CDK5RAP3 gene SNP molecular marker related to feed conversion rate of yellow feather broilers and application of CDK5RAP3 gene SNP molecular marker

Abstract

The invention discloses a CDK5RAP3 gene SNP molecular marker related to the feed conversion rate of yellow feather broilers and application of the CDK5RAP3 gene SNP molecular marker, and belongs to the field of animal genetic breeding and molecular biology. The polymorphism of the SNP molecular marker is A / G, the SNP molecular marker is located at the 369307 site of a chicken chromosome 27, and the RS number of the SNP molecular marker is rs7383324012. The invention provides the SNP molecular marker related to the feed conversion rate of the yellow-feathered broiler chicken and located in the CDK5RAP3 gene of the 27th chromosome of the chicken, and the marker shows that the feed conversion rates of the yellow-feathered broiler chickens with different genotypes are obviously different, so that the SNP molecular marker can be used for efficiently screening individual or parent yellow-feathered broiler chickens with excellent characters of low feed conversion rate; the yellow-feather broiler chicken with low feed conversion rate can be quickly bred by applying the yellow-feather broiler chicken feed additive to breeding of the yellow-feather broiler chicken, the feed consumption in the production process can be effectively reduced, and the economic benefits and competitiveness of enterprises are improved.

Description

Technical Field

[0001] The present invention relates to the technical field of animal genetic breeding and molecular biology, and in particular to a CDK5RAP3 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broiler chickens and an application thereof. Background Art

[0002] As an important economic trait, feed efficiency has always been the focus of attention of domestic and foreign chicken farming companies. Chicken has the advantages of low fat, high protein, low price and no religious restrictions. It is the most consumed meat product in the world and its demand is also increasing. For the broiler industry, feed accounts for a large proportion of the breeding cost, and the feed conversion rate of commercial chickens largely determines the economic benefits of the industry.

[0003] Reducing feed conversion rate is very important for improving economic benefits. Therefore, discovering and utilizing new genes related to feed conversion rate of yellow-feathered broiler chickens is of great significance for the genetic breeding of chickens. Based on high-density SNP data covering the entire genome and trait phenotypic records of a large population, the candidate genes that control traits can be accurately located through genome-wide association analysis (GWAS). Although this technology still has some defects, it has been widely used in the mining of candidate genes for complex human diseases and the positioning of key genes for important economic traits of livestock and poultry. The use of GWAS to screen out SNP molecular markers related to feed conversion rate of yellow-feathered broiler chickens provides a feasible way for the genetic breeding of chicken growth traits, which is of great significance to the poultry industry.

[0004] Through high-throughput sequencing technology, the genetic regulation mechanism of feed conversion rate traits is revealed, potential molecular markers of specific phenotypes are selected, and the accuracy of trait genetic prediction is improved. Specifically, by performing association analysis on feed conversion rate phenotype and genomic data, significant SNP sites that affect the feed conversion rate of yellow-feathered broilers are found, and effective SNP markers are identified, providing a powerful tool for early selection of traits and accelerating the genetic breeding process. However, there have been no reports on genetic molecular markers related to poultry feed conversion rate. Summary of the invention

[0005] In order to solve the above technical problems, the purpose of the present invention is to provide a CDK5RAP3 gene SNP molecular marker related to the feed conversion rate of yellow-feathered broilers and its application, so as to solve the problem of lack of development and utilization of genetic molecular markers related to the feed conversion rate of yellow-feathered broilers.

[0006] The technical solution of the present invention to solve the above technical problems is as follows:

[0007] A CDK5RAP3 gene SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers, the SNP molecular marker polymorphism is A / G, is located at position 369307 of chicken chromosome 27, and the RS number is rs738324012.

[0008] Furthermore, the mutation site and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO. 1, wherein R is an A>G mutation site, and when R is G, it is a yellow-feathered broiler with low feed conversion rate;

[0009] SEQ ID NO.1: 5'-GACGTCAGCCTCCTCCTCCATCTCCACCAGGCGC TGTGCCAGGAACAGCTCCAGCTGTGGGGAAAAGGACGCCGTGAGGGGAAGGGGCGGCCAAAACCCACCCGACATGGGGAGGGTGCCCGAGCCGTCCCAGTGCTGCTCACCTCCATGAGCTCATCGATGAATTGGTTCCGTGTCGCAGCATTCTCCAGCAGTGTCAGRGCATCGGAGCCACGGGCA ACTGCCTCGGGTTCTGGGGGATGAGTGGGGTCAGCAGGGAAGGGAGCTCTGCGGTCTCTGCACGCTGGAACCCGACTGTCCCCTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATCTGTGCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGTGAT-3'.

