Therapeutic preparation for improving nerve injury repair capability of neural stem cells

Abstract

The invention provides a therapeutic preparation for improving the nerve injury repair capacity of neural stem cells, and belongs to the technical field of neurobiology. The therapeutic preparation provided by the invention aims to improve the survival rate and neural differentiation capacity of neural stem cells during hypoxia treatment through two-stage pretreatment. The treatment preparation consists of a pretreatment culture medium 1 and a pretreatment culture medium 2, wherein the pretreatment culture medium 1 comprises a basic culture medium, N-acetylcysteine, Kunyuenin-1 polypeptide, an epidermal growth factor and a basic fibroblast growth factor; the pretreatment culture medium 2 comprises a basic culture medium, ligustrazine, astragalus polysaccharide and brain-derived neurotrophic factors. Experimental results show that the therapeutic preparation improves the survival rate of the neural stem cells in an anoxic environment and the expression level of a neural differentiation marker gene, and the effect of the therapeutic preparation is superior to that of single-stage treatment or direct mixing treatment, so that the neural stem cells can better realize damage repair of a nervous system.

Description

Technical Field

[0001] The invention belongs to the technical field of neurobiology, and in particular relates to a therapeutic preparation for improving the nerve damage repairing ability of neural stem cells. Background Art

[0002] Neural stem cells (NSCs) are special cells with self-renewal and multidirectional differentiation potential. They can differentiate into cell types such as neurons, astrocytes and oligodendrocytes, and therefore have important potential in neural repair. In recent years, the role of neural stem cells in the repair of central nervous system injuries has received widespread attention, especially in the fields of stroke, spinal cord injury, and neurodegenerative diseases. However, a major obstacle faced by neural stem cells in clinical applications is their limited function, especially in the harsh environment of the lesion area, where they show a significant decrease in repair ability.

[0003] In the pathological environment of nerve damage or degenerative diseases, hypoxia is often accompanied, and hypoxia can significantly inhibit the proliferation and differentiation ability of neural stem cells. In addition, the hypoxic environment can also lead to impaired mitochondrial function, energy metabolism disorders, and increased oxidative stress levels, thereby further reducing the survival rate and differentiation ability of neural stem cells. These factors make it difficult for neural stem cells to fully exert their repair function, limiting their application prospects in clinical treatment. Therefore, it is of great significance to develop a therapeutic preparation that can specifically improve the survival and differentiation ability of neural stem cells in a hypoxic environment. Summary of the invention

[0004] The purpose of the present invention is to provide a therapeutic preparation for improving the nerve damage repair ability of neural stem cells, so that the neural stem cells can better repair nerve damage diseases.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides a therapeutic preparation for improving the ability of neural stem cells to repair nerve damage in an oxygen-deficient environment, the therapeutic preparation comprising a pretreatment medium 1 and a pretreatment medium 2;

[0007] The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor;

[0008] The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

[0009] Preferably, the basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine;

[0010] The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

[0011] Preferably, the improving the ability of neural stem cells to repair nerve damage in an oxygen-deficient environment is to improve the proliferation and neural differentiation ability of neural stem cells in an oxygen-deficient environment to achieve nerve repair;

[0012] The anoxic environment is 94% N2, 5% CO2, and 1% O2.

[0013] Preferably, the pretreatment medium 1 consists of a basal medium, 7.5 mM N-acetylcysteine, 75 μg / mL Kunyuenin-1 polypeptide, 15 ng / mL epidermal growth factor and 15 ng / mL basic fibroblast growth factor;

[0014] The pretreatment medium 2 consists of a basal medium, 30 μM ligustrazine, 125 μg / mL astragalus polysaccharide and 15 ng / mL brain-derived neurotrophic factor.

