoter.

[0017] Preferably, the agent for inhibiting the expression of ADAMTS3 is a sequence as shown in SEQ ID NO.13-14, a sequence as shown in SEQ ID NO.15-16 or a sequence as shown in SEQ ID NO.17-18.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] In the present invention, by analyzing the gene expression profiles of cashmere goats at different embryonic stages, it was found that lncRNA MSTRG.20890.1 located in the cytoplasm was significantly differentially expressed during the secondary hair follicle morphogenesis of cashmere goats. At the same time, it was proved that lncRNA MSTRG.20890.1 regulates the proliferation and migration of dermal fibroblasts by competitively binding to chi-miR-24-3p with ADAMTS3, thereby inhibiting the formation of dermal papilla structure, so that the detection reagents of lncRNA MSTRG.20890.1, chi-miR-24-3p and / or ADAMTS3 can be used to detect hair follicle development and prepare hair follicle development promoters. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Figure 2 is the functional analysis of lncRNA MSTRG.20890.1 in dermal fibroblasts. A is the screening of lncRNA MSTRG.20890.1 related to secondary hair follicle morphogenesis. B is the expression of lncRNA in different treatment groups. C is the apoptosis of dermal fibroblasts after interference with lncRNA MSTRG.20890.1, where (1) is NC, (2) is sh-NC, (3) is MSTRG.20890.1-sh, and (4) is the statistical situation. D is the use of EDU to detect the proliferation of lncRNA MSTRG.20890.1-sh cell lines, where (1) is the proliferation diagram, and (2) is the statistical situation. E is the use of CCK8 to detect the proliferation of lncRNA MSTRG.20890.1-sh cell lines. F is the lncRNA in skin tissues at different embryonic stages. The expression of lncRNA MSTRG.20890.1, G is the screening of the interference vector of lncRNA MSTRG.20890.1, H is the migration of lncRNA MSTRG.20890.1-sh cell line detected by cell scratch assay, where (1) is the migration diagram and (2) is the statistical situation. I is the cell cycle of lncRNA MSTRG.20890.1-sh cell line detected by DNA staining, where (1) is NC, (2) is sh-NC, (3) is MSTRG.20890.1-sh, and (4) is the statistical situation.

[0021] Figure 2lncRNA MSTRG.20890.1 can target and bind to chi-miR-24-3p. A is the detection of lncRNA MSTRG.20890.1 expression in the nucleus and cytoplasm of dermal fibroblasts. B is the prediction of the distribution of lncRNA MSTRG.20890.1 in cells by lncLocator software. C is a schematic diagram of the construction of wild / mutant lncRNA MSTRG.20890.1 luciferase reporter vector. D is the sequence of the binding site of lncRNA MSTRG.20890.1 and chi-miR-24-3p predicted by RNAhybridv2.1.2 software. E is the relative expression of chi-miR-24-3p after transfection of dermal fibroblasts with lncRNA MSTRG.20890.1-sh. F is the detection of target binding of lncRNA MSTRG.20890.1 and chi-miR-24-3p by dual luciferase reporter gene system.

[0022] Figure 3 Chi-miR-24-3p can reverse the effect of lncRNA MSTRG.20890.1 on the phenotype of dermal fibroblasts. A is the cell cycle of lncRNA MSTRG.20890.1-sh cell line detected after adding chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is lncRNA MSTRG.20890.1-sh, and (3) is lncRNA MSTRG.20890.1-sh+chi-miR-24-3p. inhibitor, (4) is the statistical situation, B is the migration of lncRNAMSTRG.20890.1-sh cell line after adding chi-miR-24-3p inhibitor, where (1) is the migration diagram and (2) is the statistical situation, C is the cell proliferation detected by adding chi-miR-24-3p inhibitor to lncRNAMSTRG.20890.1-sh cell line, where (1) is the proliferation diagram and (2) is the statistical situation, D is the apoptosis of lncRNA MSTRG.20890.1-sh cell line after adding chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is lncRNA MSTRG.20890.1-sh, and (3) is lncRNA MSTRG.20890.1-sh+chi-miR-24-3p inhibitor, (4) is the statistical situation, E is the expression of cell proliferation / apoptosis marker genes detected by qRT-PCR, and F is the expression of lncRNA MSTRG.20890.1 detected in chi-miR-24-3p interference / overexpression cell lines.

[0023] Figure 4 Figure 3 is the prediction and analysis of chi-miR-24-3p target genes, A is the construction of chi-miR-24-3p-mRNA regulatory network, B is the schematic diagram of wild-type / mutant ADAMTS3-3'UTR luciferase reporter vector construction, C is the detection of ADAMTS3 expression in chi-miR-24-3p interference / overexpression dermal fibroblast cell lines, and D is the dual luciferase reporter gene system to detect the target binding of chi-miR-24-3p and ADAMTS3-3'UTR.

[0024] Figure 5 GO enrichment analysis of chi-miR-24-3p target genes.

[0025] Figure 6 KEGG enrichment analysis of chi-miR-24-3p target genes.

