Application of Ackerman's standard strain ATCC BAA-835 in reduction of retina neovascularization area and alleviation of retinal inflammation

Abstract

The invention discloses application of Ackerman's standard strain ATCC BAA-835 in reduction of retina neovascularization area and alleviation of retinal inflammation, and belongs to the technical field of microorganisms. According to the invention, an Ackerman's standard strain ATCC BAA-835 is applied, and it is found that the Ackerman's standard strain ATCC BAA-835 has new application in reduction of the area of retina and choroidal neovascularization and alleviation of retinal inflammation; a new thought is provided for clinically relieving the retinopathy, pathological neovascularization high myopia, polypoid choroidal retinopathy, retinal vasculitis, diabetic retinopathy and hypopsia of senile macular degeneration patients and premature infants, and wide application prospects and popularization values are achieved.

Description

Technical Field

[0001] The invention relates to application of Akkermansia standard strain ATCC BAA-835 in reducing retinal neovascularization area and alleviating retinal inflammation, and belongs to the technical field of microorganisms. Background Art

[0002] Choroidal neovascularization (CNV) is the main type of subretinal neovascularization (SRNV), which mainly causes neovascular age-related macular degeneration (nAMD). As a common eye disease that affects vision, nAMD mainly affects the elderly. nAMD is an important subtype of AMD, which can cause severe loss of central vision in patients. With the aging of the global population, the number of people suffering from AMD is increasing, and it is expected that the number of people suffering from AMD will increase to 288 million by 2040.

[0003] Current treatments for AMD include anti-VEGF (vascular endothelial growth factor) drugs, which can significantly improve AMD and have become the current first-line treatment. However, patients need to undergo regular intravitreal injections, which not only increases the economic and mental burden on the patient's family, but also may bring risks such as intraocular hemorrhage and infection. In order to reduce these burdens, new treatment options are being actively sought at home and abroad, and gene therapy has become a major research direction. At present, the KH631 gene therapy project has entered the clinical trial stage, providing a new treatment option for AMD patients, but gene therapy faces immunogenicity and safety issues. For example, when adeno-associated virus (AAV) is used as a gene therapy vector, it may trigger an immune response in patients. For example, Adverum Biotechnologies Inc.'s AAV gene therapy drug ADVM-022 was forced to suspend the trial due to serious adverse reactions (such as hypotony, inflammation, and blindness) in clinical trials. In addition, the immunogenicity of AAV vectors may also lead to treatment failure or uncontrolled inflammation, so the efficacy and safety of gene therapy still need to be further verified.

[0004] Akkermansia muciniphila is a type of Gram-negative anaerobic bacteria that colonizes the human intestine. They use intestinal mucin as their sole carbon and nitrogen source and have a variety of potential positive effects on host health. It has been reported to play a role in intestinal barrier protection and repair, anti-inflammation, metabolic regulation, neuroprotection, tumor treatment, immune regulation, and regulation of drug response, but there are relatively few studies on its effect on eye diseases. Summary of the invention

[0005] In order to solve the technical difficulties of using probiotics to alleviate retinal inflammation, the present invention uses a standard strain of Akkermansia ATCC BAA-835 and finds that it has a new use in reducing the area of ​​retinal and choroidal neovascularization and alleviating retinal inflammation, providing a new idea for clinically slowing down the decline of retinal and choroidal neovascularization diseases, and has broad application prospects and promotion value.

[0006] In one embodiment of the present invention, the preparation of the bacterial suspension of the Akkermansia standard strain ATCC BAA-835 requires that the number of viable bacteria is ≥ 1×10 9 CFU / mL.

[0007] In one embodiment of the present invention, the preparation of the intragastric bacterial solution (A. muciniphila) of the Akkermansia standard strain ATCC BAA-835 requires a bacterial count of ≥1×10 9 CFU / mL.

[0008] In one embodiment of the present invention, the mouse modeling period is 14 days, and the drug is administered daily, with the dosage being 1% (w / v) of the mouse body weight of A. muciniphila bacterial solution containing 30% (v / v) glycerol.