[0015] At the same time, the present invention provides a method for improving the survival and differentiation ability of neural stem cells under hypoxic environment, the method comprising the following steps:

[0016] (1) Inoculating neural stem cells into a cell culture plate, placing it in a cell culture incubator, and culturing the neural stem cells until they are completely attached to the plate;

[0017] (2) Remove the culture medium, replace it with pretreatment medium 1, and culture in a cell culture incubator for 12 h;

[0018] (3) removing pretreatment medium 1, adding pretreatment medium 2, and culturing in an incubator for 12 h, thereby improving the survival and differentiation ability of neural stem cells in a hypoxic environment;

[0019] The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor;

[0020] The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

[0021] Preferably, the basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine;

[0022] The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

[0023] Preferably, the pretreatment medium 1 consists of a basal medium, 7.5 mM N-acetylcysteine, 75 μg / mL Kunyuenin-1 polypeptide, 15 ng / mL epidermal growth factor and 15 ng / mL basic fibroblast growth factor;

[0024] The pretreatment medium 2 consists of a basal medium, 30 μM ligustrazine, 125 μg / mL astragalus polysaccharide and 15 ng / mL brain-derived neurotrophic factor.

[0025] Preferably, the conditions of the anoxic treatment are 94% N2, 5% CO2, 1% O2;

[0026] The normal culture medium consisted of Neurobasal medium, 2% B27 supplement and 1% L-glutamine or Neurobasal medium and 10% FBS.

[0027] At the same time, the present invention provides an application of a pretreatment medium combination in the preparation of a preparation for improving the hypoxia tolerance of neural stem cells, wherein the pretreatment medium combination consists of a pretreatment medium 1 and a pretreatment medium 2;

[0028] The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor;

[0029] The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

[0030] Preferably, the basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine;

[0031] The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

[0032] The beneficial effects of the present invention are:

[0033] The present invention improves the antioxidant and proliferation properties of neural stem cells and enhances the hypoxia adaptability of neural stem cells by pre-treating the medium 1 in the first stage, and improves the neural differentiation ability of neural cells by pre-treating the medium 2 in the second stage. The synergistic effect of the two stages effectively avoids the signal interference problem of direct mixing treatment and realizes the maximization of cell protection and function optimization.

[0034] Moreover, the pretreatment culture medium of the present invention synergistically improves the proliferation and neural differentiation ability of neural stem cells in an oxygen-deficient environment through key components such as Kunyuenin-1 polypeptide, ligustrazine, astragalus polysaccharide, and N-acetylcysteine, so that the neural stem cells can better repair the damage of the nervous system. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The survival rates of neural stem cells treated with different pretreatment methods in hypoxia are different;

[0036] Figure 2 The difference of Tubb3 gene expression in neural stem cells treated with different pretreatment methods after hypoxia.

[0037] Figure 3 The difference in Neurogenin1 gene expression in neural stem cells after hypoxia treatment after different pretreatment methods. DETAILED DESCRIPTION

[0038] The essential contents of the present invention are further illustrated by the following embodiments, but the contents of the present invention are not limited thereto.

[0039] Example 1

[0040] This embodiment 1 provides a therapeutic preparation for improving the neural repair ability of neural stem cells. The therapeutic preparation 1 is composed of a pretreatment medium 1 and a pretreatment medium 2:

[0041] Pretreatment medium 1 consisted of basal medium: Neurobasal medium, 2% B27 supplement, 1% L-glutamine;

[0042] Added ingredients: 10 mM N-acetylcysteine, 50 ug / ml Kunyuenin-1 peptide (Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2), 20 ng / mL epidermal growth factor and 10 ng / mL basic fibroblast growth factor;

[0043] Pretreatment medium 2 consisted of basal medium: Neurobasal medium, 2% B27 supplement, 1% L-glutamine;

[0044] Added ingredients: 20μM ligustrazine, 150μg / mL astragalus polysaccharide (CAS: 89250-26-0), and 20ng / mL brain-derived neurotrophic factor.

[0045] Example 2

[0046] This embodiment 2 provides a therapeutic preparation for improving the neural repair ability of neural stem cells, the therapeutic preparation is composed of pretreatment medium 1 and pretreatment medium 2:

[0047] Pretreatment medium 1 consists of basal medium: Neurobasal medium;

[0048] Added ingredients: 2% B27 supplement, 1% L-glutamine, 5mM N-acetylcysteine, 100ug / ml Kunyuenin-1 peptide, 10ng / mL epidermal growth factor and 20ng / mL basic fibroblast growth factor;

[0049] Pretreatment medium 2 consisted of basal medium: Neurobasal medium;

[0050] Added ingredients: 2% B27 supplement, 1% L-glutamine, 40μM ligustrazine, 100μg / mL astragalus polysaccharide, 10ng / mL brain-derived neurotrophic factor.