[0026] Figure 7 Functional analysis of ADAMTS3 in dermal fibroblasts. A is the screening of ADAMTS3 interference vectors. B is the detection of apoptosis of dermal fibroblasts after ADAMTS3 interference, where (1) is NC, (2) is sh-NC, (3) is ADAMTS3-sh, and (4) is the statistical situation. C is the cell scratch assay to detect the migration of ADAMTS3-sh cell lines, where (1) is the migration graph, and (2) is the statistical situation. D is the use of EDU to detect the proliferation of ADAMTS3-sh cell lines, where (1) is the migration graph, and (2) is the statistical situation. E is the use of DNA staining to detect the cell cycle of ADAMTS3-sh cell lines, where (1) is NC, (2) is sh-NC, (3) is ADAMTS3-sh, and (4) is the statistical situation.

[0027] Figure 8Chi-miR-24-3p can reverse the effect of ADAMTS3 on the phenotype of dermal fibroblasts. A is the apoptosis of ADAMTS3-sh cell line detected after adding chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is ADAMTS3-sh, (3) is ADAMTS3-sh+chi-miR-24-3p inhibitor, and (4) is the statistical situation. B is the migration of ADAMTS3-sh cell line detected after adding chi-miR-24-3p inhibitor, where (1) is the migration diagram, (2) is the statistical situation. C is the cell cycle of ADAMTS3-sh cell line detected after adding chi-miR-24-3p inhibitor, where (1) is sh-NC, (2) is ADAMTS3-sh, and (3) is ADAMTS3-sh+chi-miR-24-3p. inhibitor, (4) is the statistical situation, D is the proliferation of ADAMTS3-sh cell line detected after adding chi-miR-24-3p inhibitor, where (1) is the migration diagram, (2) is the statistical situation, and E is the expression of cell proliferation / apoptosis marker genes detected by qRT-PCR.

[0028] Fig. 9 Schematic diagram of the regulatory mechanism of lncRNA MSTRG.20890.1 / chi-miR-24-3p / ADAMTS3.

[0029] Fig.10 It is the fragment of 1bp-2744bp in the lncRNA MSTRG.20890.1 sequence of the present invention.

[0030] Fig.11 It is the fragment of 2745bp-7013bp in the lncRNA MSTRG.20890.1 sequence of the present invention.

[0031] Fig.12 The invention is a fragment of 7014bp-11217bp in the lncRNA MSTRG.20890.1 sequence.

[0032] The lncRNA MSTRG.20890.1 sequence is Figure 10-12 The sequences in are connected in sequence.

[0033] Fig.13 It is the fragment of 1 bp to 4259 bp in the ADAMTS3 sequence of the present invention.

[0034] Fig.14 It is the fragment of 4260bp-5842bp in the ADAMTS3 sequence of the present invention.

[0035] The ADAMTS3 sequence described above is Figure 13-14 formed by sequentially connecting the sequences in

[0036] Note: NC represents the blank control, and sh-NC represents the negative control. Specific embodiments

[0037] The following is a detailed description of the specific embodiments of the present invention. However, it should be understood that the protection scope of the present invention is not limited by the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.

[0038] Example

[0039] Twelve 3-year-old Inner Mongolia cashmere goat ewes with the same feeding conditions were selected and divided into 4 groups. The ewes were mated and the mating time was recorded. According to the mating records, the ewes were subjected to cesarean section, and the fetal skin tissues at 45, 55, 65, and 75 days of embryonic development were collected and stored in liquid nitrogen.

[0040] 1. Screening and identification of key lncRNAs in secondary hair follicle morphogenesis

[0041] In previous studies, transcriptome sequencing was performed on 12 lateral skin tissues at four different embryonic stages of Inner Mongolia cashmere goats, and the lncRNA expression profiles in the skin tissues at four different embryonic stages were obtained. The four different embryonic stages were: 45 days was denoted as d45, 55 days was denoted as d55, 65 days was denoted as d65, and 75 days was denoted as d75.

[0042] First, the total RNA of the samples was extracted using Trizol reagent. The detection of all 12 samples met the sequencing standards, and the sequencing standards were: 1.8 < OD260 / OD280 < 2.4, 1.5 < OD260 / OD230 < 2.4, 7 ≤ Rin < 10. Subsequently, paired-end sequencing was performed using Illumina Hiseq 4000 to obtain the raw data. The data was aligned with the reference genome using Bowtie and Hisat2 tools, the reads were assembled and transcribed using Stringtie, and CPC and CNCI were used to predict the coding ability of the RNA. Finally, RNAs with a transcript length greater than 200 bp, a CPC score ≤ 0.5, and a CNCI score ≤ 0 were regarded as lncRNAs for subsequent research.

[0043] Differentially expressed lncRNAs related to secondary hair follicle morphogenesis were screened based on the characteristics of embryonic hair follicle development. The three comparison groups of d55vsd45, d65vsd45 and d65vsd55 were used as stage A related to primary hair follicle development, and the three comparison groups of d75vsd45, d75vsd55 and d75vsd65 were used as stage B related to primary and secondary hair follicle development. The common part of stage B and stage A was removed from stage B, that is, the intersection part was removed from stage B, and the remaining part was used as important lncRNAs related to secondary hair follicle morphogenesis and development. The screening criteria for differentially expressed lncRNAs were based on FPKM values, and differential expression analysis was performed using edge software, with the screening conditions of |log2(Foldchange)|≥1 and P≤0.05.

