Method for realizing efficient genome integration of exogenous DNA fragment and application of method

Abstract

The invention provides a method for realizing efficient genome integration of an exogenous DNA fragment and application of the method. The method comprises the following steps: construction of a transgenic vector, preparation of ZB transposon enzyme, transgenic microinjection and fluorescence signal detection. According to the invention, ZB transposon from zebra fish is utilized to construct p-miniZB plasmid, a minimum empty vector sequence is provided to meet the cloning requirements of different exogenous genes, the maximum assembly of exogenous fragments is facilitated, transposase is optimized through goldfish codon preference, nuclear localization signals are recombined at the N terminal and the C terminal of protein, and the transposase can be used for cloning different exogenous genes. The coding positioning integration of exogenous DNA fragments is facilitated, the integration rate and hereditary rate of exogenous genes can be improved, the probability of gene jumping of goldfish homologous transposase systems and transposase can be reduced, and the method has the characteristics of convenience in operation, high conversion rate, high stability, high precision and the like, can be applied to multiple biotechnical fields, and has wide application prospects. And a new thought and a new method are provided for related research and utilization of fish transgenosis.

Description

Technical Field

[0001] The present invention belongs to the technical field of animal genetic engineering, and specifically relates to a method for realizing efficient genome integration of exogenous DNA fragments and its application. Background Art

[0002] Goldfish originated in China and has a history of more than 1,000 years. It is a living fossil and cultural name card. It is deeply loved by people all over the world because of its various shapes and colors. In recent years, foreign countries have relied on advanced breeding and breeding technologies, which has caused great pressure on our goldfish industry. In addition, the goldfish industry is facing many problems such as low innovation ability, difficulty in breeding, weak disease resistance and low level of practitioners. The innovation of goldfish varieties is the fundamental driving force for maintaining its industrial development and is an urgent problem that needs to be solved. Therefore, the integration of exogenous genes is expected to achieve innovation in goldfish varieties, but there is currently no good technical means for goldfish. As a type of DNA fragment that can move in the genome, the unique transposition mechanism of transposons provides new ideas and methods for gene integration, especially in animal gene transfer and gene function research, and has shown great potential and application value. Commonly used DNA transposons include Sleeping Beauty (SB), piggyBac (PB) and Tol2, etc. These transposon systems have their own characteristics. For example, the SB transposon system has the characteristics of high efficiency and random integration, while the PB transposon system allows up to 100kb of DNA to be inserted into the "AATT" sequence, and these sequences are preferentially located in the euchromatin region of the mammalian genome. The existing technology has discovered the Tgf2 transposon system in the goldfish genome, indicating that the goldfish genome is also suitable for the transposon system to function. However, since the goldfish itself has transposase, the system will cause unstable jumping of exogenous integration fragments, so it is only suitable for gene integration in other species. Studies have shown that the earliest use of the transposon system in goldfish was to use the Tol2 system to conduct gene integration research on grass goldfish, but the detection rate was only 17.3%, which could not meet the needs of goldfish exogenous gene integration. The ZB transposon system is a newly discovered transposon system with high activity in zebrafish. The system shows strong activity in mammalian cells and mice, but is rarely used in fish. In addition, the existing technologies have the following problems: (1) the positive rate of linearized plasmids is usually less than 10%, and the heritability is less than 1%; (2) the positive rate of transgenic goldfish mediated by insect piggyBac transposon is extremely low (less than 1%); (3) the positive rate of the Tol2 transposition system can reach 17%, but the Tol2 transposase is large and it is not easy to prepare high-quality capped mRNA; (4) the efficiency of the Tol2 transposition system is very low when the length of the introduced exogenous fragment is more than 10 kb; (5) the goldfish Tgf2 transposon system can make the fluorescence rate reach more than 80%, but because the goldfish itself has Tgf2 transposase, the constructed transgenic strain will cause gene jumping, resulting in strain instability. Therefore, developing a transposon system that can achieve efficient integration of exogenous genes in the goldfish genome has greatly improved the effectiveness and application scope of the ZB transposon. Efficient integration of exogenous genes in the goldfish genome is crucial for innovative goldfish breeding. Summary of the invention

