Polypeptide with repairing effect and application thereof

Abstract

The invention relates to the technical field of polypeptides, and mainly relates to a polypeptide with a repairing effect and application thereof. The polypeptide contains the following amino acid sequence: (EVDEQMLNVQNK) n, wherein n is any one natural number from 3 to 10. The polypeptide can significantly improve the activity and proliferation of keratinocytes, and has an excellent effect of promoting skin repair.

Description

Technical Field

[0001] The present application relates to the technical field of polypeptides, and mainly to a polypeptide with repairing effect and its application. Background Art

[0002] Sea cucumber (holothurians), belonging to the phylum Echinodermata and class Holothurioider, is a marine invertebrate with a long history. According to current statistics, there are more than 1,250 species of sea cucumbers in the world, distributed all over the world, mainly in tropical and temperate zones. The tropical zone mainly includes Malaysia, the Philippines, Indonesia, Fiji and other places. There are many species and large numbers of sea cucumbers in the tropical zone, accounting for a large proportion of the world's sea cucumber resources. The temperate zone includes China, Japan, South Korea, Canada and other places.

[0003] Sea cucumbers are distributed in both the south and north of my country. The northern region mainly includes Liaoning, Hebei, Shandong and other places. The species of sea cucumbers in the north are relatively single, mainly Apostichopus japonicus, which is the only edible sea cucumber currently recorded in the Bohai Sea and the Yellow Sea. It is one of the world's precious sea cucumbers and is known as the "crown of sea cucumbers". There are many species of sea cucumbers in the south, and the resources are rich, mainly including Acaudina molpadioides, Stichopus variegates, Thelenota ananas, Stichopus chloronotus, Actinopyga mauritiana, Holothuria nobilis and Stichopus horens, etc., which are distributed in Jiangsu, Fujian, Hainan and Xisha Islands.

[0004] Sea cucumbers have been used as excellent nutritional health food since ancient times. They have the effects of strengthening muscle strength, enhancing immunity, preventing arthritis, anemia and impotence. The ancient book "Compendium of Materia Medica" in the Qing Dynasty records: "Sea cucumbers are warm and nourishing, and they are as good as ginseng, so they are called sea cucumbers; they taste sweet and salty, nourish the kidney meridian, benefit the essence, eliminate phlegm, control urination, strengthen yang and cure impotence, and kill sores and insects." Protein is an important component of sea cucumbers. In dried sea cucumbers, the protein content can be close to 90%, which contains more collagen. Studies have shown that sea cucumber peptides, as a marine bioactive peptide, have multiple biological active functions, such as anti-oxidation, anti-inflammatory, anti-fatigue, anti-tumor, immune regulation, and blood pressure reduction. The sea cucumber peptides currently on the market are obtained by capturing sea cucumbers, then hydrolyzing or enzymolyzing them, and finally purifying them to obtain specific sea cucumber peptides, thereby obtaining sea cucumber peptides with specific functions. Currently, this technology is the mainstream means of obtaining sea cucumber peptides. The extraction of sea cucumber peptides has the disadvantage that sea cucumbers themselves are expensive, and the price of extracted sea cucumber peptides themselves is even more expensive, which will also lead to the capture of a large number of marine life. At the same time, the extracted sea cucumber peptides / proteins also have the risk of animal-derived immunogenicity. With the development and maturity of synthetic biotechnology, recombinant sea cucumber peptides / proteins have also come into being. Currently, specific protein functions are obtained by extracting sea cucumbers, and the amino acid sequence of sea cucumber peptides / proteins is obtained by "reverse processing" through sea cucumber extraction. Through synthetic biotechnology, recombinant sea cucumber peptides / proteins can be obtained, which have the advantages of scalability and environmental friendliness. Recombinant sea cucumber peptides / proteins have immeasurable application scenarios and effects in the medical beauty industry. Summary of the invention

[0005] The present application provides a polypeptide with repair efficacy and its application. The polypeptide has excellent skin repair efficacy and can significantly improve keratinocyte viability and keratinocyte proliferation rate. Based on the significantly excellent skin repair effect of the polypeptide, it will be widely used in the preparation of skin repair agents and / or cosmetics.

[0006] This application involves the following:

[0007] 1. A polypeptide with repairing effect, the polypeptide contains the following amino acid sequence: (EVDEQMLNVQNK) n , where n is 3, 4, 5, 6, 7, 8, 9 or 10.

[0008] 2. The polypeptide according to item 1, wherein the polypeptide is selected from any one or more of the following:

[0009] n is 3, and the amino acid sequence is the polypeptide shown in SEQ ID NO: 2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0010] n is 4, and the amino acid sequence is a polypeptide as shown in SEQ ID NO: 3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0011] n is 5, and the amino acid sequence is the polypeptide shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK;

[0012] n is 6, and the amino acid sequence is the polypeptide shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0013] n is 7, and the amino acid sequence is the polypeptide shown in SEQ ID NO:6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0014] n is 8, and the amino acid sequence is a polypeptide as shown in SEQ ID NO:7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0015] n is 9, and the amino acid sequence is a polypeptide as shown in SEQ ID NO:8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NK;

[0016] n is 10, and the amino acid sequence is the polypeptide shown in SEQ ID NO:9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NKEVDEQMLNVQNK;

[0017] and a polypeptide having an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to any one of SEQ ID NO:2 to SEQ ID NO:9;

[0018] Preferably, the polypeptide is a polypeptide whose amino acid sequence is as shown in SEQ ID NO:5; and / or a polypeptide whose amino acid sequence is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:6.

[0019] 3. The polypeptide according to claim 2, wherein the gene sequence encoding the polypeptide as shown in SEQ ID NO:5 is as shown in SEQ ID NO:10; and / or has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:10.

[0020] 4. The polypeptide according to item 2 or 3, wherein the polypeptide is a natural polypeptide or a genetically recombinant polypeptide;

[0021] Preferably, the polypeptide is sea cucumber collagen.

[0022] 5. The polypeptide according to any one of items 2 to 4, wherein the method for preparing the genetically recombinant polypeptide comprises: recombining the gene encoding the polypeptide into a basic plasmid to obtain a recombinant plasmid;

[0023] Transducing the recombinant plasmid into a host cell to obtain a recombinant cell;

[0024] The recombinant cells are cultured and the polypeptide is isolated from the culture fluid.

[0025] 6. The polypeptide according to item 5, wherein the basic plasmid is selected from any one or more of a pPIC9K vector, a pPIC9 vector, a pPIC9K-His vector and a pPIC3.5K vector;

[0026] And / or, the host cell is selected from any one or more of Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris KM71 and Pichia pastoris SMD1168.

[0027] 7. The polypeptide according to item 5 or 6, wherein culturing the recombinant cell comprises seed culturing;

[0028] The seed culture medium is selected during the seed culture;

[0029] The seed culture medium is selected from any one or more of BMGY medium, MGY medium, MGYH medium, RD medium, RDH medium, MD medium, MDH medium, SOC medium and YPD medium.

[0030] 8. The polypeptide according to any one of items 5 to 7, wherein culturing the recombinant cell comprises fermentation culturing;

[0031] The fermentation culture medium is selected during the fermentation culture;

[0032] The fermentation medium is selected from any one or more of BSM medium, BMMY medium and BMM medium;

[0033] Preferably, the fermentation medium is BSM medium.

[0034] 9. The polypeptide according to any one of items 5 to 8, wherein the fermentation culture includes methanol induction;

[0035] Methanol induction was initiated when the wet weight of the recombinant cells was 50-150 g / L, 50-75 g / L, 75-150 g / L or 100-150 g / L.