[0044] 2. Cell culture

[0045] Dermal fibroblasts were cultured in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 complete medium containing 10% fetal bovine serum, 100 μg / ml penicillin and 100 μg / ml streptomycin. All cell lines were cultured in an incubator at 37°C with 5% carbon dioxide.

[0046] 3. Construction of interference / overexpression cell lines

[0047] lncRNA MSTRG.20890.1 interference plasmid, ADAMTS3 interference plasmid, and chi-miR-24-3p interference / overexpression plasmid were prepared by Shanghai Hanheng Biotechnology Co., Ltd. Lentivirus transfection was performed according to the manufacturer's instructions. Cells were cultured in basal medium containing optimal concentration of polybrene for 4 hours, and then the medium was replaced and lentivirus was added for transfection. After transfection, puromycin was added for resistance screening. Finally, qRT-PCR was used to detect whether each cell line was successfully constructed.

[0048] lncRNA MSTRG.20890.1 interference vector construction process: According to the lncRNA MSTRG.20890.1 sequence information, the target fragment was amplified and purified by PCR and PAGE purification methods, and finally three pairs of lncRNAMSTRG.20890.1 shRNA were obtained, which were named lncRNA MSTRG.20890.1-sh1, lncRNAMSTRG.20890.1-sh2 and lncRNA MSTRG.20890.1-sh3, and their shRNA sequence information is shown in Table 1.

[0049] Table 1 shRNA sequence information of lncRNA MSTRG.20890.1

[0050]

[0051] The lncRNA MSTRG.20890.1-sh1, lncRNA MSTRG.20890.1-sh2 and lncRNA MSTRG.20890.1-sh3 fragments were respectively connected with the pHBLV-U6-MCS-CMV-ZsGreen-PGK-PURO vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd.) by the T4 ligation method to complete the construction of the lncRNA MSTRG.20890.1 interference plasmid.

[0052] Subsequently, the constructed interference plasmid was mixed with the transformation competent DH5a, the bacterial solution was plated and placed in an incubator for 16 hours; single clones were selected for colony verification, and positive clones were sequenced for verification; plasmids were extracted and purified if the sequencing results were consistent with the target sequence. Among them, the lncRNA MSTRG.20890.1-shRNA synthesized by PCR amplification is a hairpin structure, which can be cut in cells to form siRNA, which binds to the RNA-induced silencing complex (RISC) to inhibit the expression of the lncRNA MSTRG.20890.1 gene. The siRNA sequence information of lncRNA MSTRG.20890.1 is shown in Table 2.

[0053] Table 2 siRNA sequence information of lncRNA MSTRG.20890.1

[0054]

[0055] The construction process of ADAMTS3 interference vector is the same as that of lncRNA MSTRG.20890.1 interference vector, except that lncRNA MSTRG.20890.1 is changed to ADAMTS3. The shRNA sequence information of ADAMTS3 is shown in Table 1, and the siRNA sequence information of ADAMTS3 is shown in Table 2.

[0056] Table 3 ADAMTS3 shRNA sequence information

[0057]

[0058] Table 4 ADAMTS3 siRNA sequence information

[0059] Gene name sequence Sequence number ADAMTS3-siRNA1 CAAACACCACTGGTTGCCATATGAA SEQ ID NO.19 ADAMTS3-siRNA2 CAGTAAATCCAATGGTGCTAACTTA SEQ ID NO.20 ADAMTS3-siRNA3 TCTCCGGTGCCTGGGAATATATGA SEQ ID NO.21

[0060] Chi-miR-24-3p interference / overexpression vector construction process:

[0061] According to the chi-miR-24-3p sequence information, the target fragment was amplified by PCR, and finally the chi-miR-24-3p interference sequence and chi-miR-24-3p overexpression sequence were obtained, which were named chi-miR-24-3p inhibitor and chi-miR-24-3p mimic, respectively. The sequence information is as follows:

[0062] chi-miR-24-3p mimic: GAAGTCAAGCAAGACTATGTCAGCGGTAGATGATGTGTGAGTAGAGCTGGGCGCTTTCAAAGGAGACGTCCTCTTGTGATTTCCGAGCACGGTGAACTCTCTCTTGTATTTGCAGTC CAGGTCTGTGTCTTCTGCAGCGCCAGTGGAACGAGGCCGAGCGAGCTCCCAGCCGAGGCGCTGCTTCTCCGGGCTGTCAGTTGGACCCGCCCTCCGGTGCCTACTGAGCTGATATCAGTTCTC ATTTTACACACTGGCTCAGTTCAGCAGGAACAGGAGTCGAGCCCTAGAGCAAAGCCTTCCTGTTTGTAAGTGCCCAGAGGCCTGGGAGCTGAGACTGCAGCTGCGTGAGGACCGGCCTGAGCG CCCGCAGCACAGCTGACCGGCAGCGGTGGTGGCCCCTCTGTATGTGTCCTGTGTGTGGGTGTCGGTACAGTCAGAGTTCTGTTGATACAAGAGAAATGAGCTTCCACCCGAAAAGGC, denoted as SEQ ID NO.22;

[0063] chi-miR-24-3p inhibitor: GTTCCTGCTTCCTGAGCCATATACGTTCCTGCTTCCTGAGCCAACATCGTTCCTGCTTCCTGAGCCATCTTCAGTTCCTGCTTCCTGAGCCA, recorded as SEQ ID NO. 23.