[0003] Technical problems to be solved: In view of the above technical problems, the purpose of the present invention is to provide a method and application thereof for realizing efficient genome integration of exogenous DNA fragments, and the steps are as follows: transgenic vector construction, preparation of ZB transposon enzyme, transgenic microinjection and fluorescence signal detection. The present invention uses the ZB transposon derived from zebrafish to construct p-miniZB plasmid, provides the smallest empty vector sequence to meet the needs of different exogenous gene cloning, is conducive to the maximum assembly of exogenous fragments, and the transposase is optimized by goldfish codon preference, and the nuclear localization signal is recombined at the N-terminus and C-terminus of the protein, which is conducive to the coding and localization integration of exogenous DNA fragments, which can not only improve the integration rate and heritability of exogenous genes, but also reduce the probability of gene jumping of goldfish homologous transposon system and transposase, and has the characteristics of convenient operation, high conversion rate, high stability, high precision, etc., which can be applied to multiple biotechnology fields, and provide new ideas and methods for fish transgenic related research and utilization.

[0004] Technical solution: A method for achieving efficient genome integration of exogenous DNA fragments, comprising the following steps: S1. Construction of ZB transposon transgenic donor plasmid: Use PCR technology to clone the target gene DNA fragment and integrate it into the p-miniZB universal transgenic vector backbone plasmid to obtain the ZB transposon transgenic donor plasmid; S2. Preparation of ZB transposase RNA: Use PCR technology to clone the ZB transposase-CO final sequence, add capping and optimize to obtain ZB transposase RNA; S3. Preparation of a mixed system: ZB transposon transgenic donor plasmid and ZB transposase RNA are mixed evenly to prepare a mixed system; S4. Transgenic microinjection: Fertilized eggs are collected by artificial insemination, and the mixed system is microinjected into each embryo of the fertilized egg to obtain microinjected embryos; S5. Fluorescence detection: Use fluorescence microscopy to detect fluorescence expression. Furthermore, the p-miniZB universal transgenic vector backbone plasmid in step S1 contains two transposition arms of the ZB transposition system, and there is a multi-cloning site between the transposition arms. The plasmid map is shown in Figure 1 . Furthermore, the integration methods of the target gene DNA fragment in step S1 include restriction enzyme ligation and seamless cloning. Furthermore, the ZB transposase-CO final sequence in step S2 is shown as SEQ.ID.NO.1. Furthermore, in step S3, the concentration of the ZB transposon transgene donor plasmid is 50-100 ng / μL, and the concentration of the ZB transposase RNA is 100-200 ng / μL. Furthermore, the injection volume of the mixed system in step S4 is 2-4 nL. The application of any of the above methods in the innovative breeding of goldfish is shown in the application flow chart. Figure 2 . Beneficial effects: 1. The p-miniZB universal transgenic vector backbone plasmid used to construct the ZB transposon transgenic donor plasmid in the present invention contains two transposition arms of the ZB transposition system, and a multiple cloning site for convenient molecular cloning is introduced between the transposition arms. The transposition wall is relatively short, and the basic plasmid size is only about 3kb, providing a minimum empty vector sequence to meet the needs of different exogenous gene cloning, which is conducive to the maximum assembly of exogenous fragments, and the size of the exogenous fragment that can be integrated can reach 10kb. 2. The ZB transposase used in the present invention has been optimized for metal codon preference, and nuclear localization signals (NLS) are recombined at the N-terminus and C-terminus, which facilitates accurate recognition with the ZB transposon transgenic donor plasmid. In addition, the transposase is relatively small, which facilitates in vitro transcription of high-quality RNA, and has the characteristics of low toxicity and high expression. 