[0051] Example 3

[0052] This embodiment 3 provides a therapeutic preparation for improving the neural repair ability of neural stem cells. The therapeutic preparation 3 is composed of a pretreatment medium 1 and a pretreatment medium 2:

[0053] Pretreatment medium 1 consists of basal medium: Neurobasal medium;

[0054] Added ingredients: 2% B27 supplement, 1% L-glutamine, 7.5mM N-acetylcysteine, 75ug / ml Kunyuenin-1 peptide, 15ng / mL epidermal growth factor and 15ng / mL basic fibroblast growth factor;

[0055] Pretreatment medium 2 consisted of basal medium: Neurobasal medium;

[0056] Added ingredients: 2% B27 supplement, 1% L-glutamine, 30μM ligustrazine, 125μg / mL astragalus polysaccharide, 15ng / mL brain-derived neurotrophic factor.

[0057] Example 4

[0058] Detect the difference in survival of neural stem cells in hypoxia after different pretreatment methods

[0059] 1. Inoculate mouse neural stem cells C17.2 into 96-well plates, and then pre-treat the cells according to the following experimental groups. Each treatment has 5 replicate wells. After the cells are completely attached to the plate, perform subsequent treatments:

[0060] Group a of Example: first treated with the pretreatment medium 1 of Example 1 for 12 h, and then treated with the pretreatment medium 2 of Example 1 for 12 h;

[0061] Group b of Example: first treated with the pretreatment medium 1 of Example 2 for 12 h, and then treated with the pretreatment medium 2 of Example 2 for 12 h;

[0062] Group c of Example: first treated with the pretreatment medium 1 of Example 3 for 12 h, and then treated with the pretreatment medium 2 of Example 3 for 12 h;

[0063] Comparative Example Group a: only Neurobasal medium containing 2% B27 supplement and 1% L-glutamine was added;

[0064] Comparative Example Group B: Only the pretreatment medium 1 of Example 3 was used for treatment for 24 h;

[0065] Comparative Example C group: treated with only the pretreatment medium 2 of Example 3 for 24 h;

[0066] Comparative Example Group D: The pretreatment medium 1 and pretreatment medium 2 of Example 3 were directly mixed and treated for 24 hours;

[0067] Comparative Example e group: first treated with the pretreatment medium 1 of Example 3 for 12 hours (pretreatment medium 1 lacks Kunyuenin-1 polypeptide), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (pretreatment medium 2 lacks ligustrazine);

[0068] Comparative Example Group f: first treated with the pretreatment medium 1 of Example 3 for 12 hours (pretreatment medium 1 lacked Kunyuenin-1 polypeptide), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (pretreatment medium 2 lacked astragalus polysaccharide);

[0069] Comparative Example G group: first treated with the pretreatment medium 1 of Example 3 for 12 hours (pretreatment medium 1 lacks N-acetylcysteine), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (pretreatment medium 2 lacks brain-derived neurotrophic factor).

[0070] 2. After pretreatment, the cells were replaced with Neurobasal medium containing 2% B27 supplement and 1% L-glutamine, and subjected to hypoxia treatment (94% N2, 5% CO2, 1% O2), and a blank control group without hypoxia treatment was set up;

[0071] 3. After 24 h of hypoxia treatment, remove the culture medium, add 200 μL MTT, and place in the incubator for 4 h;

[0072] 4. Add 200 μL DMSO to each well and fully dissolve it at room temperature. Then use an enzyme reader to measure the absorbance at 570 nm.

[0073] Table 1 Differences in survival of neural stem cells in hypoxia after different pretreatment methods

[0074]

[0075] Table 1 and Figure 1 The results show the differences in the survival of neural stem cells treated with different pretreatment methods in hypoxic environment. The following conclusions can be drawn from the experimental results:

[0076] Compared with the blank control group, the cell survival rate of comparison group a was significantly decreased, indicating that cells treated with basal culture medium were difficult to provide protection in a hypoxic environment.