[0064] The chi-miR-24-3p inhibitor and chi-miR-24-3pmimic fragments were connected to pHBLV-CMV-ZsGreen-T2A-Puro vector (purchased from Hanheng Biotechnology (Shanghai) Co., Ltd.) using the HB infusionTM one-step cloning and ligation system to complete the construction of the lncRNA MSTRG.20890.1 interference plasmid. Subsequently, the constructed interference plasmid was mixed with the transformation competent DH5a, the bacterial solution was plated and placed in an incubator for 16 hours; single clones were selected for colony verification, and positive clones were sequenced for verification; if the sequencing results were consistent with the target sequence, plasmid extraction and purification were performed.

[0065] 4. Real-time fluorescence quantitative PCR

[0066] Total RNA was extracted from cells using Trizol reagent (Invitrogen) according to the manufacturer's instructions. Genomic DNA in total RNA was removed using gDNAEraser, and the treated RNA was reverse transcribed. lncRNA and mRNA were reverse transcribed into cDNA using Primer ScriptTM reagent kit (Takara, China) and expressed using TB Premix ExTaq TM II (Takara, China). For miRNA qRT-PCR, RNA was reverse transcribed into cDNA and qRT-PCR was performed using the Bulge Loop miRNA qRT-PCR Starter Kit (RiboBio, China). The expression levels of lncRNA, mRNA, and miRNA were measured using 2 -ΔΔCT Method calculation.

[0067] 5. Nuclear-cytoplasmic separation experiment

[0068] lncLocator was used to predict the subcellular locations of lncRNA MSTRG.20890.1, such as cytoplasm, nucleus and ribosome. At the same time, according to the manufacturer's instructions, the cytoplasmic RNA and nuclear RNA of dermal fibroblasts were extracted and purified using Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek), and their expression in different cellular locations was detected by qRT-PCR.

[0069] 6. Dual luciferase

[0070] Targetscan and miRanda software were used to predict miRNAs targeted by lncRNA and mRNAs targeted by miRNA, and the lncRNA-miRNA-mRNA regulatory network was preliminarily constructed. Subsequently, based on the predicted results, the chi-miR-24-3p / ADAMTS3 signal axis was selected as the candidate target of lncRNA MSTRG.20890.1. The dual luciferase reporter gene system was used to detect the targeting relationship between lncRNA MSTRG.20890.1 and chi-miR-24-3p, and between chi-miR-24-3p and ADAMTS3. Chi-miR-24-3pmimic was co-transfected with psiCHECK2-MSTRG.20890.1-WT / MUT and psiCHECK2-ADAMTS3-WT / MUT using LipoFiter transfection reagent (the vectors were synthesized by Hanheng, China). 48 hours after transfection, the luciferase level was detected using the dual-luciferase reporter assay system (Promega, Wisconsin), and the Renilla luciferase activity was normalized.

[0071] 7. CCK8

[0072] Cell proliferation ability was measured using Cell Counting Kit-8 (CCK-8) (Solarbio, China) according to the manufacturer's instructions. Optical density was measured at a wavelength of 450 nm using a microplate reader.

[0073] 8. EdU Assay

[0074] EdU assay based on BeyoClick TM The EdU-555 cell proliferation detection kit (Beyotime, China) was used as described in the instructions. After culturing dermal fibroblasts in a 24-well plate for 24 h, they were incubated with 1×EDU working solution for 2 h, fixed with 4% paraformaldehyde for 15 min, incubated with 0.3% TritonX-100 for 15 min, and stained with 1×Hoechst for 15 min. Under an inverted fluorescence microscope, the cells were counted in three random fields in each well. The proliferation rate of each group of cells was the ratio of EdU-labeled proliferating cells to Hoechst-labeled cells.

[0075] 9. Cell apoptosis detection

[0076] According to the manufacturer's instructions, the Annexin V-APC / PI apoptosis detection kit (Elabscience Biotechnology, China) was used to determine cell apoptosis. Single cell suspension was prepared, and 100 μl of 1x Annexin V Binding Buffer, 2.5 μl of Annexin V-APC Reagent and 2.5 μl of PI Reagent were added in sequence, the cells were resuspended and incubated at room temperature in the dark for 20 min. Finally, 400 μl of 1x Annexin V Binding Buffer was added and cell apoptosis was detected by flow cytometry (apoptotic cells = (early apoptotic cells + late apoptotic cells) / total cells).