[0009] In one embodiment of the present experiment, laser photocoagulation modeling of both eyes of mice was performed 14 days after intragastric administration.

[0010] In one embodiment of the present invention, the qPCR validation uses the left eyeball of mice sacrificed 3 days after model establishment.

[0011] In one embodiment of the present invention, the retinal and choroidal flat mount staining uses the bilateral eyeballs of mice sacrificed 7 days after modeling.

[0012] The invention provides use of Akkermansia standard strain (Akkermansia muciniphila) ATCC BAA-835 or a bacterial agent containing the Akkermansia standard strain ATCC BAA-835 in preparing a drug capable of improving and / or treating retinal and choroidal neovascularization diseases.

[0013] In one embodiment of the present invention, the retinal and choroidal neovascular diseases include but are not limited to age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss.

[0014] In one embodiment of the present invention, the drug has at least any one of the following applications a to d:

[0015] a. Reduce the area of ​​retinal and choroidal neovascularization;

[0016] b. Reduce the number of regenerated new blood vessels;

[0017] c. Reduce retinal inflammation;

[0018] d. Improve and / or treat retinal and choroidal neovascularization diseases.

[0019] In one embodiment of the present invention, the amount of Akkermansia standard strain ATCC BAA-835 added to the drug is not less than 1×10 9 CFU / mL.

[0020] In one embodiment of the present invention, the medicine contains the Akkermansia standard strain ATCC BAA-835, a drug carrier and / or a pharmaceutical excipient.

[0021] In one embodiment of the present invention, the drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes.

[0022] In one embodiment of the present invention, the pharmaceutical excipients include one or more of fillers, binders, wetting agents, disintegrants, lubricants, and flavoring agents.

[0023] In one embodiment of the present invention, the dosage form of the drug is granules, capsules, tablets, pills, oral liquids, powders, suspensions, capsules, tube feeding preparations or enema.

[0024] In one embodiment of the present invention, the drug includes a drug for human use or a drug for animal use.

[0025] In one embodiment of the present invention, the bacterial agent uses Akkermansia standard strain ATCC BAA-835 as the main microorganism.

[0026] In one embodiment of the present invention, the bacterial agent is a liquid bacterial agent or a solid bacterial agent; preferably, the bacterial agent contains living cells of Akkermansia standard strain ATCC BAA-835, dry cells obtained by freeze-drying, or immobilized cells.

[0027] The present invention also provides an application of Akkermansia standard strain (Akkermansia muciniphila) ATCC BAA-835 or a bacterial agent containing the Akkermansia standard strain ATCC BAA-835 in preparing a product capable of improving and / or treating retinal and choroidal neovascularization diseases.

[0028] In one embodiment of the present invention, the product includes food, health food, detection reagent, detection kit, feed, feed additive, food additive.

[0029] In one embodiment of the present invention, the retinal and choroidal neovascular diseases include but are not limited to age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss.

[0030] In one embodiment of the present invention, the dosage form of the health food includes powder, suspension, oral solution, tablet, capsule and granule.

[0031] Beneficial Effects

[0032] The present invention has discovered a new use of Akkermansia standard strain ATCC BAA-835 for alleviating the symptoms of retinal and choroidal neovascularization diseases, which is specifically embodied in:

[0033] (1) By calculating the area of ​​neovascularization of the retina and choroid of mice, it was found that oral administration of inactivated Akkermansia ATCC BAA-835 solution could significantly reduce the area of ​​neovascularization of the retina and choroid.

[0034] (2) Through quantitative experiments analyzing the response of mouse retina to C3 inflammatory factor, it was found that oral administration of inactivated Akkermansia ATCC BAA-835 bacterial solution could significantly downregulate the expression of C3 inflammatory factor, thereby alleviating retinal inflammation.