[0010] A primer for detecting the above SNP molecular marker, wherein the forward primer sequence of the primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.3;

[0011] Forward primer: 5′-CTCCAGCTGTGGGGAAAAGGAC-3′ (SEQ ID NO. 2);

[0012] Reverse primer: 5'-CAGGACAATGGCATTGACTGGG-3' (SEQ ID NO. 3).

[0013] A kit for detecting the above-mentioned SNP molecular marker, the kit comprising the above-mentioned primers.

[0014] The use of the above-mentioned SNP molecular markers or primers or kits in screening individuals or parents of yellow-feathered broiler chickens with excellent traits of low feed conversion rate.

[0015] A method for screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion rate, using PCR technology to amplify and sequence SNP molecular markers of the individuals to be tested, and screening to obtain homozygous individuals with the SNP molecular marker genotype of GG.

[0016] Furthermore, the above primers or kit are used for PCR amplification.

[0017] Furthermore, the PCR amplification system was: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

[0018] Furthermore, the PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0019] The present invention has the following beneficial effects:

[0020] The present invention provides a SNP molecular marker associated with the feed conversion rate of yellow-feathered broilers and located in the CDK5RAP3 gene on chicken chromosome 27. The marker indicates that there are significant differences in the feed conversion rates between yellow-feathered broilers of different genotypes, and can be used to efficiently screen individuals or parent yellow-feathered broilers with excellent traits of low feed conversion rates. The marker can be applied to the breeding of yellow-feathered broilers to quickly breed yellow-feathered broilers with low feed conversion rates, effectively reduce feed consumption in the production process, and improve the economic benefits and competitiveness of the enterprise. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Manhattan plot of the SNP molecular markers in Example 1;

[0022] Figure 2 This is the SNP molecular marker genotype sequencing diagram in Example 2. DETAILED DESCRIPTION

[0023] The principles and features of the present invention are described below in conjunction with the accompanying drawings. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. If specific conditions are not specified in the embodiments, they are carried out according to normal conditions or conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0024] Example 1: Screening of SNP molecular markers

[0025] 1872 healthy yellow-feathered broiler chickens were selected, and all the experimental chickens were mixed and fed until 56 days of age. From 56 days of age, they were transferred to individual cages for feeding, and the experiment ended at 98 days of age. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. The calculation formula is as follows:

[0026]

[0027] Where, FCR is feed conversion rate; W f is feed consumption; W a To increase the weight of living organisms.

[0028] The lower the FCR value, the lower the feed conversion rate, which means that less feed is consumed for the same production capacity during the production process, that is, feed is saved. DNA was extracted from each sample, and the DNA sample was quality tested. The DNA concentration was tested by QubitFluorometer, and the DNA fragment size and degradation degree were tested using agarose gel electrophoresis. Simplified genome sequencing was performed using high-throughput production measurement technology. The sequencing data was quality controlled and filtered to remove low-quality sequencing reads and possible false-positive BNP. Feed conversion rate was used as a phenotype and was associated with SNP data. The EMMAX program (http: / / genetics.cs.ucla.edu / emmax / index.html.) was used for GWAS analysis, and the analysis model was as follows:

[0029] y=Xb+Zu+m+e;

[0030] In the model, y represents the true value of the trait record, X represents the fixed effect association matrix, b represents the fixed effect vector, the fixed effect includes batch effect and three principal component effects, Z represents the additive genetic effect association matrix, u represents the individual additive genetic effect vector, e represents the residual, u~N(0, Gσ 2 α ), e~N(0,Iσ 2 ε α), G represents the genome kinship matrix, I represents the identity matrix, σ 2 α , σ 2 ε α represents the additive genetic effect variance and residual variance, and m represents the SNP marker effect.