[0077] 10. DNA staining

[0078] The cell cycle was determined by DNA content quantification (Solarbio, China) according to the manufacturer's instructions. The cells were collected and 70% pre-cooled ethanol was added, the cells were resuspended and placed in a 4°C refrigerator for fixation. After 24 h, the fixative was removed; 100 μl of RNase A solution was added to the cell pellet and incubated in a 37°C water bath for 30 minutes. Subsequently, 400 μl of propidium iodide (PI) staining solution was added and mixed thoroughly, and incubated at 4°C in the dark for 30 minutes. The red fluorescence at an excitation wavelength of 488 nm was detected by flow cytometry.

[0079] 11. Cell scratch test

[0080] The cell scratch test was performed by scratching the cell monolayer with a sterile 200 μl pipette tip and photographing the scratched area using a microscope. After the scratch, the cells were washed three times with PBS and replaced with fresh serum-free medium. The cells were cultured in an incubator at 37°C and 5% CO2. Images were collected at 0h and 24h after the scratch. Cell migration rate = [(0h blank area - 24h blank area) * 100 / 0h blank area].

[0081] Table 5 Sequence information of each gene detected

[0082]

[0083]

[0084] result

[0085] 1. Screening of important lncRNAs for secondary hair follicle morphogenesis

[0086] Based on the previously constructed transcriptome database of the skin of Inner Mongolia cashmere goats at 45, 55, 65 and 75 days. |log2foldchange|≥1 and P value <0.05 were used as screening conditions for differential expression analysis. A total of 1209 differentially expressed lncRNAs were identified, including 157 differentially expressed lncRNAs in the d45vsd55 comparison group, 802 differentially expressed lncRNAs in the d45vsd65 comparison group, 670 differentially expressed lncRNAs in the d45vsd75 comparison group, 807 differentially expressed lncRNAs in the d55vsd65 comparison group, 628 differentially expressed lncRNAs in the d55vsd75 comparison group, and 177 differentially expressed lncRNAs in the d65vsd75 comparison group. Figure 1 Middle B.

[0087] Based on the characteristics of primary and secondary hair follicle morphogenesis and development in cashmere goats, lncRNAs differentially expressed in different embryonic periods were further screened and analyzed. First, the three comparison groups of d55vsd45, d65vsd45 and d65vsd55 were set as stage A, with a total of 1051 lncRNAs related to primary hair follicle morphogenesis and development; the three comparison groups of d75vsd45, d75vsd55 and d75vsd65 were set as stage B, with a total of 903 lncRNAs related to primary or secondary hair follicle morphogenesis and development. After removing the common parts of stage B and stage A from stage B, the remaining 158 lncRNAs were regarded as important lncRNAs related to secondary hair follicle morphogenesis and development, such as Figure 1 A in Figure 1. Among the 158 lncRNAs associated with secondary hair follicle morphogenesis, lncRNA MSTRG.20890.1 was found to be significantly low expressed at embryonic day 75. Subsequently, qRT-PCR was used to further verify its expression in skin tissues at different embryonic stages. The results showed that lncRNA MSTRG.20890.1 was significantly low expressed at embryonic day 75, a critical period for secondary hair follicle morphogenesis, such as Figure 1 F in.

[0088] 2. lncRNA MSTRG.20890.1 inhibits the proliferation and migration of dermal fibroblasts

[0089] LncRNA MSTRG.20890.1 is an RNA transcribed from the intron region of the ZNF385D gene with a length of 11217 bp. Figure 1A in the figure. The coding ability of lncRNA MSTRG.20890.1 was analyzed using CPC and CNCI software. The results showed that the scores of CPC and CNCI were 0.274 and -0.043, respectively, indicating that lncRNA MSTRG.20890.1 could not encode protein. Subsequently, three pairs of lncRNA MSTRG.20890.1 interference vectors were constructed, and lncRNAMSTRG.20890.1-sh1 / 2 / 3 were transfected into dermal fibroblasts by lentivirus. The morphogenesis and development of hair follicles are the result of continuous proliferation and differentiation of dermal fibroblasts and epithelial cells. In addition, dermal fibroblasts eventually form dermal papilla structure through continuous proliferation and differentiation, which is the signal center of periodic growth and regeneration of hair follicles. Therefore, dermal fibroblasts were selected for subsequent experiments. The interference efficiency of the vector was detected by qRT-PCR. The vectors sh1, sh2 and sh3 can all significantly inhibit the expression of lncRNAMSTRG.20890.1, among which sh2 has the best interference efficiency. Figure 1 The G in.

[0090] First, flow cytometry was used to detect the effect of lncRNA MSTRG.20890.1 interference on dermal fibroblasts. The experimental results showed that when lncRNA MSTRG.20890.1 was interfered, the proportion of late apoptotic cells in dermal fibroblasts was significantly lower than that in the control group, indicating that lncRNA MSTRG.20890.1-sh can inhibit the apoptosis of dermal fibroblasts. Figure 1 In addition, CCK8 and EDU were used to detect the proliferation of lncRNA MSTRG.20890.1-sh cell lines. The results showed that after interfering with lncRNA MSTRG.20890.1, the number of EDU-positive cells in dermal fibroblasts increased significantly, and the proliferation ability of cells was also significantly higher than that of the control group. Figure 1 D and E in .