[0036] 10. The polypeptide according to item 9, wherein the pH of the fermentation broth is adjusted to 5.5-7.0 during methanol induction; preferably 6.0-6.5.

[0037] 11. The polypeptide according to any one of items 5 to 10, wherein the method for separating the polypeptide from the culture medium comprises any one or more of solid-liquid separation, chromatography and dialysis;

[0038] Preferably, the solid-liquid separation method includes any one or more of centrifugation, microfiltration, suction filtration, and ultrafiltration;

[0039] Preferably, the chromatography includes any one or more of ion chromatography and hydrophobic chromatography.

[0040] 12. Use of the polypeptide according to any one of items 1 to 11 for preparing skin repair agents and / or cosmetics.

[0041] 13. A composition with repair efficacy, comprising the polypeptide described in any one of items 1-11.

[0042] 14. A skin repair agent, comprising the polypeptide according to any one of items 1 to 11 and / or the composition according to item 13.

[0043] Effects of the Invention

[0044] The sea cucumber collagen (i.e., polypeptide) of the present application, especially the polypeptide prepared by synthetic biology technology (gene recombination method), has excellent effects in promoting the proliferation of keratinocytes and improving their cell vitality, and therefore has significantly excellent skin repair effects; the recombinant sea cucumber collagen (polypeptide) can be applied to the beauty and medical beauty industries, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 .Plasmid map of pPIC9K recombinant plasmid.

[0046] Figure 2 .Mass spectrometry detection results of pPIC9K recombinant plasmid.

[0047] Figure 3 .Agarose electrophoresis results after the linearized pPIC9K recombinant plasmid was electroporated into the Pichia pastoris GS115 host bacteria; wherein, bands 1 to 6 refer to 6 parallel samples of nucleic acid electrophoresis.

[0048] Figure 4 . Electrophoresis of polypeptides expressed by recombinant cells after methanol induction culture in BMMY medium.

[0049] Figure 5 . Electrophoresis of polypeptides expressed by recombinant cells revived from cryopreservation in BMMY medium after methanol induction.

[0050] Figure 6 .Chromatogram of the protein after purification by the method of Example 19.

[0051] Figure 7 .Chromatogram of the protein after purification by the method of Example 20.

[0052] Figure 8 .Cell viability after co-culture of human keratinocytes with polypeptide 4 and different sea cucumber collagen addition concentrations. Specific implementation methods

[0054] It should be noted that certain words are used in the specification and claims to refer to specific components. Those skilled in the art should understand that technicians may use different nouns to refer to the same component. This specification and claims do not use the difference in nouns as a way to distinguish components, but use the difference in components' functions as the criterion for distinction.

[0055] As mentioned throughout the specification and claims, "including" or "comprising" is an open term and should be interpreted as "including but not limited to". The subsequent description of the specification is a preferred embodiment of the present application, but the description is for the purpose of the general principles of the specification and is not intended to limit the scope of the present application. The scope of protection of the present application shall be determined by the attached claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by ordinary technicians in the field to which the present disclosure belongs.

[0056] It should be understood that the embodiments of the present application described herein include "consisting of" and / or "consisting essentially of" embodiments. References to "about" a value or parameter herein include (and describe) variations to the value or parameter itself. For example, a description referring to "about X" includes a description of "X".

[0057] As used herein, reference to "other than" a value or parameter generally means and describes the "except for" the value or parameter.

[0058] As used herein, the term "about XY" has the same meaning as "about X to about Y."

[0059] As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. It should also be noted that the claims may be drafted to exclude any optional elements. This statement is therefore intended to serve as antecedent basis for the use of exclusive terminology such as "only", "only" and the like in connection with the recitation of claim elements, or the use of a limitation of "no".

[0060] As used herein, the term "and / or" in phrases such as "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, as used herein, the term "and / or" in phrases such as "A, B, and / or C" is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0061] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein and refer to a polymeric form of amino acids of any length, which may include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0062] As used herein, "binding" (e.g., Cas13d nuclease binding to RNA or binding to target nucleic acid, etc.) refers to non-covalent interactions between macromolecules (e.g., non-covalent interactions between proteins and guide RNAs; non-covalent interactions between guide RNAs and target nucleic acids, etc.). When in a non-covalent interaction state, the macromolecules are referred to as "associated" or "interacting" or "binding" (e.g., when molecule X is referred to as interacting with molecule Y, it means that molecule X binds to molecule Y in a non-covalent manner). Not all components of the binding interaction need to be sequence-specific (e.g., contact with phosphate residues in the DNA backbone), but some parts of the binding interaction can be sequence-specific.

[0063] The term "amino acid", amino acids and their abbreviations are as commonly understood by those skilled in the art, specifically as follows: Ala is abbreviated as A, Leu is abbreviated as L, Gln is abbreviated as Q, Ser is abbreviated as S, Arg is abbreviated as R, Lys is abbreviated as K, Glu is abbreviated as E, Thr is abbreviated as T, Asn is abbreviated as N, Met is abbreviated as M, Gly is abbreviated as G, Trp is abbreviated as W, Asp is abbreviated as D, Phe is abbreviated as F, His is abbreviated as H, Tyr is abbreviated as Y, Cys is abbreviated as C, Pro is abbreviated as P, Ile is abbreviated as I, and Val is abbreviated as V.

[0064] A polynucleotide or polypeptide has a certain percentage of "sequence identity" with another polynucleotide or polypeptide, which means that the percentage of bases or amino acids is the same when aligned and is in the same relative position when the two sequences are compared. Sequence identity can be determined in many different ways. To determine sequence identity, various methods and computer programs (e.g., BLAST, T-COFFEE, MUSCLE, MAFFT, Phyre2, etc.) can be used to align sequences.

[0065] As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid by traditional Watson-Crick base pairing. The percentage of residues that can form hydrogen bonds (i.e., Watson-Crick base pairing) with a second nucleic acid in a complementarity percentage indication nucleic acid molecule (e.g., about 5, 6, 7, 8, 9, 10 / 10, respectively about 50%, 60%, 70%, 80%, 90%, and 100% complementarity). "Complete complementarity" means that all continuous residues of a nucleic acid sequence form hydrogen bonds with the same number of continuous residues in a second nucleic acid sequence. As used herein, "substantially complementary" refers to at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% of the complementarity degree in the region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0066] The term "hybridization" refers to the reaction of one or more polynucleotides to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. Hydrogen bonding can occur by Watson-Crick base pairing, Hoogstein binding, or in any other sequence-specific manner. A sequence that can hybridize to a given sequence is referred to as the "complementary sequence" of the given sequence.

[0067] As used herein, the term "recombinant" means that a particular nucleic acid (DNA or RNA) is the product of various combinations of cloning, restriction, polymerase chain reaction (PCR) and / or ligation steps that produce constructs with structural coding sequences or non-coding sequences that can be distinguished from endogenous nucleic acids present in natural systems. "Recombinant nucleic acid", such as a recombinant plasmid, refers to a non-naturally occurring nucleic acid, such as a nucleic acid made by the artificial combination of two otherwise separate segments of a sequence through human intervention. This artificial combination is often accomplished by chemical synthesis means or by artificial manipulation of isolated fragments of nucleic acids. The above operations can connect nucleic acid fragments having the desired functions together to produce the desired functional combination. When a recombinant polynucleotide encodes a polypeptide, the encoded polypeptide sequence can be naturally occurring (wild type, reference or reference sequence) or a variant (e.g., mutant) of a naturally occurring polypeptide sequence.