3. The present invention is based on the ZB active transposition system derived from zebrafish and the optimized and modified ZB transposase to efficiently integrate exogenous DNA fragments of goldfish. It not only has the advantages of high transgenic efficiency, an integration rate of 60-90%, a heritability of 30%, simplicity, efficiency and high precision, but also can overcome the problem of gene jumping in transgenic strains caused by the endogenous transposition system of goldfish, resulting in strain instability, thereby efficiently mediating gene transfer, maximizing the effectiveness and application scope of the ZB transposition system, and providing new methods and ideas for the research on relevant functional genes and gene innovation breeding of fish. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is the p-miniZB plasmid map; Figure 2 This is a flow chart of the application of exogenous DNA fragments in goldfish based on the p-miniZB transposition system; Figure 3 is the pUC-SPZB seq plasmid map; Figure 4 It is the result of PCR amplification of enhancer-B actin-EGFP DNA fragment; Figure 5 is the result of linearized pUC-SPZB-seq backbone PCR amplification; Figure 6 is the pUC-SPZB-enchancer-B actin-EGFP plasmid map; Figure 7 is the result of PCR amplification of ZB-enchancer-B actin-EGFP DNA fragment; Figure 8 is the PCR amplification result of the pmini backbone DNA fragment; Fig. 9 is the pmini ZB-enchancer-B actin-EGFP plasmid map; Fig.10 It is the agarose gel electrophoresis image of ZB transposase; Fig.11 is the YHpTol2-enchancer-B actin-EGFP plasmid map; Fig.12 is the pCMV-Tol2 plasmid map; Fig.13 This is the fluorescence detection situation of Example 5 and Comparative Example 1; Fig.14 It is the fluorescence expression result of goldfish fry and adult goldfish in Example 6. DETAILED DESCRIPTION The present invention will be further described below in conjunction with embodiments, which are explanations of the present invention and are not limited to the following embodiments: Example 1 Synthesis of pUC-SPZB-seq plasmid The ZBseq containing ZB-L / R was directly synthesized by Shanghai Biotechnology Co., Ltd. onto the pUC-SP plasmid vector. The plasmid was named pUC-SPZB seq. Its base sequence is shown in SEQ.ID.NO.2. The plasmid map is shown in Figure 3 shown. Example 2 Construction of pUC-SPZB-enchancer-Bactin-EGFP plasmid S1. Cloning of enhancer-Bactin-EGFP DNA fragment: Using plasmid YHpTol2-enchancer-Bactin-EGFP as template, primers ZB-enhancer-B-actin-f / ZB-Bactin-EG-r, PrimeSTARMaxPremix (2x) were used for PCR cloning to obtain enhancer-Bactin-EGFP DNA fragment. Primers ZB-enhancer-B-actin-f / ZB-Bactin-EG-r were designed with 15 bp homology arm sequences identical to the linearized pUC-SPZB-seq backbone. The base sequences of the primers used in step S1 are shown in Table 1; the results of PCR amplification of enhancer-Bactin-EGFP DNA fragment are shown in Figure 4 ,Depend on Figure 4 It can be seen that the length of the amplified target band is 4344bp and the maerker is 5000bp; the linearized pUC-SPZB-seq backbone PCR amplification results are shown in Figure 5 ,Depend on Figure 5 It can be seen that the length of the amplified target band is 3238bp and the maerker is 5000bp. Table 1S1 Base sequences of primers used Primer name Base sequence ZB-enhancer-B-actin-f aaccaattgaattgccttcggcttagtccctttattaatc ZB-Bactin-EG-r atctatttaaattaaactgggcagtgaaaaaaatgctttatttgtg ZB-wfgj-r gcaattcaattggtttggtaatagc ZB-wfgj-f ccagtttaatttaaatagatctggcc S2. DNA gel recovery: Cut the gel block containing the target fragment from the agarose gel and weigh it, add Buffer B2 buffer 5 times the mass of the gel block, and dissolve it in a water bath at 50°C for 10 minutes. Transfer the sol solution to the adsorption column, centrifuge it at 8000×g for 30 seconds, and pour out the liquid in the collection tube. Then add 500μL Wash Solution and centrifuge it at 9000×g for 30 seconds, pour out the liquid in the collection tube, repeat once, and then centrifuge the empty adsorption column at 9000×g for 60 seconds, put the adsorption column into a clean 1.5mL centrifuge tube, add 40μL Nuclease-free Water to the center of the adsorption membrane, let it stand at room temperature for 60 seconds, and centrifuge it for 60 seconds, and save the DNA solution in the tube; S3. Seamless cloning: Use the pEASY-Basic Seamless Cloning and Assembly Kit for seamless cloning reaction. The reaction system is shown in Table 2. Mix gently, and then react at 50°C for 15 minutes. After the reaction, place the centrifuge tube on ice for a few seconds. The recombinant product can be stored at -20°C or used directly for transformation. Table 