[0091] The above experimental results show that interfering with lncRNA MSTRG.20890.1 can promote the proliferation of dermal fibroblasts and inhibit cell apoptosis. Subsequently, flow cytometry was used to detect changes in the cell cycle to further explore the promoting effect of lncRNAMSTRG.20890.1-sh on cell proliferation. It was found that after interfering with lncRNA MSTRG.20890.1, the number of cells in the S phase increased significantly, while the proportion of cells in the G1 phase and G2 / M phase decreased significantly, indicating that lncRNA MSTRG.20890.1-sh achieves cell proliferation by increasing the proportion of cells in the S phase and blocking the G1 phase and G2 / M phase. Figure 1I in. Hair follicles are the result of continuous proliferation and differentiation of epithelial cells and dermal fibroblasts. During the entire process of hair follicle development, as the hair follicle structure continues to mature, dermal fibroblasts not only proliferate and differentiate, but also continuously penetrate into the dermis to form the dermal papilla structure of the hair follicle. Therefore, in the present invention, a cell scratch experiment was used to explore the effect of lncRNA MSTRG.20890.1 on the migration ability of dermal fibroblasts. It was found that after transfection with lncRNA MSTRG.20890.1-sh, the migration ability of dermal fibroblasts was significantly enhanced, such as Figure 1 The combined results of the above experiments indicate that lncRNA MSTRG.20890.1-sh can enhance the proliferation and migration of dermal fibroblasts. At the same time, its promoting effect on the proliferation of dermal fibroblasts may be achieved by increasing the proportion of cells in the S phase.

[0092] 3. lncRNA MSTRG.20890.1 participates in the morphogenesis and development of secondary hair follicles by binding to chi-miR-24-3p

[0093] The location of lncRNA in cells determines its function. Studies have shown that lncRNAs in the cytoplasm can regulate gene expression by binding to miRNAs. Therefore, lncLocator software and nuclear-cytoplasmic separation experiments were used to predict and analyze the location of lncRNA MSTRG.20890.1 in cells. The results showed that it is mainly expressed in the cytoplasm, such as Figure 2 A and B in the figure. Subsequently, bioinformatics analysis was performed using TargetScan and miRanda databases, and it was found that lncRNA MSTRG.20890.1 had potential binding sites with chi-miR-24-3p. RNAhybrid (v2.1.2) software was further used to obtain the sequence information of the binding sites between lncRNA MSTRG.20890.1 and chi-miR-24-3p. Figure 2 D in the figure shows that the free energy of binding between lncRNAMSTRG.20890.1 and chi-miR-24-3p is less than -20 kcal / mol, indicating a strong binding ability. The expression of chi-miR-24-3p in the lncRNA MSTRG.20890.1-sh cell line was detected by qRT-PCR, and it was found that the miRNA was significantly highly expressed in the cell line, such as Figure 2 In addition, wild-type and mutant lncRNA MSTRG.20890.1 dual-luciferase reporter plasmids were constructed, as Figure 2C in the figure, and a dual luciferase reporter gene experiment was performed to verify the target binding relationship between lncRNAMSTRG.20890.1 and chi-miR-24-3p. The results showed that overexpression of chi-miR-24-3p significantly reduced the fluorescence activity of the lncRNA MSTRG.20890.1-WT luciferase reporter gene, while the mutant type had no significant change, indicating that lncRNA MSTRG.20890.1 and chi-miR-24-3p do have a target binding relationship, such as Figure 2 F in.

[0094] 4. Chi-miR-24-3p can counteract the promoting effect of lncRNA MSTRG.20890.1-sh on the proliferation and migration of dermal fibroblasts

[0095] To further explore the interaction between lncRNA MSTRG.20890.1 and chi-miR-24-3p in dermal fibroblasts, several rescue experiments were performed by co-transfecting lncRNA MSTRG.20890.1-sh and chi-miR-24-3p inhibitor. First, the expression of lncRNAMSTRG.20890.1 was detected in chi-miR-24-3p inhibitor and chi-miR-24-3p overexpressing cell lines, respectively. After chi-miR-24-3p interference, the expression of lncRNA MSTRG.20890.1 was significantly increased. In contrast, its expression was significantly decreased in chi-miR-24-3p overexpressing cell lines, as shown in Figure 2. Figure 3 F in. Subsequently, the results of the EDU experiment and cell cycle experiment showed that the knockdown of lncRNA MSTRG.20890.1 significantly promoted the proportion of EDU-positive cells in dermal fibroblasts and increased the number of S phase cells. However, when lncRNA MSTRG.20890.1-sh was co-transfected with the chi-miR-24-3p inhibitor, the number of EDU-positive cells and S phase cells was significantly reduced, and the proportion of G2 / M phase cells was significantly increased, as shown in Figure 2. Figure 3 A and C in the figure. At the same time, it was found that lncRNA MSTRG.20890.1-sh could significantly promote the expression of cell proliferation-related genes such as PCNA, CCND1 and CCND2. However, after adding chi-miR-24-3p inhibitor to this cell line, the expression of proliferation-related genes was significantly reduced compared with lncRNA MSTRG.20890.1-sh in the experimental group, such as Figure 3F. At the level of apoptosis, it was found that when the chi-miR-24-3p inhibitor was added to the lncRNA MSTRG.20890.1-sh cell line, apoptosis of dermal fibroblasts was promoted, and this promotion offset the inhibition of apoptosis by lncRNA MSTRG.20890.1-sh, as Figure 3 D. At the same time, it was found that when the chi-miR-24-3p inhibitor was added to the lncRNA MSTRG.20890.1-sh cell line, the mRNA expression levels of pro-apoptotic genes such as Bax and Casp9 were significantly increased, while the mRNA expression level of the anti-apoptotic gene Bcl2 was significantly decreased compared with the experimental group lncRNA MSTRG.20890.1-sh, as shown in Figure 2. Figure 3 In terms of cell migration, lncRNA MSTRG.20890.1-sh significantly promoted the migration of dermal fibroblasts, while this promoting effect was reversed after co-transfection with chi-miR-24-3p inhibitor, as shown in Figure 3 In conclusion, the above results indicate that chi-miR-24-3p inhibitor can rescue the promoting effects of lncRNA MSTRG.20890.1-sh on proliferation and migration of dermal fibroblasts and the inhibiting effects on apoptosis.