[0035] (3) Intravenous administration of A. muciniphila liquid can significantly reduce the expression of Fgf2, a growth factor that promotes angiogenesis in the mouse retina (expression level: mean, 0.515691), thereby helping to reduce the number and area of ​​new blood vessels; Spp1 is one of the most expressed genes in retinal microglia during CNV formation. Intravenous administration of A. muciniphila liquid can significantly reduce the expression of Spp1 factor in the mouse retina (expression level: mean, 0.587334), thereby helping to reduce retinal inflammation;

[0036] (4) Akkermansia ATCC BAA-835 bacterial liquid has the potential to be used in the preparation of drugs that can improve and / or treat retinal and choroidal neovascular diseases, including but not limited to age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 : Retinal neovascularization in the experimental group (A. muciniphila).

[0038] Figure 2:Control group (glycerol) retinal neovascularization.

[0039] Figure 3 : Retinal neovascularization in the reverse control group (E. coli).

[0040] Figure 4 : Experimental group (A. muciniphila) choroidal neovascularization.

[0041] Figure 5 : Control group (glycerol) choroidal neovascularization.

[0042] Figure 6 : Choroidal neovascularization in the reverse control group (E. coli).

[0043] Figure 7 :Comparative statistical chart of retinal neovascularization area.

[0044] Figure 8 :Comparative statistical chart of choroidal neovascularization area.

[0045] Fig. 9 : Oil immersion micrograph of Akkermansia ATCC BAA-835 after 12 hours of culture.

[0046] Fig.10 : qPCR results of C3 expression level on day 3 after CNV mouse modeling (n=5).

[0047] Fig.11 : qPCR results of Fgf2 expression level on day 3 after CNV mouse modeling (n=5).

[0048] Fig.12 : qPCR results of Spp1 expression level on day 3 after CNV mouse modeling (n=5).

[0049] Fig.13 : Flow chart of experimental animal handling time. DETAILED DESCRIPTION

[0050] In order to explain in detail the possible application scenarios, technical principles, specific schemes that can be implemented, and the purposes and effects that can be achieved, the following is a detailed description of the specific embodiments listed in conjunction with the accompanying drawings. The embodiments described herein are only used to more clearly illustrate the technical solutions of the present application, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present application.

[0051] Reference to "embodiment" herein means that the specific features, structures or characteristics described in conjunction with the embodiment may be included in at least one embodiment of the present application. The term "embodiment" appearing in various places in the specification does not necessarily refer to the same embodiment, nor does it particularly limit its independence or association with other embodiments. In principle, in the present application, as long as there is no technical contradiction or conflict, the various technical features mentioned in the embodiments can be combined in any way to form a corresponding implementable technical solution.

[0052] Unless otherwise defined, the technical terms used in this document have the same meanings as those generally understood by those skilled in the art to which this application belongs; the use of relevant terms in this document is only for describing specific embodiments and is not intended to limit this application.

[0053] Without further limitations, in this application, the words "include", "comprises", "has" or other similar expressions used in the sentences are intended to cover non-exclusive inclusion. These expressions do not exclude the presence of additional elements in the process, method or product including the elements, so that the process, method or product including a series of elements may include not only those limited elements, but also other elements not explicitly listed, or also include elements inherent to such process, method or product.

[0054] The Akkermansia standard strain ATCC BAA-835 of the present invention can be obtained from ATCC or other commercial companies, and is deposited in Henan Industrial Microbiological Strain Engineering Technology Research Center with the deposit number: BNCC341917, which is a published strain. The Akkermansia standard strain used in this experiment was donated by other laboratories.

[0055] About the model:

[0056] The present invention adopts a binocular laser photocoagulation model, and the diseases involved in the model are retinal and choroidal neovascular diseases, which are one or more of age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss.