[0077] Compared with the comparative example a group, the example a group, b group and c group all adopted a two-stage pretreatment method, and the average absorbance values ​​were 0.794, 0.783 and 0.852, respectively, which were significantly higher than all the comparative example groups, indicating that the two-stage pretreatment had a significant effect on improving the cell hypoxia tolerance. Among them, the absorbance of the example c group was the highest (0.852), indicating that its pretreatment scheme had the best effect in improving the hypoxic survival of neural stem cells.

[0078] Comparative Example Groups b and c were treated with the single pretreatment medium of Example 3, and the absorbances were 0.499 and 0.488, respectively, which were significantly lower than that of the Example Group, indicating that the single pretreatment medium was not sufficient to effectively improve the hypoxia tolerance of cells.

[0079] The comparative example d group was treated with a direct mixture of pretreatment medium 1 and 2 of Example 3, and the absorbance was 0.622. Although it was higher than that of a single pretreatment medium, the effect was still not as good as that of the example group with staged pretreatment. This may be because when pretreatment was performed at the same time, too many components led to competition or antagonism in signal pathways, thereby weakening the effects of some functional components.

[0080] The absorbances of the comparative examples e, f and g groups (0.493, 0.483 and 0.532) were significantly lower than those of the example group, indicating that key components (such as Kunyuenin-1 polypeptide, ligustrazine, N-acetylcysteine, BDNF, etc.) are indispensable in the pretreatment process, and their absence will significantly weaken the protective effect of pretreatment on neural stem cells.

[0081] Example 5

[0082] Detect the differences in cell differentiation performance of neural stem cells treated with different pretreatment methods under hypoxia

[0083] Experimental grouping

[0084] 1. Mouse neural stem cells C17.2 were seeded into 6-well plates, and then the cells were pretreated according to the following experimental groups, with 3 replicate wells for each treatment:

[0085] Group a of Example: first treated with the pretreatment medium 1 of Example 1 for 12 h, and then treated with the pretreatment medium 2 of Example 1 for 12 h;

[0086] Group b of Example: first treated with the pretreatment medium 1 of Example 2 for 12 h, and then treated with the pretreatment medium 2 of Example 2 for 12 h;

[0087] Group c of Example: first treated with the pretreatment medium 1 of Example 3 for 12 h, and then treated with the pretreatment medium 2 of Example 3 for 12 h;

[0088] Comparative Example Group a: only Neurobasal medium containing 2% B27 supplement and 1% L-glutamine was added;

[0089] Comparative Example Group B: Only the pretreatment medium 1 of Example 3 was used for treatment for 24 h;

[0090] Comparative Example C group: treated with only the pretreatment medium 2 of Example 3 for 24 h;

[0091] Comparative Example Group D: The pretreatment medium 1 and pretreatment medium 2 of Example 3 were directly mixed and treated for 24 hours;

[0092] Comparative Example e group: first treated with the pretreatment medium 1 of Example 3 for 12 hours (the pretreatment medium 1 lacked Kunyuenin-1 polypeptide), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (the pretreatment medium lacked ligustrazine);

[0093] Comparative Example Group f: first treated with the pretreatment medium 1 of Example 3 for 12 hours (the pretreatment medium 1 lacked Kunyuenin-1 polypeptide), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (the pretreatment medium lacked astragalus polysaccharide);

[0094] Comparative Example G group: first treated with the pretreatment medium 1 of Example 3 for 12 hours (pretreatment medium 1 lacks N-acetylcysteine), and then treated with the pretreatment medium 2 of Example 3 for 12 hours (pretreatment medium lacks brain-derived neurotrophic factor).

[0095] 2. After pretreatment, the pretreated cells were replaced with Neurobasal medium containing 10% FBS and subjected to hypoxia treatment (94% N2, 5% CO2, 1% O2). A blank control group (21% O2, 5% CO2) without hypoxia treatment was set up.

[0096] 3. After 24 hours of hypoxia treatment, the cells were taken out and placed in a cell culture incubator (21% O2, 5% CO2) for normal culture for 48 hours.

[0097] RNA extraction

[0098] 1. After the culture is completed, take out the 6-well plate, discard the culture medium, and gently rinse the cells twice with RNase-free PBS.

[0099] 2. Add 500 μL RNA extraction reagent to each well and pipette the cells to ensure complete cell lysis.