[0068] As used herein, "variant" is interpreted as a polynucleotide or polypeptide that is different from a reference polynucleotide or polypeptide, but retains the necessary characteristics. A typical variant of a polynucleotide is different from the nucleic acid sequence of another reference polynucleotide. Changes in the variant nucleic acid sequence may or may not change the amino acid sequence of the polypeptide encoded by the reference polynucleotide. Nucleotide changes may result in amino acid substitutions, additions, deletions, fusions, and truncations in the polypeptide encoded by the reference sequence, as described below. A typical variant of a polypeptide is different from another reference polypeptide in amino acid sequence. Usually, the difference is limited, so that the sequences of the reference polypeptide and the variant are generally very similar, and are identical in many regions. The amino acid sequences of the variant and the reference polypeptide may differ by any combination of one or more substitutions, additions, and deletions. The amino acid residues replaced or inserted may or may not be amino acid residues encoded by the genetic code. The variant of a polynucleotide or polypeptide may be naturally occurring (such as an allele variant), or may be an unknown naturally occurring variant. Non-naturally occurring variants of polynucleotides and polypeptides may be prepared by mutagenesis techniques, by direct synthesis, and by other recombinant methods known to those skilled in the art.

[0069] A "vector" is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid to the interior of a cell. Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphipathic compounds, plasmids and viruses. Typically, a suitable vector comprises an origin of replication that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selective markers. The term "vector" should also be interpreted to include non-plasmid and non-viral compounds that facilitate transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc.

[0070] As used herein, the terms "transduction" and "transfection" include methods known in the art to introduce DNA into cells using infectious agents (such as viruses) or other means to express a protein or molecule of interest. In addition to viruses or virus-like agents, there are chemical-based transfection methods, such as transfection methods using calcium phosphate, dendrimers, liposomes or cationic polymers (such as DEAE-dextran or polyethyleneimine); non-chemical methods, such as electroporation, cell squeezing, sonoporation, optical transfection, impalefection, protoplast fusion, plasmid delivery or transposon; particle-based methods, such as using a gene gun, magnetofection or magnet-assisted transfection, particle bombardment; and hybrid methods (such as nuclear transfection).

[0071] As used herein, the term "transfection", "transformation" or "transduction" refers to the process of transferring or introducing exogenous nucleic acid into a host cell. A "transfected", "transformed" or "transduced" cell is a cell that has been transfected, transformed or transduced with exogenous nucleic acid.

[0072] The present application provides a polypeptide with repair efficacy, wherein the polypeptide contains the following amino acid sequence: (EVDEQMLNVQNK) n , wherein n is 3, 4, 5, 6, 7, 8, 9 or 10. The value of n is different, and the polypeptide is different. The amino acid sequence of the repeating unit of the polypeptide is EVDEQMLNVQNK, SEQ ID NO: 1.

[0073] When n is 3, the polypeptide is polypeptide 1, and the amino acid sequence is as shown in SEQ ID NO:2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or the amino acid sequence of the polypeptide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:2. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:2; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:2.

[0074] When n is 4, the polypeptide is polypeptide 2, and the amino acid sequence is as shown in SEQ ID NO:3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or the amino acid sequence of the polypeptide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:3. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:3; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:3.

[0075] When n is 5, the polypeptide is polypeptide 3, and the amino acid sequence is as shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK; and / or, the amino acid sequence of the polypeptide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:4. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:4; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:4.

[0076] When n is 6, the polypeptide is polypeptide 4, and the amino acid sequence is as shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; and / or the amino acid sequence of the polypeptide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:5. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:5; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:5.

[0077] When n is 7, the polypeptide is polypeptide 5, and the amino acid sequence is as shown in SEQ ID NO:6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO:6. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:6; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:6.

[0078] When n is 8, the polypeptide is polypeptide 6, and the amino acid sequence is as shown in SEQ ID NO:7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO:7. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:7; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:7.

[0079] When n is 9, the polypeptide is polypeptide 7, and the amino acid sequence is as shown in SEQ ID NO:8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NK; and / or, the amino acid sequence of the polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:8. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:8; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:8.

[0080] When n is 10, the polypeptide is polypeptide 8, and the amino acid sequence is as shown in SEQ ID NO:9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NKEVDEQMLNVQNK; and / or, the amino acid sequence of the polypeptide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:9. In some embodiments, the amino acid sequence of the polypeptide is as shown in SEQ ID NO:9; in some embodiments, the amino acid sequence of the polypeptide is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to SEQ ID NO:9.

[0081] It should be noted that, in the present application, polypeptide N (N is 3, 4, 5, 6, 7, 8, 9 or 10) means: the polypeptide itself and / or a polypeptide having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with the polypeptide amino acid sequence. For example, polypeptide 1 can be a polypeptide having an amino acid sequence as shown in SEQ ID NO:2; or a polypeptide having an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity to SEQ ID NO:2; or any mixture thereof.

[0082] In some embodiments, the polypeptide is a single polypeptide; in some embodiments, the polypeptide is a mixture of multiple peptides having different amino acid sequences.

[0083] In some embodiments, the polypeptide is selected from any one or more of polypeptides 1 to 8.

[0084] In some embodiments, the polypeptide is polypeptide 1, polypeptide 2, polypeptide 3, polypeptide 4, polypeptide 5, polypeptide 6, polypeptide 7 or polypeptide 8.

[0085] In some embodiments, the polypeptide is a mixture of polypeptide 1 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 2 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 3 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 5 and polypeptide 4; in some embodiments, the polypeptide is a mixture of polypeptide 2, polypeptide 4 and polypeptide 5; in some embodiments, the polypeptide is a mixture of polypeptide 3, polypeptide 4 and polypeptide 5; in some embodiments, the polypeptide is a mixture of polypeptide 2, polypeptide 3, polypeptide 4 and polypeptide 5.

[0086] In some embodiments, the polypeptide is a natural polypeptide or a genetically recombinant polypeptide.

[0087] In some embodiments, the method for preparing the genetically recombinant polypeptide comprises:

[0088] Inserting the gene encoding the polypeptide into the basic plasmid to obtain a recombinant plasmid;

[0089] Transducing the recombinant plasmid into a host cell to obtain a recombinant cell;

[0090] The recombinant cells are cultured and the polypeptide is isolated from the culture fluid.

[0091] In some embodiments, the gene sequence encoding the polypeptide 4 is as shown in SEQ ID NO: 10 or has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO: 10; in some embodiments, the gene sequence encoding the polypeptide 4 has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO: 10.

[0092] As understood by those skilled in the art, the basic plasmid is an expression vector of the target gene (i.e., a gene encoding a polypeptide). In the present application, there are no excessive restrictions on the selection of the basic plasmid, as long as it can carry the target gene, transduce it into the host cell, and express the target gene. Exemplarily, the basic plasmid can be a pPIC9K vector, a pPIC9 vector, a pPIC9K-His vector, a pPIC3.5K vector; or a combination of any two or more of the above.

[0093] In the present application, it is understood that there is no excessive restriction on the selection of host cells. For example, the host cell can be Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris SMD1168, Pichia pastoris KM71, or a combination of any two or more of the above.

[0094] In some embodiments, the fermentation culture further comprises methanol induction.

[0095] In some embodiments, methanol induction is started when the wet weight of the recombinant cells is 50-150 g / L, 50-75 g / L, 75-150 g / L, 100-150 g / L, or any wet weight within the range of 50-150 g / L; in some embodiments, methanol induction is started when the wet weight of the recombinant cells is 50 g / L, 60 g / L, 75 g / L, 80 g / L, 90 g / L, 100 g / L, 110 g / L, 125 g / L, 130 g / L, 140 g / L, 150 g / L, or any wet weight within the range of 50-150 g / L. In some preferred embodiments, methanol induction is started when the wet weight of the recombinant cells is 100 g / L, 125 g / L, or 150 g / L.