[0057] The experimental materials involved in the following embodiments are as follows:

[0058] Type III mucin (purchased from McLean), brain heart infusion liquid culture medium (purchased from Beijing Solaibao Technology Co., Ltd.), glycerol, tribromoethanol (purchased from Beijing Yoshida Biotechnology), compound tropicamide eye drops, isoflurane (purchased from Lunan Beite Pharmaceutical Co., Ltd.), RZ solution (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), paraformaldehyde, physiological saline, FITC-Isolectin B4 (purchased from Enzo; USA), anti-fluorescence quenching sealing solution containing DAPI (purchased from Enzo; USA), chloroform, PrimeScript TM RT reagent Kit with gDNA Eraser (Takara) (purchased from Takar; Japan), QuantiNova SYBR Green PCR Kit (QIAGEN) kit.

[0059] The instruments and equipment involved in calculating the retinal and choroidal neovascularization areas in the following embodiments are as follows:

[0060] 532 nm laser machine (Quantel medical, VITRA, France) and slit lamp microscope (Haag-Streit, BQ900, Germany).

[0061] The culture medium involved in the following examples is as follows:

[0062] Brain heart infusion liquid culture medium (g / L): 3.85g / 0.1L;

[0063] BHI liquid culture medium (g / L): 1000 mL of deionized water, 1 g of type III mucin, and 38.5 g of brain heart infusion liquid culture medium were stirred evenly with a magnetic stirrer, then placed in a blue-capped bottle and sterilized with high-pressure steam at 121°C for 15 min. The culture medium was cooled and set aside.

[0064] The preparation method of the Akkermansia A. muciniphila bacterial suspension involved in the following examples is as follows:

[0065] (1) The Akkermansia standard strain ATCC BAA-835 was taken from a glycerol storage tube and inoculated into a BHI liquid culture medium, and cultured in an anaerobic workstation at 37° C. for 18 h to activate the strain; thus, an activated culture solution was prepared.

[0066] (2) Take the activated culture solution of the strain and inoculate it into a new BHI liquid medium at an inoculum amount of 2% (v / v), and culture it in an anaerobic workstation at 37° C. for 18 h. Repeat this step to subculture the strain three times to prepare a seed solution.

[0067] (3) The seed solution of Akkermansia standard strain ATCC BAA-835 was inoculated at a 60% (v / v) inoculum into BHI liquid medium containing 0.5% (w / v) type III mucin and cultured at 37°C for 48 hours until the OD of the culture solution reached 0.1. 600 The value reached 1.0, and the concentration was estimated using a Nano Drop instrument. The obtained bacterial solution was centrifuged at 37°C and 5000 rpm for 10 min to remove the culture medium. After washing with 0.9% (w / v) saline, the bacterial precipitate was obtained by centrifugation, and then dissolved with 0.9% (w / v) saline to prepare a bacterial suspension. The number of viable bacteria was required to be ≥1×10 9 CFU / mL.

[0068] The preparation method of the Akkermansia muciniphila intragastric bacterial solution involved in the following examples is as follows:

[0069] Akkermansia was inoculated into BHI medium and cultured at 37°C for 48 hours. The culture solution was centrifuged at 4°C and 5000 rpm for 10 min and the bacterial slurry was resuspended in 30% (v / v) glycerol at a concentration of 1×10 9 CFU / mL, stored in a -80℃ refrigerator, and obtained the A. muciniphila intragastric bacterial solution.

[0070] The preparation method of the Escherichia coli suspension involved in the following examples is as follows:

[0071] (1) Preparation of culture medium

[0072] Take 8 g of LB medium and 400 ml of ddH20, sterilize at 121°C for 15 minutes, then take out the medium and let it cool to room temperature.

[0073] (2) Preparation of bacterial solution

[0074] E. coli was inoculated into the culture medium obtained in step (1), and cultured at 37°C and 200 rpm for 8-12 h to obtain a fermentation broth. The fermentation broth was centrifuged at 5000 rpm for 10 min, and the bacterial sludge was resuspended in 30% (v / v) glycerol at a concentration of 1×10 9 CFU / mL, stored in a -80℃ refrigerator to obtain the E. coli intragastric bacterial solution.