2 Seamless cloning reaction system Note: * indicates that in a 10 μL reaction system, the recommended amount of vector and each inserted fragment is 0.01-0.25 pmols, and the optimal molar ratio of vector to each inserted fragment is 1:2, pmols = mass ng / (fragment length bp×0.65 kDa). S4. Transformation plating: Thaw the full-form gold Trans1-T1 competent cells on ice, then add 5 μL of the recombinant product to 50 μL of the cells, gently flick the wall of the centrifuge tube to mix (no vortexing), place on ice for 30 minutes, heat shock in a water bath at 42°C for 90 seconds, immediately transfer to ice to cool for 2 minutes, then add 1 mL of room temperature LB medium, culture at 250 rpm in a 37°C shaker for 1 hour, then preheat the LB plate with appropriate resistance at 37°C, take 100 μL of cells and evenly spread them on the plate, and culture overnight at 37°C; S5.pUC-SPZB-enchancer-Bactin-EGFP plasmid extraction: Pick up single clone colonies for sequencing, compare sequencing results, name positive clones as pUC-SPZB-enchancer-Bactin-EGFP plasmid bacteria, expand the pUC-SPZB-enchancer-Bactin-EGFP plasmid bacteria, then take 5mL of overnight cultured bacterial solution, centrifuge at 8000×g for 2min to collect the bacteria and discard the culture medium, then add 250μL Buffer P1 to the precipitate to thoroughly suspend the bacteria, add 250μL Buffer P2, immediately gently invert the centrifuge tube 10 times to mix, and let stand at room temperature for 4min. Then add 350 μL Buffer P3, immediately gently invert the centrifuge tube 10 times to mix, and centrifuge at 12000×g for 10 min. Then transfer the supernatant into the adsorption column and centrifuge at 9000×g for 30 s. Pour out the liquid in the collection tube, add 500 μL Wash Solution and centrifuge at 9000×g for 30 s. Pour out the liquid in the collection tube, repeat once, then centrifuge the empty adsorption column at 9000×g for 1 min, then put the adsorption column into a clean 1.5 mL centrifuge tube, add 100 μl Nuclease-free Water in the center of the adsorption membrane, let it stand at room temperature for 1 min and centrifuge for 1 min, save the DNA solution in the tube, and store it in a -20℃ refrigerator for later use; The pUC-SPZB-enchancer-Bactin-EGFP plasmid can be found in Figure 6 , and its base sequence is shown in SEQ.ID.NO.3. Example 3 Construction of pminiZB-enchancer-Bactin-EGFP plasmid S1. Cloning of ZB-enchancer-Bactin-EGFP DNA fragment: clone the ZB-enchancer-Bactin-EGFP DNA fragment from the pUC-SP ZB-enchancer-Bactin-EGFP plasmid and clone the pmini backbone DNA fragment from the pminitol2-casrx plasmid using PCR technology; The base sequences of the primers used in step S1 of Example 3 are shown in Table 3; the PCR amplification results of the ZB-enchancer-Bactin-EGFP DNA fragment are shown in Figure 7 ,Depend on Figure 7 It can be seen that the length of the amplified target band is 5008bp and the marker is 5000bp; the PCR amplification results of the pmini backbone DNA fragment are shown in Figure 8 ,Depend on Figure 8It can be seen that the length of the amplified target band is 2968bp and the marker is 5000bp. Table 3 Base sequences of primers used in step S1 of Example 3 S2. DNA gel recovery: Cut the gel block containing the target fragment from the agarose gel and weigh it, add Buffer B2 buffer 5 times the mass of the gel block, and dissolve it in a water bath at 50°C for 10 minutes. Transfer the sol solution to the adsorption column, centrifuge it at 8000×g for 30 seconds, and pour out the liquid in the collection tube. Then add 500μL Wash Solution and centrifuge it at 9000×g for 30 seconds, pour out the liquid in the collection tube, repeat once, and then centrifuge the empty adsorption column at 9000×g for 60 seconds, put the adsorption column into a clean 1.5mL centrifuge tube, add 40μL Nuclease-free Water to the center of the adsorption membrane, let it stand at room temperature for 60 seconds, and centrifuge it for 60 seconds, and save the DNA solution in the tube; S3. Seamless cloning: Use the pEASY-Basic Seamless Cloning and Assembly Kit for seamless cloning reaction. The reaction system is shown in Table 2. Mix gently, and then react at 50°C for 15 minutes. After the reaction, place the centrifuge tube on ice for a few seconds. The recombinant product can be stored at -20°C or used directly for transformation. S4. Transformation plating: Thaw the full-form gold Trans1-T1 competent cells on ice, then add 5 μL of