[0096] During fermentation culture, methanol induction was performed when the wet weight of the recombinant cells was 50 g / L, and after fermentation, the polypeptide content in the fermentation broth was 6.12 g / L; methanol induction was performed when the wet weight of the recombinant cells was 75 g / L, and after fermentation, the polypeptide content in the fermentation broth was further increased to 8.23 ​​g / L; and when the wet weight of the recombinant cells was 100-125 g / L, methanol induction was performed, and after fermentation, the polypeptide content in the fermentation broth was at least as high as 11.84-12.15 g / L, and even as high as 13 g / L. Therefore, controlling the timing of methanol induction can significantly increase the amount of polypeptides finally obtained.

[0097] In some embodiments, the pH of the fermentation broth is adjusted to 5.5-6.0, 6.0-6.5 or 6.5-7.0 during methanol induction; in some embodiments, the pH of the fermentation broth is adjusted to 5.5, 6.0, 6.5 or 7.0 during methanol induction. In some preferred embodiments, the pH of the fermentation broth is adjusted to 6.0 or 6.5 during methanol induction. Under these conditions, after fermentation, the polypeptide content in the fermentation broth is at least as high as 10.65-11.24 g / L.

[0098] The polypeptide obtained in the present application was used to culture keratinocytes. The results showed that the cell viability of keratinocytes increased from 100% to 105.33-135.04% compared with the negative control; thus, it can be seen that the polypeptide of the present application can significantly improve the viability of keratinocytes. After the polypeptide of the present application was just added to the keratinocytes, the proliferation rate of the keratinocytes was as high as 116%-131%; after culturing for 24 hours, the proliferation rate of the keratinocytes was further increased to 155%-208%; and after culturing for 48 hours, the proliferation rate of the keratinocytes was significantly increased to 631%-891%. Thus, it can be seen that the polypeptide of the present application can exert its remarkable and excellent repair effect by significantly improving the cell viability and cell proliferation ability of keratinocytes.

[0099] The present application provides a use of the polypeptide for preparing a skin repair agent and / or cosmetics.

[0100] The present application provides a composition with repair efficacy, wherein the composition comprises the polypeptide.

[0101] The present application also provides a skin repair agent, which comprises the polypeptide and / or the composition.

[0102] It should be understood that the preparation form of the skin repair agent includes an external preparation; exemplary forms may be any one or more of liquid, emulsion, cream, powder, block and oil. In some embodiments, the skin repair agent further includes excipients; the excipients include any one or more of the group consisting of excipients, antibacterial agents, anti-inflammatory agents, antioxidants, propellants, whitening agents, thickeners, suspending agents, surfactants, acid-base regulators, complexing agents, pearlescent agents, astringents and aromatics. Example

[0103] The specific embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the specific embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided in order to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.

[0104] Example 1. Peptide

[0105] This example provides the following 8 polypeptides, namely polypeptide 1 to polypeptide 8, whose amino acid sequences are shown below:

[0106] Polypeptide 1, the amino acid sequence is shown in SEQ ID NO: 2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0107] Polypeptide 2, the amino acid sequence of which is shown in SEQ ID NO: 3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0108] Polypeptide 3, the amino acid sequence of which is shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK;

[0109] Polypeptide 4, the amino acid sequence of which is shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK;

[0110] Polypeptide 5, the amino acid sequence is shown in SEQ ID NO: 6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0111] Polypeptide 6, the amino acid sequence is shown in SEQ ID NO: 7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0112] Polypeptide 7, a polypeptide with an amino acid sequence as shown in SEQ ID NO: 8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK.

[0113] Polypeptide 8, a polypeptide having an amino acid sequence as shown in SEQ ID NO: 9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQ NKEVDEQMLNVQNK.

[0114] Example 2. Synthesis and identification of recombinant plasmids

[0115] 1. Synthesis of recombinant plasmid

[0116] This example is to construct a recombinant plasmid expressing polypeptide 4; wherein the amino acid sequence of polypeptide 4 is shown in SEQ ID NO:5:

[0117] EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK;

[0118] The gene sequence encoding polypeptide 4 is shown in SEQ ID NO: 10:

[0119] GAGGTCGACGAACAGATGTTAAACGTTCAAAATAAAGAAGTGGATGAGCAAATGTTGAATGTACAGAACAAGGAGGTGGACGAGCAGATGCTTAACGTTCAGAATAAAGAAGTTGATGAACAAATGCTAAACGTCCAAAATAAGGAAGTAGACGAGCAGATGCTGAACGTACAAAACAAGGAAGTCGATGAGCAGATGCTCAATGTGCAAAATAAATGA.

[0120] The construction of the recombinant plasmid was entrusted to Jiangsu GenScript Biotechnology Co., Ltd. for synthesis. The basic plasmid vector was pPIC9K vector (purchased from Thermo Fisher; geneJET plasmid mini kit, K0503) with a secretion signal peptide. The gene sequence encoding polypeptide 5 was directly connected to the secretion signal peptide to obtain a recombinant plasmid named pPIC9K recombinant plasmid. The plasmid map of the recombinant plasmid is shown in Figure 1 shown.

[0121] 2. Sequencing and identification of recombinant plasmids

[0122] The recombinant plasmid extraction and sequencing method is:

[0123] 1) Inoculate the pPIC9K recombinant plasmid into LB liquid culture medium, culture overnight at 220 rpm and 37°C, pour the bacterial solution into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, remove the supernatant medium, repeat the above steps 3 to 4 times, and enrich all the bacteria in the centrifuge tube.

[0124] 2) Recover the pPIC9K recombinant plasmid according to the instructions of the high-purity plasmid mini-extraction kit (Thermo Fisher, geneJET plasmid mini-extraction kit, K0503).

[0125] 3) Take 60 μL of the prepared 60℃ ddH2O, centrifuge at 12000rpm for 2.5min, collect the pPIC9K recombinant plasmid in a 1.5mL centrifuge tube, and perform DNA sequencing on the pPIC9K recombinant plasmid. The plasmid sequencing was commissioned by Shanghai Biotech for mass spectrometry detection. The test results are shown in Figure 2 ,The results showed that the target protein sequence was completely correct after plasmid synthesis.

[0126] Example 3. Construction and screening of recombinant cells

[0127] 1. Linearization of plasmid

[0128] 1) Prepare the vector enzyme digestion system according to Table 1.

[0129] Table 1 Vector restriction enzyme digestion system

[0130]

[0131] 2) Enzyme digestion at 37℃ overnight;

[0132] 3) Agarose gel electrophoresis detection, using the undigested plasmid as a control;

[0133] 4) After the enzyme digestion is successful, inactivate at 65°C for 20 min.

[0134] 2. Linearized plasmid purification and recovery

[0135] 1) Prepare the vector purification system according to Table 2.

[0136] Table 2 Vector purification system

[0137]

[0138] 2) Stand at -20℃ for more than 35 minutes;

[0139] 3) Centrifuge at 4°C, 12,000 rpm for 15 min, discard the supernatant, and a white precipitate can be observed on the wall;

[0140] 4) Add 400ul pre-cooled 80% ethanol to resuspend the precipitate;

[0141] 5) Centrifuge at 4°C, 12,000 rpm for 10 min, discard the supernatant, and dry the tube;

[0142] 6) Add 10ul ddH2O to dissolve the precipitate.