[0075] The intragastric gavage method of mice involved in the following embodiments:

[0076] Fix the rat with your left hand, hold the gavage device with your right hand, fix the rat's forelimbs with your left thumb and middle finger, and push backward to make the rat's forelimbs raise. Bend the first knuckle of the index finger and use the joint to press against the animal's atlas to raise the rat's head, so that the mouth and esophagus are in a straight line. Slowly insert the gavage needle into the esophagus along the posterior wall of the pharynx until its front end reaches the level of the diaphragm, and inject the drug.

[0077] The following examples involve methods for killing mice and removing eyeballs:

[0078] The mouse limbs were fixed with a pin. At the same time, a cotton ball was stuffed into a 15 ml centrifuge tube, and 500 μl of isoflurane was injected into the cotton ball to anesthetize the mouse after inhalation. The mouse was then killed by perfusion of normal saline, and the bilateral eyeballs were taken. The eyeballs prepared for the spread were placed in a 4% (w / v) paraformaldehyde solution for subsequent retinal and choroidal spread staining; the eyeballs prepared for molecular verification were placed in normal saline, and the retina was immediately taken and placed in RZ solution (purchased from: Tiangen Biochemical Technology (Beijing) Co., Ltd.) for subsequent qPCR experiments. In the quantitative tests in the following examples, 3 biological replicates and 5 technical replicates were set for each group, and the results were averaged.

[0079] Mouse retinal RNA extraction method:

[0080] (1) Leave at room temperature for 5 minutes.

[0081] (2) Add 200 μl of chloroform to 1 ml of RZ in proportion, shake vigorously for 15 seconds, and leave at room temperature for 2 minutes.

[0082] (3) Place the centrifuge tube in a 4°C refrigerated centrifuge and centrifuge at 12,000 rpm for 10 minutes. Remove the centrifuge tube and carefully aspirate the upper layer (about 400 μl) into a new EP tube (RNase-free) using a pipette.

[0083] (4) Add an equal volume of anhydrous ethanol to the centrifuge tube as the aspirated supernatant and mix well.

[0084] (5) Add the obtained solution to a centrifugal column and centrifuge (12000 rpm, 30 s), pass through the column, and discard the waste liquid.

[0085] (6) Add 500 μl Buffer RD, centrifuge (12000 rpm, 30 s), pass through the column, and discard the waste liquid.

[0086] (7) Add 500 μl Buffer RW, centrifuge (12000 rpm, 30 s), pass through the column, discard the waste liquid, and repeat twice.

[0087] (8) Place the adsorption column on a clean paper towel for drying in a laminar flow hood for 10 minutes, then put it into a new RNase-free centrifuge tube. Add 35 μl of RNase-Free Water to the center of the adsorption column, let it stand for 1 minute and then centrifuge (12,000 rpm, 2 minutes) to collect the resulting solution.

[0088] RNA reverse transcription

[0089] For the extracted total RNA, use the PrimeScript TM RT reagent Kit with gDNA Eraser (Takara) kit to reverse transcribe it into cDNA. Perform the operation steps in a laminar flow hood, and operate the reagent addition process on an ice box throughout. The cDNA obtained after reverse transcription is stored in a -20 °C refrigerator.

[0090] The qPCR methods involved are shown in Table 1 and Table 2.

[0091] Table 1: <TB Green qPCR method>

[0092]

[0093] Table 2:

[0094] <Probe qPCR analysis method>

[0095]

[0096] qPCR gene expression quantification

[0097] For qPCR quantification, use the QuantiNova SYBR Green PCR Kit (QIAGEN) kit. First, prepare the reaction mixture on an ice box as shown in Table 3. Then perform real-time fluorescence quantification according to the reaction conditions in Table 4.

[0098] Table 3: Preparation of qPCR reaction mixture

[0099]

[0100] Table 4: qPCR reaction conditions

[0101]

[0102] The qPCR primers involved in the following examples:

[0103] The qPCR primers are purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0104] C3-F ACTGCTGGCCTCTGGAGTAG;

[0105] C3-R AGTAGACCTTGACCGACCCG;

[0106] ACTB-F CATTGCTGACAGGATGCAGAAGG;

[0107] ACTB-R TGCTGGAAGGTGGACAGTGAGG.