[0096] 5. ADAMTS3 targets and binds to chi-miR-24-3p to participate in the morphogenesis and development of secondary hair follicles

[0097] To further identify the potential regulatory mechanism, TargetScan and miRanda databases were used to predict the target genes of chi-miR-24-3p. It was found that chi-miR-24-3p had a targeting relationship with 1476 genes, and its regulatory network was as follows Figure 4 As shown in A. Subsequently, GO and KEGG enrichment analysis was performed on the target genes of chi-miR-24-3p. The results showed that these target genes were significantly enriched in signaling pathways related to hair follicle occurrence and development, such as Wnt, TGF-β and Fox0. Figure 5 , Figure 6 Therefore, the ADAMTS3 gene enriched in the TGF-β signaling pathway was selected for subsequent experimental verification and analysis.

[0098] First, the dual luciferase reporter gene system was used to verify the targeting relationship between chi-miR-24-3p and ADAMTS3. The wild-type and mutant plasmids of the 3'UTR region of ADAMTS3 were constructed, respectively. Figure 4B in the figure, and the wild-type and mutant plasmids were co-transfected with chi-miR-24-3p overexpression into 293T cells. The relative luciferase activity in the cells was detected. The results of the dual luciferase reporter system showed that chi-miR-24-3p overexpression significantly reduced the fluorescence activity of the ADAMTS3-3'UTR-WT luciferase reporter gene, while the mutant type had no change, indicating that chi-miR-24-3p does have a target binding site with ADAMTS3, such as Figure 4 D in. Subsequently, qRT-PCR was used to detect the expression of ADAMTS3 in dermal fibroblast cell lines with chi-miR-24-3p interference / overexpression. The results showed that interference with chi-miR-24-3p could increase the expression level of ADAMTS3, while overexpression of chi-miR-24-3p could inhibit the expression of ADAMTS3, as shown in Figure 4 The above results indicate that there is indeed a conserved target site of chi-miR-24-3p in ADAMTS3, and this target binding site can significantly inhibit the expression of the ADAMTS3 gene.

[0099] 6. ADAMTS3 inhibits the proliferation and migration of dermal fibroblasts

[0100] The ADAMTS protease family was first discovered in mice and is structurally similar to ADAM enzymes. This family can be divided into four subclasses, of which ADAMTS3 belongs to the second subclass and is an important gene in the TGF-β signaling pathway. Therefore, three ADAMTS3 interference vectors were constructed and transfected into dermal fibroblasts by lentivirus. qRT-PCR was used to detect the interference efficiency of ADAMTS3-sh1 / sh2 / sh3. The experimental results showed that ADAMTS3-sh2 had the best interference efficiency, such as Figure 7 A in Figure 1. First, EDU and AnnexinV-APC / PI double staining were used to detect cell proliferation and apoptosis. The experimental results showed that ADAMTS3-sh could significantly inhibit the apoptosis of dermal fibroblasts, increase the proportion of EDU-positive cells, and accelerate cell proliferation. Figure 7 In addition, the effect of ADAMTS3 on the cell cycle was further explored by DNA staining. It was found that knocking down ADAMTS3 significantly increased the proportion of cells in the S phase and G2 / M phase in dermal fibroblasts, and decreased the proportion of cells in the G1 phase, such as Figure 7 The results of the cell migration experiment showed that when ADAMTS3-sh was transferred into dermal fibroblasts, their cell migration ability was significantly increased, as shown in Figure 7C in the figure. The results showed that knockdown of ADAMTS3 significantly enhanced the proliferation and migration of dermal fibroblasts and reduced the apoptosis of dermal fibroblasts. It should be noted that the effects of ADAMTS3-sh and lncRNA MSTRG.20890.1-sh on the phenotype of dermal fibroblasts are consistent, which is consistent with the ceRNA hypothesis.