[0143] 3. Preparation of GS115 competent cells

[0144] 1) Streak the strain onto a YPD plate and culture at 30 degrees for 3-5 days until a single colony grows;

[0145] 2) Pick a single clone and transfer it to 10 mL YPD culture medium (125 mL conical flask), and culture at 30 degrees and 300 rpm for 1-2 days;

[0146] 3) Transfer to 100 mL YPD culture medium, the initial bacterial concentration is OD600 = 0.2, and culture at 30 degrees and 300 rpm for 1-2 days until OD 600 =1.3-1.5; (Note: when the OD value cannot be determined, transfer to different concentrations for culture);

[0147] 4) Centrifuge at 1500g for 5 min at 4°C to collect the bacterial strains, and add 250 mL of pre-cooled sterile water to resuspend the bacterial strains to wash the bacterial strains;

[0148] 5) Centrifuge at 1500g for 5 min at 4°C to collect the bacteria (adjust the deceleration damping to greater than 6), add 10 mL of pre-cooled 1 M sorbitol to resuspend the bacteria, and gently pipette during resuspending;

[0149] 6) Collect the bacteria by centrifugation at 1500g and 4℃ for 5min (adjust the speed reduction damping to greater than 6), add 300uL of pre-cooled 1M sorbitol to resuspend the bacteria, gently blow during resuspending, the final volume of the bacteria is about 500uL (in actual operation, the final volume of the bacteria is about 700uL), divide into 100uL per tube, and place on ice for electroporation.

[0150] 4. Electrical conversion

[0151] 1) Take 80ul competent cells, add 6ug linearized pPIC9K, mix well and transfer to a pre-cooled 0.2cm electroporation cuvette;

[0152] 2) Place on ice for 5 minutes;

[0153] 3) Electric shock according to the yeast electric shock parameter settings (1.5kV, 25uF, 200Ω);

[0154] 4) Immediately add 2 ml of pre-cooled 1M sorbitol + HEPES (10 ml 1M sorbitol + 100 ul 2M HEPES, pH = 8.0) and transfer to a 2 ml sterile centrifuge tube;

[0155] 5) Incubate at 30°C for 1-2 hours;

[0156] 6) After diluting 5-fold, 10-fold, and 100-fold, spread 300ul / plate on a 15cm YPD plate containing 100mg / l Zeocin, and culture at 30℃ until clones grow.

[0157] 5. Positive clone screening

[0158] 1) Use a 10uL pipette tip to streak the clones grown on the MD plate onto a 0.5mg / mL G418 plate and culture at 30°C for 3-5 days;

[0159] 2) Select clones with better growth and streak them onto 2 mg / mL and 4 mg / mL G418 plates at the same time, and culture at 30°C for 3-5 days;

[0160] 3) Try to select 5 clones that grow better on the 4 mg / mL G418 plate to try to induce expression. If the growth on the 4 mg / mL plate is poor, select the clones on the 2 mg / mL plate.

[0161] Example 4. Screening and preservation of pPIC9K recombinant cells

[0162] Select several recombinants (i.e., pPIC9K recombinant cells) on YPD plates containing G418 at concentrations of 4 g / L and 6 g / L, and inoculate them in 30 mL of BMGY liquid culture medium, respectively, and culture at 29°C and 220 rpm for 24 hours to prepare fermentation broth. The prepared fermentation broth was placed in a sterile centrifuge tube, centrifuged at 5000 r / min for 5 minutes, and the precipitate was taken and washed twice with sterile water to obtain the bacteria. The bacteria were resuspended in 30 mL of BMMY liquid culture medium, and cultured at 29°C for 4 days at a speed of 220 rpm. Methanol was added every 24 hours for induction, and each time it was added to a final concentration of 1% (v / v). After the induction, the supernatant was collected by centrifugation at 6000 r / min for 5 minutes for electrophoresis detection. The results are as follows Figure 4 As shown, the recombinant with good expression was selected for glycerol storage, and the storage condition was: -80℃ refrigerator for use.

[0163] The components and proportions of BMGY liquid culture medium are as follows: yeast powder 10.0 g / L, peptone 20.0 g / L, glycerol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 100 ml / L, 500*B 2 ml / L. B is a conventional reagent purchased from biosharp, item number BS905.

[0164] The components and proportions of BMMY medium are: yeast powder 10.0 g / L, peptone 20.0 g / L, methanol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 100 ml / L, 500*B 2 ml / L. Among them, B represents biotin, a conventional reagent.

[0165] Example 5. Shake flask culture and optimization of pPIC9K recombinant cells

[0166] The BMMY medium used in this embodiment is optimized. The components and ratios of the optimized BMMY medium in this embodiment are: yeast powder 10.0 g / L, peptone 20.0 g / L, methanol 10.0 ml / L, dipotassium hydrogen phosphate 1.08 g / L, potassium dihydrogen phosphate 4.25 g / L, ammonium sulfate 10 g / L, 10*YNB 25 ml / L, 500*B 2 ml / L.

[0167] The optimized cultivation method is:

[0168] 1) Inoculate 0.1 ml of the glycerol bacteria obtained in Example 5 into 50 ml of liquid BMGY medium, culture at 29° C., 220 rpm, and culture for 48 h;

[0169] 2) Take 5 ml of the first-stage shake flask and inoculate it in BMMY medium. Induce with methanol every 24 hours, and add it to a final concentration of 1% (v / v) each time. After 96 hours of induction, separate the solid and liquid, and perform electrophoresis detection. The electrophoresis results are as follows: Figure 5 shown.

[0170] Example 6-Example 9. Optimization of fermenter culture medium

[0171] In the following examples, unless otherwise specified, the BMGY medium formula and ratio are as follows: yeast powder 10.0 g / L, peptone 20.0 g / L, glycerol 10.0 ml / L, dipotassium hydrogen phosphate 1.8 g / L, potassium dihydrogen phosphate 7.08 g / L, 10*YNB 25 ml / L, 500*B 25 ml / L.

[0172] If there is no special explanation, the components and proportions of PTM1 are as follows: copper sulfate pentahydrate 6.0 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3.0 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, ferrous sulfate 65 g / L, biotin 0.2 g / L, and sulfuric acid 5 ml / L.

[0173] Example 6

[0174] The seed culture medium is BMGY medium, and the fermentation culture medium is BSM medium: potassium sulfate 18.20g / L, magnesium sulfate heptahydrate 14.90g / L, calcium sulfate dihydrate 0.93g / L, potassium hydroxide 4.13g / L, 85% phosphoric acid 26.70ml / L, ammonium sulfate 10.00g / L, glycerol 40.00g / L, bubo 0.10g / L, PTM1 4.35ml / L.

[0175] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust=5.0, adjust air flow to 10L / min, flame protection inoculation, inoculum size 10Vol.%, maintain pH=5.0 in the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen more than 30Vol.%, start feed supplement after glycerol consumption is complete (when dissolved oxygen rises), control flow adds 50% (m / v) glycerol (1L glycerol adds 12ml PTM1) to carry out feed supplement. When the cell wet weight reaches 100g / L, start starvation, starvation 2h carries out methanol (1L methanol adds 12ml PTM1) induction, add 35% (m / v) sorbitol simultaneously, the volume ratio of sorbitol and methanol is 1:5, induce 30h to put in the tank, use Coomassie brilliant blue method (Bradford method) to measure protein content after fermentation ends.

[0176] Example 7

[0177] The seed culture medium is BMGY medium, and the fermentation medium is BSM medium: potassium sulfate 12.74g / L, magnesium sulfate heptahydrate 10.43g / L, calcium sulfate dihydrate 0.65g / L, potassium hydroxide 2.89g / L, 85% phosphoric acid 18.69ml / L, ammonium sulfate 7.00g / L, glycerol 40.00g / L, bubo 0.10g / L, PTM1 4.35ml / L.