[0108] The mouse retinal flat-mount method involved in the following embodiments:

[0109] Use forceps to remove the eyeballs from the killed mice, and immerse the eyeballs in a 1.5 ml centrifuge tube containing 4% (w / v) paraformaldehyde for 10 hours to fix the eyeballs. Place the fixed eyeballs in a dish with 0.9% (w / v) saline for washing in a shaker for 5 minutes. Use ophthalmic scissors to cut off the anterior segment of the eye under a microscope, and then use ophthalmic forceps to separate the lens and vitreous body, and then separate the complete retina. Use 5 μg ml -1 The retina was incubated and stained with FITC-Isolectin B4 for 12 hours (protected from light, 4°C). The retina was removed and placed in a dish containing a small amount (200ul per retina or choroid) of PBS to gently wash off the Isolectin B4 solution (purchased from: Enzo; USA), and cut into a four-leaf clover shape, spread on a slide, and sealed with a sealing solution (anti-fluorescence quenching sealing solution containing DAPI, purchased from: Enzo; USA) and photographed.

[0110] Example 1: Effect of Akkermansia Standard Strain ATCC BAA-835 on the Area of ​​Neovascularization in the Retina and Choroid of Mice

[0111] The experimental animals were treated as follows:

[0112] The animals used in this experiment were 6-8 week old C57BL / 6 male mice purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. The animal room of Wuxi Medical College of Jiangnan University provided the breeding environment. During the breeding process, the light and dark were alternated for 12 hours each day, the ambient temperature was 20-26℃, and there was no restriction on food and water. All animal studies complied with the regulations of the American Association for Research in Vision Ophthalmology (ARVO) and the Animal Experiment Ethics Committee of Jiangnan University.

[0113] 1. Animal experiment grouping and gavage treatment:

[0114] The mice were randomly divided into three groups (10 mice in each group), as shown in Table 5.

[0115] Table 5: Animal experiment groups

[0116]

[0117] The specific steps are as follows:

[0118] Blank control feeding group (control group): On the 0th to 14th day, mice were gavaged with 30% (v / v) glycerol, with a gavage dose of 200ul; two weeks after gavage, binocular laser photocoagulation modeling (CNV modeling) was performed, and fasting was performed on the same day. From the first day after modeling, 30% (v / v) glycerol was continued to be gavaged;

[0119] AKK bacterial liquid feeding group (AKK group): On days 0 to 14, based on the average weight of mice of 20 g, mice were intragastrically administered with 5×10 9 CFU / mL A.muciniphila bacterial solution, the gavage dose was 200ul; after gavage for 2 weeks, binocular laser photocoagulation modeling (CNV modeling) was performed, and fasting was performed on the same day. From the first day after modeling, 5×10 CFU / mL A.muciniphila containing 30% (v / v) glycerol was continued for gavage. 9 CFU / mL A. muciniphila bacterial solution;

[0120] E. coli liquid feeding group (E. coli group): On days 0 to 14, based on the average weight of mice of 20 g, mice were intragastrically administered with 5×10 9 CFU / mL E. coli liquid, the gavage dose was 200ul; after gavage for 2 weeks, the eyes were laser photocoagulated to create CNV model, and fasting was performed on the same day; from the first day after modeling, 5×10 9 CFU / mL E.coli liquid;

[0121] The above groups were killed in two batches on the 3rd and 7th days after modeling, and the retinas of the left and right eyes were taken for subsequent experiments.

[0122] The laser-induced CNV mouse modeling method is as follows:

[0123] 6-8 week old C57BL / 6 male mice were anesthetized by intraperitoneal injection of tribromoethanol (0.2 ml / 10 g body weight) 5-10 minutes before the experiment, and the pupils were dilated with compound tropicamide eye drops (dosage: 1 drop). Photocoagulation was performed using a 532 nm laser machine (Quantel medical, VITRA, France) and a slit lamp microscope (Haag-Streit, BQ900, Germany). Four photocoagulations were performed at 3, 6, 9, and 12 o'clock at 2 optic disc diameters around the optic disc, with the following parameters: energy 120 mW, exposure time 0.1 s, spot diameter 0 nm. The generation of bubbles during photocoagulation was considered a sign of success.