[0101] 7. lncRNA MSTRG.20890.1 inhibits proliferation and apoptosis of dermal fibroblasts through the chi-miR-24-3p / ADAMTS3 signaling axis

[0102] Based on previous studies, it was found that chi-miR-24-3p can bind to lncRNA MSTRG.20890.1, and chi-miR-24-3p inhibitors can offset the promoting effects of lncRNA MSTRG.20890.1-sh on dermal fibroblast proliferation and migration and the inhibiting effects on apoptosis. Therefore, it was hypothesized that the chi-miR-24-3p inhibitor could also act as an inhibitor of ADAMTS3-sh to offset the effects of ADAMTS3-sh on the phenotype of dermal fibroblasts. To prove this hypothesis, co-transfection of ADAMTS3-sh and chi-miR-24-3p inhibitor was performed, and their relationship was verified at the cellular level by rescue experiments. The AnnexinV-APC / PI double staining method was used to detect changes in cell apoptosis after co-transfection of ADAMTS3-sh and chi-miR-24-3p inhibitor. It was found that the ADAMTS3-sh cell line with chi-miR-24-3p inhibitor could offset the inhibition of apoptosis induced by ADAMTS3-sh, such as Figure 8 A. The changes in cell proliferation and migration were detected using the EdU method and cell scratch assay. Figure 8 As can be seen from B and D, after the addition of the chi-miR-24-3p inhibitor to the ADAMTS3-sh cell line, the number of EDU-positive cells decreased significantly and the cell migration ability was also reduced. Subsequently, the effect of the chi-miR-24-3p inhibitor on the ADAMTS3-sh dermal fibroblast cell line was further explored by DNA staining. It was found that after interfering with ADAMTS3, the proportion of S phase cells in dermal fibroblasts increased significantly. When the chi-miR-24-3p inhibitor was added to the ADAMTS3-sh cell line, the increase in the proportion of S phase cells caused by ADAMTS3-sh was rescued. This suggests that the proliferation of dermal fibroblasts caused by ADAMTS3-sh may be achieved by increasing the proportion of S phase cells, such as Figure 8C in. In addition, the expression of proliferation and apoptosis marker genes in the ADAMTS3-sh cell line and the ADAMTS3-sh and chi-miR-24-3p inhibitor co-transfected cell line was detected. It was found that ADAMTS3-sh can promote the expression of cell proliferation-related marker genes and inhibit the expression of apoptosis-related genes. When ADAMTS3-sh2 and chi-miR-24-3p inhibitor were co-transfected, the expression of cell proliferation-related marker genes was significantly inhibited, while the expression of apoptosis-related marker genes was significantly promoted compared with the ADAMTS3-sh group, as shown in Figure 2. Figure 8 E in. The above results indicate that ADAMTS3, as a target gene of chi-miR-24-3p, can promote apoptosis of dermal fibroblasts and inhibit their proliferation and migration. The effect of ADAMTS3 on the phenotype of dermal fibroblasts is regulated by chi-miR-24-3p. This result further indicates that chi-miR-24-3p and ADAMTS3 do have a targeting relationship in cells, and they jointly regulate the proliferation and migration of dermal fibroblasts.

[0103] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0104] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0105] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of a detection reagent for cashmere goat hair follicle development-related genes in the preparation of a hair follicle development detection kit, characterized in that: The cashmere goat hair follicle development-related gene is any one or more of lncRNAMSTRG.20890.1, chi-miR-24-3p, and ADAMTS3, and the lncRNA MSTRG.20890.1 and the ADAMTS3 competitively bind to the chi-miR-24-3p; The nucleotide sequence of lncRNAMSTRG.20890.1 is shown in SEQ ID NO.45; The nucleotide sequence of chi-miR-24-3p is shown in SEQ ID NO.46; The nucleotide sequence of ADAMTS3 is shown in SEQ ID NO.

47.

2. The use according to claim 1, characterized in that: When the related gene is lncRNA MSTRG.20890.1, the detection reagent is a sequence as shown in SEQ ID NO.24-25.

3. The use according to claim 1, characterized in that: When the related gene is chi-miR-24-3p, the detection reagent is a sequence as shown in SEQ ID NO.26-28.

4. The use according to claim 1, characterized in that: When the related gene is ADAMTS3, the detection reagent is a sequence as shown in SEQ ID NO.29-30.

5. Use of an agent for inhibiting the expression of lncRNAMSTRG.20890.1 described in claim 1 in the preparation of a hair follicle development promoter.

6. The use according to claim 5, characterized in that: The agent for inhibiting the expression of lncRNAMSTRG.20890.1 is a sequence as shown in SEQ ID NO.1-2, a sequence as shown in SEQ ID NO.3-4 or a sequence as shown in SEQ ID NO.5-6.

7. Use of an agent for promoting the expression of chi-miR-24-3p as claimed in claim 1 in the preparation of an agent for promoting hair follicle development.

8. The use according to claim 7, characterized in that: The reagent for promoting the expression of chi-miR-24-3p is the sequence shown in SEQ ID NO.

22.

9. Use of the agent for inhibiting the expression of ADAMTS3 as claimed in claim 1 in the preparation of a hair follicle development promoter.

10. The use according to claim 9, characterized in that: The agent for inhibiting the expression of ADAMTS3 is a sequence shown in SEQ ID NO. 13-14, a sequence shown in SEQ ID NO. 15-16 or a sequence shown in SEQ ID NO. 17-18.

Images