[0178] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust=5.0, adjust air flow to 10L / min, flame protection inoculation, inoculum size 10Vol.%, maintain pH=5.0 in the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen more than 30Vol.%, start feed supplement after glycerol consumption is complete (when dissolved oxygen rises), control flow adds 50% (m / v) glycerol (1L glycerol adds 12ml PTM1) to carry out feed supplement. When the cell wet weight reaches 100g / L, start starvation, starvation 2h carries out methanol (1L methanol adds 12ml PTM1) induction, add 35% (m / v) sorbitol simultaneously, the volume ratio of sorbitol and methanol is 1:5, induce 30h to put in the tank, use Coomassie brilliant blue method (Bradford method) to measure protein content after fermentation ends.

[0179] Example 8

[0180] The seed culture medium is BMGY medium, and the fermentation culture medium is BSM medium: potassium sulfate 9.10g / L, magnesium sulfate heptahydrate 7.45g / L, calcium sulfate dihydrate 0.47g / L, potassium hydroxide 2.07g / L, 85% phosphoric acid 13.4ml / L, ammonium sulfate 5.00g / L, glycerol 40.00g / L, bubo 0.10g / L, PTM1 4.35ml / L.

[0181] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust=5.0, adjust air flow to 10L / min, flame protection inoculation, inoculum size 10Vol.%, maintain pH=5.0 in the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen more than 30Vol.%, start feed supplement after glycerol consumption is complete (when dissolved oxygen rises), control flow adds 50% (m / v) glycerol (1L glycerol adds 12ml PTM1) to carry out feed supplement. When the cell wet weight reaches 100g / L, start starvation, starvation 2h carries out methanol (1L methanol adds 12ml PTM1) induction, add 35% (m / v) sorbitol simultaneously, the volume ratio of sorbitol and methanol is 1:5, induce 30h to put in the tank, use Coomassie brilliant blue method (Bradford method) to measure protein content after fermentation ends.

[0182] Example 9

[0183] The seed culture medium is BMGY medium, and the fermentation culture medium is BSM medium: potassium sulfate 5.46g / L, magnesium sulfate heptahydrate 4.47g / L, calcium sulfate dihydrate 0.28g / L, potassium hydroxide 1.24g / L, 85% phosphoric acid 8.01ml / L, ammonium sulfate 3.00g / L, glycerol 40.00g / L, bubo 0.10g / L, PTM1 4.35ml / L.

[0184] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust=5.0, adjust air flow to 10L / min, flame protection inoculation, inoculum size 10Vol.%, maintain pH=5.0 in the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen more than 30Vol.%, start feed supplement after glycerol consumption is complete (when dissolved oxygen rises), control flow adds 50% (m / v) glycerol (1L glycerol adds 12ml PTM1) to carry out feed supplement. When the cell wet weight reaches 100g / L, start starvation, starvation 2h carries out methanol (1L methanol adds 12ml PTM1) induction, add 35% (m / v) sorbitol simultaneously, the volume ratio of sorbitol and methanol is 1:5, induce 30h to put in the tank, use Coomassie brilliant blue method (Bradford method) to measure protein content after fermentation ends.

[0185] After fermentation, the protein expression levels of Example 6, Example 7, Example 8 and Example 9 were 5.83 g / L, 7.18 g / L, 10.68 g / L and 7.56 g / L, respectively, as shown in Table 3. The protein expression of Example 8 was the highest. Therefore, the culture medium of 10L fermenter was determined to be: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphoric acid 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubo 0.10 g / L, PTM 14.35 ml / L.

[0186] Table 3 Protein expression levels of Example 6, Example 7, Example 8 and Example 9

[0187]

[0188] Example 10-Example 14. Optimization of wet weight at the start of methanol induction

[0189] The following examples are mainly optimized for the wet weight of cells before methanol induction. In the following examples, unless otherwise specified, the components and proportions of the fermentation medium are the same as in Example 9, specifically: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphoric acid 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubo 0.10 g / L, PTM1 4.35 ml / L.

[0190] The components and proportions of PTM1 are: copper sulfate pentahydrate 6.0g / L, sodium iodide 0.08g / L, manganese sulfate monohydrate 3.0g / L, sodium molybdate dihydrate 0.2g / L, boric acid 0.02g / L, cobalt chloride 0.5g / L, ferrous sulfate 65g / L, biotin 0.2g / L, and sulfuric acid 5ml / L.

[0191] Example 10

[0192] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 50g / L, start starvation, starvation 2h for methanol (1L methanol plus 12ml PTM1) induction, add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after fermentation.

[0193] Embodiment 11

[0194] A 10L fermentation tank (Zhenjiang Dongfang) was selected, and the volume was 5L after high-pressure sterilization. Ammonia water was used to adjust pH=5.0, and the air flow rate was adjusted to 10L / min. Flame protection inoculation was used, and the inoculation amount was 10Vol.%. The pH was maintained at 5.0 during the entire fermentation stage. The stirring was controlled between 100-800rpm to maintain the dissolved oxygen at more than 30Vol.%. After the glycerol was consumed (when the dissolved oxygen rose), feeding was started, and 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) was added to the controlled flow. When the wet weight of the bacterial cell reached 75g / L, starvation began, and methanol (1L methanol plus 12ml PTM1) was induced for 2h. At the same time, 35% (m / v) sorbitol was added, and the volume ratio of sorbitol to methanol was 1:5. The tank was released after induction for 30h, and the protein content was measured after the fermentation was completed.

[0195] Example 12

[0196] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 100g / L, start starvation, starvation 2h for methanol (1L methanol plus 12ml PTM1) induction, add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after fermentation.

[0197] Embodiment 13

[0198] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 125g / L, start starvation, starvation 2h for methanol (1L methanol plus 12ml PTM1) induction, add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after fermentation.

[0199] Embodiment 14

[0200] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 150g / L, start starvation, starvation 2h for methanol (1L methanol plus 12ml PTM1) induction, add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after fermentation.

[0201] After the fermentation was completed, the protein expression levels of Examples 10 to 14 were measured, as shown in Table 4. The protein expression of Example 13 was the highest. Therefore, when the cell wet weight of the pPIC9K recombinant cells was 125 g / L, methanol induction was started.

[0202] Table 4 Protein expression concentration after methanol induction at different pPIC9K recombinant cell wet weights

[0203]

[0204]

[0205] Example 15-Example 18. Optimization of pH at the beginning of methanol induction

[0206] In the following examples, the pH of the fermentation broth before methanol induction is optimized. In the following examples, unless otherwise specified, the components and proportions of the fermentation medium are the same as in Example 9, specifically: potassium sulfate 9.10 g / L, magnesium sulfate heptahydrate 7.45 g / L, calcium sulfate dihydrate 0.47 g / L, potassium hydroxide 2.07 g / L, 85% phosphoric acid 13.4 ml / L, ammonium sulfate 5.00 g / L, glycerol 40.00 g / L, bubo 0.10 g / L, PTM1 4.35 ml / L.

[0207] The components and proportions of PTM1 are: copper sulfate pentahydrate 6.0g / L, sodium iodide 0.08g / L, manganese sulfate monohydrate 3.0g / L, sodium molybdate dihydrate 0.2g / L, boric acid 0.02g / L, cobalt chloride 0.5g / L, ferrous sulfate 65g / L, biotin 0.2g / L, and sulfuric acid 5ml / L.

[0208] Embodiment 15

[0209] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 125g / L, start starvation, adjust pH = 5.5 during the starvation stage, and induce methanol (1L methanol plus 12ml PTM1) for 2h, and add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after the fermentation ends.

[0210] Example 16

[0211] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 125g / L, start starvation, adjust pH = 6.0 during the starvation stage, and induce methanol (1L methanol plus 12ml PTM1) for 2h, and add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after the fermentation ends.