the recombinant product to 50 μL of the cells, gently flick the wall of the centrifuge tube to mix (no vortexing), place on ice for 30 minutes, heat shock in a water bath at 42°C for 90 seconds, immediately transfer to ice to cool for 2 minutes, then add 1 mL of room temperature LB medium, culture at 250 rpm in a 37°C shaker for 1 hour, then preheat the LB plate with appropriate resistance at 37°C, take 100 μL of cells and evenly spread them on the plate, and culture overnight at 37°C; S5.pminiZB-enchancer-Bactin-EGFP plasmid extraction: single clones were picked for sequencing, and the sequencing results were compared. The positive clones were named pminiZB-enchancer-Bactin-EGFP plasmid bacteria. The pminiZB-enchancer-Bactin-EGFP plasmid bacteria were expanded and cultured. Then 5 mL of overnight culture solution was taken and centrifuged at 8000 × g for 2 min to collect the bacteria and discard the culture medium. Then 250 μL Buffer P1 was added to the precipitate to thoroughly suspend the bacteria. 250 μL Buffer P2, immediately and gently invert the centrifuge tube 10 times to mix and let it stand at room temperature for 4 minutes, then add 350μL Buffer P3, immediately and gently invert the centrifuge tube 10 times to mix and centrifuge at 12000×g for 10 minutes, then transfer the supernatant into the adsorption column and centrifuge at 9000×g for 30 seconds, pour out the liquid in the collection tube, add 500μL Wash Solution and centrifuge at 9000×g for 30 seconds, pour out the liquid in the collection tube, repeat once, then centrifuge the empty adsorption column at 9000×g for 1 minute, then put the adsorption column into a clean 1.5mL centrifuge tube, add 100μl Nuclease-free Water in the center of the adsorption membrane, let it stand at room temperature for 1 minute and centrifuge for 1 minute, save the DNA solution in the tube, and store it in a -20℃ refrigerator for later use; The pminiZB-enchancer-Bactin-EGFP plasmid can be found in Fig. 9 , and its base sequence is shown in SEQ.ID.NO.4. Example 4 Preparation of ZB transposase RNA S1. Cloning of ZBtransposase-COfina plasmid sequence: The plasmid ZBtransposase-COfinal was linearized by PCR technology as a template for in vitro transcription, wherein the primer sequences are shown in Table 4; Table 4 Base sequences of primers used in step S1 of Example 4 Primer name Base sequence ZB-transposase-f tacacatacgatttaggtgacac ZB-transposase-r ttagctggcctccaccttg S2. Preparation of capped mRNA: Take 1 μg of recovered DNA fragments to make a template solution, draw 5.5 μL of template DNA into the reaction system, the reaction system consists of 2 μL 10X Reaction Buffer, 10 μL 2X NTP / Cap, 2 μL Sp6 Enzyme Mix, 0.5 μL RNase inhibitor, and the total reaction volume is 20 μL, then put it into the PCR instrument and react for 4 hours at 37°C, set the temperature of the PCR instrument lid to 70°C to obtain capped mRNA, add 1 μL DNase in the mMESSAGE mMACHINET MSP6 transcription kit to the reaction solution, put it into the PCR instrument and react for 30 minutes at 37°C to achieve the purpose of digesting DNA, and add 100 μL H 2 O (RNase-free) to 200 μL, and then add 20 μL Ammonium Acetate to terminate the reaction; S3. Purification: Add 200 μL of mixed solution (100 μL phenol + 96 μL chloroform + 4 μL isoamyl alcohol) to the reaction system, mix by inverting, and centrifuge at 12000 rpm in a 4°C refrigerated centrifuge for 5 min, then add 200 μL chloroform-isoamyl alcohol solution (192 μL chloroform + 8 μL isoamyl alcohol), mix by inverting, and centrifuge at 12000 rpm in a 4°C refrigerated centrifuge for 5 min, then aspirate the upper aqueous phase into a new EP tube, add 200 μL of isopropanol was inverted, and then placed in a -80℃ refrigerator for 10 minutes, and centrifuged at 13500 rpm for 5 minutes to discard the supernatant, and then 1 mL of 75% ethanol was added for washing and centrifuged at 13500 rpm for 5 minutes in a 4℃ refrigerated centrifuge. The supernatant was discarded and placed in a 4℃ refrigerated centrifuge for centrifugation at 13500 rpm for 5 minutes. The remaining liquid was sucked up with a gun and dried in an ultra-clean bench for 8 minutes. 