[0124] The modeling results showed that the choroid showed acute inflammation due to laser stimulation, new blood vessels grew, the Brush membrane was destroyed, and new blood vessels grew into the retina.

[0125] 2. Experimental results

[0126] The right eyes of 7 mice in each of the first batch of AKK group, control group, and E. coli group that were killed 3 days after modeling (a total of 21 samples) were used for transcriptome sequencing (samples that passed quality control were taken for subsequent actual sequencing and data analysis), and the left eyes were used to extract RNA for subsequent qPCR verification.

[0127] Three mice from each of the second batch of AKK group, control group, and E. coli group were killed 7 days after modeling (9 samples in each group) and used for retinal and choroidal spread staining.

[0128] like Figure 1-3 , 7-9, after mice were gavaged with A. muciniphila liquid, the experimental group (average: 1.52667μm 2 ) compared to the control group (glycerol, average: 2.106333μm 2 ) and the reverse control group (E.coli, average: 4.022167μm 2 ) The area of ​​retinal neovascularization in mice was significantly reduced.

[0129] like Figure 4-6 As shown, after mice were gavaged with A. muciniphila liquid, the experimental group (average: 2.1845 μm 2 ) compared to the control group (glycerol, average: 7.430μm 2 ) and the reverse control group (E.coli, average: 14.314μm 2 )The area of ​​choroidal neovascularization in mice was significantly reduced.

[0130] Example 2: Effects of Akkermansia Standard Strain ATCC BAA-835 on C3 Inflammatory Factors in Mouse Retinal Cells

[0131] The animal experiment was the same as in Example 1. After the experiment, the animals were killed on the 3rd day after modeling, and the retina of the left eye was taken for experiment.

[0132] The expression levels of retinal C3 inflammatory factors in each group of mice were detected. Fig.10 shown.

[0133] The results show:

[0134] Depend on Fig.10It can be seen that 3 days after laser-induced CNV model mice (blank group), the expression level of retinal C3 inflammatory factor was significantly reduced (P < 0.01), and the specific expression amount was: mean, 0.779608;

[0135] The expression level of retinal C3 inflammatory factor in the reverse control group (E. coli) was significantly increased (P<0.001), and the specific expression levels were: mean, 2.328429;

[0136] The results showed that intragastric administration of A. muciniphila bacterial solution could significantly reduce the expression of C3 inflammatory factor in the mouse retina (specific expression level: mean, 0.42346), thereby helping to alleviate retinal inflammation.

[0137] Example 3: Effect of Akkermansia Standard Strain ATCC BAA-835 on Fgf2 Factor in Mouse Retina

[0138] The animal experiment was the same as in Example 1. After the experiment, the animals were killed on the 3rd day after modeling, and the retina of the left eye was taken for experiment.

[0139] The expression level of Fgf2 (angiogenic growth factor) in the retina of each group of mice was detected. Fig.11 shown.

[0140] The results show:

[0141] Depend on Fig.11 It can be seen that the expression level of angiogenic growth factor Fgf2 in the retina of laser-induced CNV model mice (blank group) was significantly reduced 3 days later (P < 0.01), and the specific expression level was: 0.810728;

[0142] The expression level of angiogenic growth factor Fgf2 in the retina of the reverse control group (E. coli) was significantly increased (P<0.05), and the specific expression level was: 0.991923;

[0143] The results showed that intragastric administration of A. muciniphila bacterial solution could significantly reduce the expression of Fgf2, a pro-angiogenic growth factor in the mouse retina (specific expression level: 0.515691), thereby helping to reduce the number and area of ​​regenerated new blood vessels.