[0212] Embodiment 17

[0213] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 throughout the fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 125g / L, start starvation, adjust pH = 6.5 during the starvation stage, and induce methanol (1L methanol plus 12ml PTM1) for 2h, and add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after the fermentation ends.

[0214] Embodiment 18

[0215] Select 10L fermentation tank (Zhenjiang Dongfang), volume 5L after autoclaving, use ammonia water to adjust = 5.0, adjust air flow to 10L / min, flame protection inoculation, inoculation amount 10Vol.%, maintain pH = 5.0 during the whole fermentation stage, control stirring between 100-800rpm to maintain dissolved oxygen above 30Vol.%, start feeding after glycerol consumption is complete (when dissolved oxygen rises), control flow to add 50% (m / v) glycerol (1L glycerol plus 12ml PTM1) for feeding. When the wet weight of the bacterial cell reaches 125g / L, start starvation, adjust pH = 7.0 during the starvation stage, and induce methanol (1L methanol plus 12ml PTM1) for 2h, and add 35% (m / v) sorbitol at the same time, the volume ratio of sorbitol and methanol is 1:5, induce 30h and release the tank, and measure the protein content after the fermentation ends.

[0216] After the fermentation, the protein expression levels of Examples 15 to 18 were measured, as shown in Table 5. The protein expression of Example 17 was the highest. Therefore, when the pH of the fermentation broth was adjusted to 6.5, methanol induction was started. However, at pH = 6.5, there was protein degradation, while at pH = 6.0, the protein was not degraded and the protein expression level was also high.

[0217] Table 5 Protein expression concentration after methanol induction at different pH

[0218]

[0219] Example 19 and Example 20. Protein Purification

[0220] Fermentation was carried out according to the method of Example 16, and the protein in the fermentation broth was purified after fermentation.

[0221] Embodiment 19

[0222] Fermentation was performed using the method of Example 16, and the protein in the fermentation broth was purified after fermentation. The purification method is:

[0223] 1) The fermentation broth was subjected to solid-liquid separation at 6000 rpm, 10 min, and 4°C.

[0224] 2) Inactivate enzyme: Take the supernatant and inactivate enzyme in a water bath at 65°C (generally 60-70°C is acceptable) for 20 min (generally 10-60 min is acceptable).

[0225] 3) Ultrafiltration desalination: Shandong Bona organic membrane test machine is used, and the organic membrane selects the molecular retention capacity of 2000 Daltons for ultrafiltration desalination, and the conductivity is controlled to be below 1ms / cm.

[0226] 4) Membrane filtration: Add sodium dihydrogen phosphate to the above liquid to make the conductivity 2ms / cm, then use sodium hydroxide to adjust the pH to 6, and finally use a 0.45um membrane for filtration.

[0227] 5) Ion chromatography: Select Jiangsu Hanbang protein purification instrument, and select Hedera Q FF pre-packed column for chromatography column. A buffer: 20mM sodium dihydrogen phosphate, adjust pH=6.0 with sodium hydroxide, and filter with 0.45um membrane; B buffer: 20mM sodium dihydrogen phosphate, adjust pH=6.0 with sodium hydroxide, and filter with 0.45um membrane. Use A buffer to balance the column for 10 CV, and the loading speed is 2ml / min. After loading, use A buffer to rinse until the conductivity and pH are stable, and then use 5% B solution and 95% A solution for further absorption, 5-20% B is eluted as the target protein, and finally 100% B buffer is used for elution for 5CV, then washed with water for 10CV, washed with 0.5M sodium hydroxide for 3CV, and continued to wash with water for 10CV, and finally the column is stored in 20Vol.% ethanol.

[0228] 6) After ultrafiltration to remove salt, freeze-dry the protein.

[0229] 7) Protein purity determination method:

[0230] Mobile phase A: 1000 ml of purified water with 0.75‰ TFA; preparation method: 500 ml solution + 500 ml ultrapure water + 750 μL TFA, ultrasonic for 10 min to remove bubbles.

[0231] Mobile phase B: 1000 ml of 0.75‰ TFA in acetonitrile; preparation method: 500 ml solution + 500 ml acetonitrile + 750 μL TFA, ultrasonic for 10 min to remove bubbles.

[0232] Chromatographic conditions: Shim-pack Scepter C4: 4.6×250 mm, 5 μm, Flow rate: 1.0 ml / min; column temperature: 35°C; UV detector, detection wavelength: 220 nm; injection 50 μL, gradient conditions as shown in Table 6. The chromatogram of the product is as follows Figure 6 shown.

[0233] Table 6 Chromatographic elution program

[0234]

[0235] Embodiment 20

[0236] Fermentation was performed using the method of Example 16, and the protein in the fermentation broth was purified after fermentation. The purification method is:

[0237] 1) The fermentation broth was subjected to solid-liquid separation at 6000 rpm, 10 min, and 4°C.

[0238] 2) Inactivate enzyme: Take the supernatant and inactivate enzyme in a water bath at 65°C (generally 65-70°C is acceptable) for 20 min (generally 10-60 min is acceptable).

[0239] 3) Membrane filtration: Add sodium dihydrogen phosphate to the above liquid to make the conductivity 200ms / cm, then use sodium hydroxide to adjust the pH to 6, and finally use a 0.45um membrane for filtration.

[0240] 4) Hydrophobic chromatography: Select Jiangsu Hanbang protein purification instrument, and select Hedera Butyl 4FF for chromatography column. A buffer: 20mM sodium dihydrogen phosphate, 2M ammonium sulfate, use sodium hydroxide to adjust pH = 6.0, 0.45um membrane filtration; B buffer: 20mM sodium dihydrogen phosphate, use sodium hydroxide to adjust pH = 6.0, 0.45um membrane filtration. Use A buffer to balance the column for 10 CV, the loading speed is 2ml / min, and after the loading is completed, it is rinsed with A buffer until the conductivity and pH are stable, and then 5% B solution and 95% A solution are used for further absorption, 25-30% B is eluted as the target protein, and finally 100% B buffer is used for elution for 5CV, then washed with water for 10CV, washed with 0.5M sodium hydroxide for 3CV, and continued to wash with water for 10CV, and finally the column is stored in 20% ethanol.

[0241] 5) Ultrafiltration desalination: The eluted sample was ultrafiltered to remove salt through an organic membrane with a molecular cutoff of 2000 Daltons, and finally replaced with a phosphate buffer (20 mM sodium dihydrogen phosphate, pH=6.0 adjusted with sodium hydroxide, 0.45 um membrane filtration).

[0242] 6) Ion chromatography: Select Jiangsu Hanbang protein purification instrument, and select Hedera Q FF pre-packed column for chromatography column. A buffer: 20mM sodium dihydrogen phosphate, adjust pH=6.0 with sodium hydroxide, and filter with 0.45um membrane; B buffer: 20mM sodium dihydrogen phosphate, adjust pH=6.0 with sodium hydroxide, and filter with 0.45um membrane. Use A buffer to balance the column for 10 CV, and the loading speed is 2ml / min. After the loading, use A buffer to rinse until the conductivity and pH are stable, and then use 5% B solution and 95% A solution for further absorption, 5-20% B is eluted as the target protein, and finally 100% B buffer is used for elution for 5CV, then wash with water for 10CV, wash with 0.5M sodium hydroxide for 3CV, continue to wash with water for 10CV, and finally store the column in 20Vol.% ethanol.

[0243] 7) After ultrafiltration to remove salt, freeze-dry the protein.

[0244] 8) The purity determination method is the same as in Example 19.

[0245] The chromatogram of the product is Figure 7 shown.