[0031] According to the results of association analysis, a SNP molecular marker associated with the feed conversion rate trait of yellow-feathered broiler chickens was found. The molecular marker is located on chromosome 27 of yellow-feathered broiler chickens. Figure 1 as shown in the Manhattan diagram.

[0032] The mutation site and upstream and downstream sequences of the SNP molecular marker are as follows:

[0033] SEQ ID NO.1: 5'-GACGTCAGCCTCCTCCTCCATCTCCACCAGGCGC TGTGCCAGGAACAGCTCCAGCTGTGGGGAAAAGGACGCCGTGAGGGGAAGGGGCGGCCAAAACCCACCCGACATGGGGAGGGTGCCCGAGCCGTCCCAGTGCTGCTCACCTCCATGAGCTCATCGATGAATTGGTTCCGTGTCGCAGCATTCTCCAGCAGTGTCAGRGCATCGGAGCCACGGGCA ACTGCCTCGGGTTCTGGGGGATGAGTGGGGTCAGCAGGGAAGGGAGCTCTGCGGTCTCTGCACGCTGGAACCCGACTGTCCCCTTGTGACCGTGCTCACCCTCAGAGCCATCCTCCAACACTGTAATCTGTGCCCGTTGCCTTCACCATCACCCCAGTCAATGCCATTGTCCTGCAGTGAT-3';

[0034] R is the A>G mutation site. When R is A, the chicken has a lower feed conversion rate; 5'- and -3' represent the 5' and 3' ends of the nucleotide sequence, respectively.

[0035] Example 2: Validation of SNP Molecular Markers

[0036] The SNP molecular markers obtained in Example 1 were verified in another yellow-feathered broiler group, with a total of 1773 healthy yellow-feathered broiler individuals. All test chickens were mixed and fed until 56 days of age, and then transferred to individual cages for feeding from 56 days of age. The test ended at 98 days of age. The daily feed intake, initial test weight and final weight of each chicken were recorded, and the feed conversion rate was calculated. 150 individuals with low feed conversion rate (FCR less than 3.0) and high feed conversion rate (FCR greater than 3.0) were selected, and blood was taken for DNA extraction. The average FCR of the 150 individuals with low feed conversion rate was 2.7±0.23, and the average FCR of the individuals with high feed conversion rate was 3.4±0.35.

[0037] The extracted DNA was used as a template, and forward primers and reverse primers were added to carry out PCR reaction.

[0038] Forward primer: 5′-CTCCAGCTGTGGGGAAAAGGAC-3′ (SEQ ID NO. 2);

[0039] Reverse primer: 5'-CAGGACAATGGCATTGACTGGG-3' (SEQ ID NO. 3).

[0040] The PCR amplification reaction system was: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

[0041] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

[0042] Analyze the sequencing results and record the genotype corresponding to each individual according to the sequencing peak graph of each sample, such as Figure 2 As shown in the figure, there is only one peak at the corresponding site in the genotype AA sequencing map, and the expression alleles are the same, both are A; there are two peaks at the corresponding site in the genotype AG sequencing map, indicating that the alleles are different, one is A and the other is G; there is only one peak at the corresponding site in the genotype GG sequencing map, indicating that the alleles are the same, both are G. The genotype and allele of the SNP molecular marker and the feed conversion rate were analyzed by one-way analysis of variance using SPSS26.0, and the results are shown in Tables 1 and 2. In this SNP molecular marker, the genotype frequency and allele frequency were extremely significantly different between the low feed conversion rate group and the high feed conversion rate group (P < 0.01). In the low feed conversion rate group, the frequency of the allele G was higher than the frequency of the allele A, and the frequency of the genotype GG was significantly higher than the frequency of the genotypes AA and AG, indicating that the GG genotype individuals at the 201st site have a better feed conversion rate phenotype than the AG and AA genotype individuals. It is further demonstrated that the polymorphism of the screened molecular markers is significantly correlated with the feed conversion rate trait, and is a SNP site associated with the feed conversion rate trait, which can be used for the breeding of yellow-feathered broilers with low feed conversion rate traits.