[0144] Example 4: Effect of Akkermansia Standard Strain ATCC BAA-835 on the Spp1 Factor in Mouse Retina

[0145] The animal experiment was the same as in Example 1. After the experiment, the animals were killed on the 3rd day after modeling, and the retina of the left eye was taken for experiment.

[0146] The expression level of Spp1 factor in the retina of each group of mice was detected. Fig.12 shown.

[0147] The results show:

[0148] Depend on Fig.12 It can be seen that the expression level of Spp1 factor in the retina of laser-induced CNV model mice (blank group) was significantly reduced 3 days later (P < 0.001), and the specific expression levels were: mean, 1.017278;

[0149] The expression level of Spp1 factor in the retina of the reverse control group (E. coli) was significantly increased (P<0.05), and the specific expression levels were: mean, 1.576489;

[0150] Spp1 is one of the most expressed genes in retinal microglia during CNV formation. Intravenous administration of A. muciniphila bacterial solution can significantly reduce the expression of Spp1 factor in the mouse retina (specific expression level: 0.587334), thereby helping to reduce retinal inflammation.

[0151] Although the present invention has been disclosed as above in the form of a preferred embodiment, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Use of Akkermansia muciniphila standard strain ATCC BAA-835 or a bacterial agent containing Akkermansia standard strain ATCC BAA-835 in the preparation of a medicament capable of improving and / or treating retinal and choroidal neovascularization diseases, characterized in that: The retinal and choroidal neovascular diseases include but are not limited to age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss.

2. The use according to claim 1, characterized in that: The drug has at least one of the following applications: a. Reduce the area of ​​retinal and choroidal neovascularization; b. Reduce the number of regenerated new blood vessels; c. Reduce retinal inflammation, reduce the expression of Fgf2, angiogenic growth factor in the mouse retina, and reduce the expression of Spp1 factor in the mouse retina; d. Improve and / or treat retinal and choroidal neovascularization diseases.

3. The use according to claim 1 or 2, characterized in that: In the drug, the amount of Akkermansia standard strain ATCC BAA-835 added is not less than 1×10 9 CFU / mL.

4. The use according to any one of claims 1 to 3, characterized in that: The medicine contains the Akkermansia standard strain ATCC BAA-835, a medicine carrier and / or a pharmaceutical excipient.

5. The use according to claim 4, characterized in that: The drug carrier comprises microcapsules, microspheres, nanoparticles and / or liposomes; preferably, the pharmaceutical excipients include one or more of fillers, binders, wetting agents, disintegrants, lubricants, and flavoring agents; preferably, the drug is in the form of granules, capsules, tablets, pills, oral liquids, powders, suspensions, capsules, tube feeding preparations or enemas; preferably, the drug includes human drugs or animal drugs.

6. The use according to any one of claims 1 to 5, characterized in that: The bacterial agent uses Akkermansia standard strain ATCC BAA-835 as the main microorganism.

7. The use according to any one of claims 1 to 6, characterized in that: The bacterial agent is a liquid bacterial agent or a solid bacterial agent; preferably, the bacterial agent contains living bacterial cells, dry bacterial cells obtained by freeze-drying, and immobilized cells of the standard strain of Akkermansia ATCC BAA-835.

8. Use of Akkermansia muciniphila standard strain ATCC BAA-835 or a bacterial agent containing Akkermansia standard strain ATCC BAA-835 in the preparation of a product capable of improving and / or treating retinal and choroidal neovascularization diseases, characterized in that: The products are food, health food, detection reagents, detection kits, feed, feed additives, and food additives.

9. The use according to claim 8, characterized in that: The retinal and choroidal neovascular diseases include but are not limited to age-related macular degeneration, retinopathy of prematurity, pathological neovascular high myopia, polypoidal chorioretinopathy, retinal vasculitis, and diabetic retinopathy vision loss.

10. The use according to claim 9, characterized in that: The dosage forms of the health food include powder, suspension, oral solution, tablet, capsule and granule.

Images