[0246] Protein effect verification

[0247] Sea cucumber collagen has a better effect in promoting cell proliferation, which means that sea cucumber collagen has a repair effect; and to measure the cell proliferation effect, it is necessary to ensure that the drug concentration (i.e. the added concentration of sea cucumber collagen) is reasonable under a certain cell concentration to ensure the accuracy of the subsequent cell proliferation effect. Therefore, the following experiment was designed:

[0248] 1. Cell Viability Assay

[0249] 1.1 Cell viability experiment: Human keratinocytes in the logarithmic growth phase were collected and inoculated into 96-well plates after adjusting the cell density, with each well containing 100 μl of culture medium. After culturing in a carbon dioxide cell culture incubator for 24 hours, the culture medium was aspirated, the cells were washed twice with PBS buffer, and then the samples were grouped and dosed according to the concentrations of the samples in Table 7.

[0250] Table 7 Cell viability sample concentration design table

[0251]

[0252] 1.2 Grouping situation, see Table 8 for details.

[0253] Table 8 Grouping and drug concentration

[0254]

[0255] 1.3 Model drug administration: After drug addition, the cells were placed in a carbon dioxide cell culture incubator for 24 hours, and then the MTT cell viability test was performed, and the absorbance OD value was read at 490nm. The cell survival rate was calculated, and only cell culture medium was added to the blank well; three parallel samples were set for each sample, and the average and SD values ​​were calculated. The specific results are shown in Table 9 and Figure 8 Among them, when the added concentration of sea cucumber collagen is in the range of 0.156%-2.5%, the cell viability is higher. When low concentration of sea cucumber collagen is added, for example, 0.156%-0.313%, higher cell viability can be obtained.

[0256] Cell viability (%) = OD490 of sample group / OD490 of negative control group × 100%.

[0257] Table 9 Cell viability after adding different concentrations of sea cucumber collagen obtained in Example 19 to the cell samples and culturing the cells for 24 hours

[0258]

[0259]

[0260] from Figure 8 As can be seen from the results in Table 9, the cell density was adjusted to a certain level, three 96-well plates were re-plated and three sample concentrations with cell viability ≥ 90% in the same group (i.e., three sea cucumber collagen addition concentrations, see Table 10, respectively (%, m / v): 0.300%, 0.110% and 0.050%) were added.

[0261] 1.4 Cell proliferation assay

[0262] After obtaining the sea cucumber protein addition concentration that resulted in higher cell viability, the effect of sea cucumber collagen on cell proliferation was further verified.

[0263] Adjust to a certain cell density, re-lay 3 96-well plates and add samples at 3 sample concentrations with cell viability ≥ 90% in the same group. After adding samples, place in an incubator and culture for 0h, 24h, and 48h. At the same time, perform MTT cell viability detection and calculate the relative cell proliferation rate at 0h, 24h, and 48h. Specific results are shown in Table 10. Comparing the sample group with the positive control, it was found that when the dosage was 0.300% and 0.110%, it had the effect of promoting cell proliferation; and when the dosage was 0.300%, the effect was better.

[0264] Relative cell proliferation rate (%) = OD490 of sample group / OD490 of negative control group × 100%.

[0265] Table 10 Relative cell proliferation rate after adding different amounts of sea cucumber collagen obtained in Example 19 to the cells for 0, 24 and 48 hours

[0266]

[0267] The description of the present disclosure is given for the purpose of illustration and description, and is not intended to be exhaustive or to limit the present disclosure to the disclosed form. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present disclosure, and to enable those of ordinary skill in the art to understand the present disclosure and thereby design various embodiments with various modifications suitable for specific uses.

Claims

1. A polypeptide with repairing effect, the polypeptide contains the following amino acid sequence: (EVDEQMLNVQNK) n , where n is 3, 4, 5, 6, 7, 8, 9 or 10.

2. The polypeptide according to claim 1, wherein the polypeptide is selected from any one or more of the following: n is 3, and the amino acid sequence is the polypeptide shown in SEQ ID NO: 2: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; n is 4, and the amino acid sequence is a polypeptide as shown in SEQ ID NO: 3: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; n is 5, and the amino acid sequence is the polypeptide shown in SEQ ID NO:4: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNK; n is 6, and the amino acid sequence is the polypeptide shown in SEQ ID NO:5: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; n is 7, and the amino acid sequence is the polypeptide shown in SEQ ID NO:6: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; n is 8, and the amino acid sequence is a polypeptide as shown in SEQ ID NO:7: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNK; n is 9, and the amino acid sequence is a polypeptide as shown in SEQ ID NO:8: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; n is 10, and the amino acid sequence is the polypeptide shown in SEQ ID NO:9: EVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQ MLNVQNKEVDEQMLNVQNKEVDEQMLNVQNKEVDEQMLNVQNK; and a polypeptide having an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to any one of SEQ ID NO:2 to SEQ ID NO:9; Preferably, the polypeptide is a polypeptide whose amino acid sequence is as shown in SEQ ID NO:5; and / or a polypeptide whose amino acid sequence is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identical to SEQ ID NO:

6.

3. The polypeptide according to claim 2, wherein the gene sequence encoding the polypeptide as shown in SEQ ID NO:5 is as shown in SEQ ID NO:10; and / or has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100% identity with SEQ ID NO:

10.

4. The polypeptide according to claim 2 or 3, wherein the polypeptide is a natural polypeptide or a genetically recombinant polypeptide; Preferably, the polypeptide is sea cucumber collagen; Preferably, the method for preparing the genetically recombinant polypeptide comprises: Recombining the gene encoding the polypeptide into the basic plasmid to obtain a recombinant plasmid; Transducing the recombinant plasmid into a host cell to obtain a recombinant cell; The recombinant cells are cultured and the polypeptide is isolated from the culture fluid.

5. The polypeptide according to claim 4, wherein the basic plasmid is selected from any one or more of a pPIC9K vector, a pPIC9 vector, a pPIC9K-His vector and a pPIC3.5K vector; And / or, the host cell is selected from any one or more of Pichia pastoris GS115, Pichia pastoris MG1003, Pichia pastoris KM71 and Pichia pastoris SMD1168.

6. The polypeptide according to claim 4 or 5, wherein the culturing of the recombinant cell comprises seed culturing; The seed culture medium is selected during the seed culture; The seed culture medium is selected from any one or more of BMGY medium, MGY medium, MGYH medium, RD medium, RDH medium, MD medium, MDH medium, SOC medium and YPD medium; and / or, culturing the recombinant cell comprises fermentation culturing; The fermentation culture medium is selected during the fermentation culture; The fermentation medium is selected from any one or more of BSM medium, BMMY medium and BMM medium; Preferably, the fermentation medium is BSM medium.

7. The polypeptide according to claim 6, wherein the fermentation culture comprises methanol induction; Methanol induction was started when the wet weight of the recombinant cells was 50-150 g / L, 50-75 g / L, 75-150 g / L, or 100-150 g / L; And / or, during methanol induction, the pH of the fermentation broth is adjusted to 5.5-7.0; preferably 6.0-6.5; And / or, the method for separating the polypeptide from the culture medium comprises any one or more of solid-liquid separation, chromatography and dialysis; Preferably, the solid-liquid separation method includes any one or more of centrifugation, microfiltration, suction filtration, and ultrafiltration; Preferably, the chromatography includes any one or more of ion chromatography and hydrophobic chromatography.

8. Use of the polypeptide according to any one of claims 1 to 7 for preparing a skin repair agent and / or cosmetics.

9. A composition with repair efficacy, comprising the polypeptide according to any one of claims 1 to 7.

10. A skin repairing agent, comprising the polypeptide according to any one of claims 1 to 7 and / or the composition according to claim 9.

Images