35 μL RNase-free H 2 O in a 55℃ water bath for 30s, divide into aliquots and freeze at -80℃ for later use. The agarose gel electrophoresis diagram of the ZB transposase is shown in Fig.10 . Example 5 A method for achieving efficient genome integration of exogenous DNA fragments, comprising the following steps: S1. Construction of ZB transposon transgene donor plasmid: pminiZB-enchancer-Bactin-EGFP plasmid prepared in Example 3; S2. Preparation of ZB transposase RNA: ZB transposase RNA prepared in Example 4; S3. Preparation of mixed system: 50 ng / μL pminiZB-enchancer-Bactin-EGFP plasmid and 100 ng / μL ZB transposase RNA were mixed evenly to prepare 3 μL mixed system; S4. Preparation of zebrafish fertilized eggs: 2 female fish and 1 male fish were transferred to a breeding box, separated by a partition and cultured in the dark overnight. The partition was removed on the next day, and the male and female fish chased each other and began to lay eggs. The eggs were collected 10 minutes after the start of spawning to obtain zebrafish fertilized eggs. S5. Transgenic microinjection: The zebrafish fertilized eggs were placed under a stereo microscope for microinjection, and each embryo of the zebrafish fertilized eggs was injected with 3 nL of the mixed system to obtain microinjected embryos; S6. Embryo culture: Microinjected embryos were cultured in 1×E3 medium at 28.5°C. The medium was changed every 24 hours and dead embryos were removed during the medium change. Example 6 A method for achieving efficient genome integration of exogenous DNA fragments in goldfish comprises the following steps: S1. Construction of ZB transposon transgenic donor plasmid: pmini ZB-enchancer-Bactin-EGFP plasmid prepared in Example 3; S2. Preparation of ZB transposase RNA: ZB transposase RNA prepared in Example 4; S3. Preparation of mixed system: 50 ng / μL pmini ZB-enchancer-B actin-EGFP plasmid and 100 ng / μL ZB transposase RNA were mixed evenly to prepare 3 μL mixed system; S4. Preparation of fertilized goldfish eggs: artificial insemination was used to obtain the eggs. A pair of dragon-eye butterfly-tail goldfish with tail-chasing phenomenon was selected. The abdomen (in front of the cloaca) was gently squeezed. Yellowish eggs flowed out of the female fish and white sperm flowed out of the male fish for later use. The eggs of the female fish were first squeezed onto a 10 mm diameter agar plate (concentration 2%, thickness 5 mm) prepared in advance. The semen of the male fish was immediately sucked with a 200 μL pipette and dripped onto the eggs. Aerated fish water was then added to fully fertilize for 1 min. Then 10 mL of 0.25% pancreatin was used to debond for 3 min at room temperature. During this period, the eggs were gently stirred with a feather. The eggs were rinsed with Hershel solution 3 times and then transferred to a 10 mm diameter agar plate (concentration 2%, thickness 5 mm) to obtain fertilized goldfish eggs. S5. Transgenic microinjection: The fertilized goldfish eggs were placed under a stereomicroscope for microinjection, and each embryo of the fertilized goldfish egg was injected with 3 nL of the mixed system to obtain microinjected embryos; S6. Embryo culture: The microinjected embryos were cultured in Herschel's solution at 28.5°C for 6 h, and then cultured with aerated water. The solution was changed every 24 h, and dead embryos were removed during the change of solution. S7. Embryo observation: The microinjected embryos were observed for green fluorescence at 48 h. Comparative Example 1 The difference between this comparative example and Example 5 is that ZB transposase RNA is not added to the mixed system. A method for realizing genomic integration of exogenous DNA fragments using pmini ZB-enchancer-B actin-EGFP plasmid comprises the following steps: S1. Construction of ZB transposon transgenic donor plasmid: pmini ZB-enchancer-Bactin-EGFP plasmid prepared in Example 3; S2. Preparation of zebrafish fertilized eggs: Two female fish and one male fish were transferred to a breeding box, separated by a partition and cultured overnight in the dark. The partition was removed on the second day, and the male and female fish chased each other and began to lay eggs. The eggs were collected 10 minutes after the start of spawning to obtain zebrafish fertilized eggs; S3. Transgenic microinjection: The zebrafish fertilized eggs were placed under a stereo microscope for microinjection. Each embryo of the zebrafish fertilized eggs was injected with 3 nL of 50 ng / μL pmini ZB-enchancer-B actin-EGFP plasmid to prepare microinjected embryos. S4. Embryo culture: Microinjected embryos were cultured in 1×E3 medium at 28.5°C. The medium was changed every 12-24 hours and dead embryos were removed during the medium change. Comparative Example 2 The difference between