[0043] Table 1 Statistical table of the distribution differences of SNP molecular marker genotypes between low feed conversion rate and high feed conversion rate

[0044] chromosome Location genotype High FCR (%) Low FCR (%) <![CDATA[Chi-square value X 2 (P)]]> chr27 3693075 AA 53(35.3％) 28(18.7％) 9.541 AG 47(31.3％) 38(25.3％) <![CDATA[7.1×10 -4 ]]> GG 50(33.4％) 84(56％) <![CDATA[8.5×10 -4 ]]>

[0045] Table 2 Statistical table of the distribution difference of SNP molecular marker alleles between low feed conversion rate and high feed conversion rate

[0046] chromosome Location genotype High FCR (%) Low FCR (%) <![CDATA[Chi-square value X 2 (P)]]> chr27 3693075 A 153(51％) 94(31.3％) 10.343 G 147(49％) 206(68.7％) <![CDATA[3.2×10 -5 ]]>

[0047] Example 3: Method for assisted molecular breeding of yellow-feathered broiler chickens with low feed conversion rate using SNP molecular marker alleles

[0048] This embodiment provides a method for assisted molecular breeding of yellow-feathered broiler chickens with low feed conversion rate traits using the above-mentioned kit for detecting SNP molecular markers, comprising the following steps:

[0049] (1) Blood was collected from the wing vein of the individual to be tested, anticoagulated with EDTA, and stored at -20°C for DNA extraction.

[0050] (2) Amplification was performed using the kit with the DNA extracted in step (1) as a template. The PCR amplification system was: 10 μL of 2×Taq Master Mix, 1 μL of each forward and reverse primer, 1 μL of DNA template, and ddH2O to 20 μL. The PCR reaction conditions were: 94°C pre-denaturation for 2 min; 94°C denaturation for 15 s, 56°C annealing for 10 s, 72°C extension for 15 s, 35 cycles; 72°C extension for 5 min.

[0051] (3) Sequence the PCR product obtained in step (2) using the Sanger sequencing method.

[0052] (4) Based on the genotyping results, individuals homozygous for the GG genotype of the SNP molecular marker chr27-3693075 were selected for breeding to reduce feed conversion rate and thus reduce feed costs; selecting individuals with this marker to join the core breeding population can achieve rapid homozygosity of the alleles related to this trait, which can provide technical support for accelerating the progress of genetic selection.

[0053] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A CDK5RAP3 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens, characterized in that: The SNP molecular marker polymorphism is A / G, located at position 369307 of chicken chromosome 27, and the RS number is rs738324012.

2. The CDK5RAP3 gene SNP molecular marker associated with feed conversion rate of yellow-feathered broiler chickens according to claim 1, characterized in that: The mutation site and upstream and downstream sequences of the SNP molecular marker are shown in SEQ ID NO.1, wherein R is an A>G mutation site, and when R is G, it is a yellow-feathered broiler with low feed conversion rate.

3. A primer for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The forward primer sequence of the primer is shown in SEQ ID NO.2, and the reverse primer sequence is shown in SEQ ID NO.

3.

4. A kit for detecting the SNP molecular marker according to claim 1 or 2, characterized in that: The kit comprises the primers according to claim 3.

5. Use of the SNP molecular marker according to claim 1 or 2, the primer according to claim 3, or the kit according to claim 4 in screening individuals or parents of yellow-feathered broilers with excellent trait of low feed conversion rate.

6. A method for screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion rate, characterized in that: The PCR technique was used to amplify and sequence the SNP molecular markers of the tested individuals, and homozygous individuals with the SNP molecular marker genotype of GG were screened.

7. The method for screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion rate according to claim 6, characterized in that: The PCR amplification is performed using the primers described in claim 3 or the kit described in claim 4.

8. The method for screening individuals or parents of yellow-feathered broilers with excellent traits of low feed conversion rate according to claim 6, characterized in that: The PCR amplification system was as follows: 2×Taq Master Mix 10 μL, forward and reverse primers 1 μL each, DNA template 1 μL, and ddH2O to 20 μL.

9. The method for screening individuals or parents of yellow-feathered broiler chickens with excellent traits of low feed conversion rate according to claim 6, characterized in that: The PCR reaction conditions were as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 15 s, annealing at 56°C for 10 s, extension at 72°C for 15 s, 35 cycles; and extension at 72°C for 5 min.

Images