this comparative example and Example 5 is that the pminiZB-enchancer-Bactin-EGFP plasmid in the mixed system is replaced by the YHpTol2-enchancer-Bactin-EGFP plasmid, and the ZB transposase RNA is replaced by the Tol2 transposase RNA, wherein the preparation of the YHpTol2-enchancer-Bactin-EGFP plasmid is referred to Example 3, and the preparation of the Tol2 transposase RNA using the pCMV-Tol2 plasmid is referred to Example 4, and the YHpTol2-enchancer-Bactin-EGFP plasmid map is shown in Fig.11 The base sequence is shown in SEQ.ID.NO.5, and the plasmid map of pCMV-Tol2 is shown in Fig.12 , whose base sequence is shown in SEQ.ID.NO.6. A method for achieving efficient genome integration of exogenous DNA fragments comprises the following steps: S1. Construction of Tol2 transposon transgenic donor plasmid: YHpTol2-enchancer-Bactin-EGFP plasmid prepared by the method of reference Example 3; S2. Preparation of Tol2 transposase RNA: Tol2 transposase RNA prepared by the method of reference Example 4; S3. Preparation of mixed system: 50 ng / μL YHpTol2-enchancer-Bactin-EGFP plasmid and 100 ng / μL Tol2 transposase RNA were mixed evenly to prepare 3 μL mixed system; S4. Preparation of zebrafish fertilized eggs: 2 female fish and 1 male fish were transferred to a breeding box, separated by a partition and cultured in the dark overnight. The partition was removed on the next day, and the male and female fish chased each other and began to lay eggs. The eggs were collected 10 minutes after the start of spawning to obtain zebrafish fertilized eggs. S5. Transgenic microinjection: The zebrafish fertilized eggs were placed under a stereo microscope for microinjection, and each embryo of the zebrafish fertilized eggs was injected with 3 nL of the mixed system to obtain microinjected embryos; S6. Embryo culture: Microinjected embryos were cultured in 1×E3 medium at 28.5°C. The medium was changed every 12-24 hours and dead embryos were removed during the medium change. Performance Testing (1) Fluorescence efficiency The green fluorescence expression of Example 5, Example 6, Comparative Example 1 and Comparative Example 2 was observed using a fluorescence microscope, and the fluorescence efficiency was calculated. Table 5 Fluorescence efficiency of Example 5, Example 6, Comparative Example 1 and Comparative Example 2 Fluorescence efficiency (%) Example 5 83.6 Example 6 91.3 Comparative Example 1 18.2 Comparative Example 2 67.9 As shown in Table 5, the fluorescence efficiency of Example 5 and Example 6 is higher than that of Comparative Example 1 and Comparative Example 2, indicating that the ZB transposase plasmid and ZB transposase RNA constructed in this patent can stably exist in the embryo and can efficiently mediate the transfer of the green fluorescent protein gene, proving that the ZB transposon system can efficiently mediate the integration of exogenous DNA fragments into the recipient embryo; Fig.13 It can be seen that in Comparative Example 1, ZB transposase RNA is not added, indicating that ZB transposase RNA can effectively promote the expression of green fluorescent protein gene, proving that ZB transposase RNA is modified and optimized by nucleoprotein localization signal (NLS), promoting the precise integration of genes carried by ZB transposase plasmid, and having a positive effect on the expression of exogenous genes; Fig.14 It can be seen that Example 6 is to transfect the ZB transposon system carrying the target gene into the embryo of the fertilized goldfish egg, and its fluorescence efficiency is the highest, indicating that the ZB transposon system can have excellent effects in the innovative breeding of goldfish and can achieve efficient integration and stable expression of the target gene. The above is only a preferred embodiment of the present invention and does not limit the present invention in any form. Any technician familiar with the art can make many possible changes and modifications to the technical solution of the present invention by using the above disclosed methods and technical contents without departing from the spirit and technical solution of the present invention, or modify it into an equivalent embodiment of equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments according to the technical essence of the present invention without departing from the content of the technical solution of the present invention still falls within the scope of protection of the technical solution of the present invention.

Claims

1. A method for achieving efficient genome integration of exogenous DNA fragments, characterized in that: The following steps are involved: S1. Construction of ZB transposon transgenic donor plasmid: Use PCR technology to clone the target gene DNA fragment and integrate it into the p-miniZB universal transgenic vector backbone plasmid to obtain the ZB transposon transgenic donor plasmid; S2. Preparation of ZB transposase RNA: Use PCR technology to clone the ZB transposase-CO final sequence, add capping and optimize to obtain ZB transposase RNA; S3. Preparation of a mixed system: ZB transposon transgenic donor plasmid and ZB transposase RNA are mixed evenly to prepare a mixed system; S4. Transgenic microinjection: Fertilized eggs are collected by artificial insemination, and the mixed system is microinjected into each embryo of the fertilized egg to obtain microinjected embryos; S5. Fluorescence detection: Use fluorescence microscopy to detect fluorescence expression.

2. A method for achieving efficient genomic integration of exogenous DNA fragments according to claim 1, characterized in that: In the step S1, the p-miniZB universal transgenic vector backbone plasmid contains two transposition arms of the ZB transposition system, and a multi-cloning site is provided between the transposition arms.

3. A method for achieving efficient genomic integration of exogenous DNA fragments according to claim 1, characterized in that: The integration methods of the target gene DNA fragment in step S1 include restriction enzyme ligation and seamless cloning.

4. A method for achieving efficient genomic integration of exogenous DNA fragments according to claim 1, characterized in that: The ZB transposase-CO final sequence in step S2 is shown as SEQ.ID.NO.

1.

5. A method for achieving efficient genomic integration of exogenous DNA fragments according to claim 1, characterized in that: In step S3, the concentration of the ZB transposon transgene donor plasmid is 50-100 ng / μL, and the concentration of the ZB transposase RNA is 100-200 ng / μL.

6. A method for achieving efficient genomic integration of exogenous DNA fragments according to claim 1, characterized in that: The injection volume of the mixed system in step S4 is 2-4 nL.

7. Application of the method according to any one of claims 1 to 6 in innovative breeding of goldfish.

Images