[0100] 3. Add 200 μL of chloroform, mix thoroughly, let stand at room temperature for 5 minutes, and centrifuge at 12,000 rpm for 15 minutes at 4°C.

[0101] 4. Collect the supernatant, transfer to a new EP tube, add an equal volume of isopropanol, mix gently, let stand at room temperature for 10 minutes, and centrifuge at 12000 rpm for 10 minutes at 4°C.

[0102] 5. Discard the supernatant, retain the precipitate, add 75% RNase-free ethanol, mix gently, and centrifuge at 7500 rpm for 5 minutes at 4°C;

[0103] 6. Discard the supernatant, air-dry the precipitate, add 30-50 μL of RNase-free water, gently pipette to mix, ensure that the RNA is completely dissolved, use a spectrophotometer to detect the RNA concentration, and then proceed with subsequent experiments.

[0104] Detection of the expression of neural transformation marker genes Tubb3 and Neurogenin1 by fluorescence quantitative PCR

[0105] 1. Use Takara reverse transcription kit to reverse transcribe the obtained RNA into cDNA.

[0106] 2. Configure the qPCR reaction system as follows (total volume 20 μL):

[0107] cDNA template: 2 μL, forward primer: 0.5 μL (10 μM), reverse primer: 0.5 μL (10 μM), SYBR Green qPCR mixture: 10 μL, add nuclease-free water to 20 μL.

[0108] Among them, the primer sequences involved are as follows:

[0109] Table 2 Primer sequences involved in detection

[0110] Gene name Primer sequence (5'-3') Tubb3 gene forward primer TCAAGGTAGCCGTGTGTGAC Tubb3 gene reverse primer GCTCCGAGATGCGTTTGAAC Neurogenin1 gene forward primer GACAGCCCTTCTCCACCTTC Neurogenin1 gene reverse primer CTGCCAGTAGTCCACGTCTG β-actin gene forward primer TACTGCTCTGGCTCCTAGCA β-actin gene reverse primer CGGACTCATCGTACTCCTGC

[0111] 3. Set the qPCR reaction program: 95°C, 10 min (initial denaturation); 95°C, 15 s (denaturation), 60°C, 30 s (annealing), 72°C, 30 s (extension), and repeat 40 cycles.

[0112] 4. The ΔΔCt method was used to analyze the relative expression levels of Tubb3 and Neurogenin1.

[0113] Table 3 Differentiation effect of neural stem cells after hypoxia treatment after different pretreatment methods

[0114]

[0115]

[0116] From the results in Table 3, it can be seen that the expression levels of Tubb3 and Neurogenin1 genes in the comparative example group a were 0.37±0.04 and 0.45±0.03, respectively, indicating that hypoxia treatment significantly inhibits the ability of neural stem cells to differentiate into neural cells.

[0117] Compared with the comparative example a group, the expression levels of Tubb3 and Neurogenin1 in the example c group were 0.86±0.04 and 0.88±0.04, respectively, which were the highest among all hypoxia-treated groups; in the example a group and the example b group, the expression levels of Tubb3 and Neurogenin1 were slightly lower than those in the example c group, but still significantly higher than those in all comparative example groups, in the range of 0.75-0.81, respectively. This result shows that the method of treating in stages using the pretreatment medium composed of different components adopted by the present invention can significantly enhance the tolerance of neural stem cells in a hypoxic environment, thereby maintaining the neural differentiation potential of neural stem cells.

[0118] For the comparative examples b, c and d, which only used a single pretreatment medium and were directly mixed without stage treatment, the expression levels of Tubb3 and Neurogenin1 were in the range of 0.41-0.66, respectively. Although better than the comparative example a, there was still a large difference compared with the embodiment. Among them, the effect of the comparative example d group shows that directly mixing the pretreatment medium 1 and the pretreatment medium 2 cannot fully exert the synergistic effect of the two, so it is an indispensable step to treat the pretreatment medium 1 and the pretreatment medium 2 in stages.

[0119] For the control groups e, f and g, the expression levels of Tubb3 and Neurogenin1 were all in the range of 0.45-0.54, indicating that when pretreatment medium 1 and pretreatment medium 2 lack key components (such as Kunyuenin-1 polypeptide, ligustrazine or BDNF), the synergy between the two cannot be effectively exerted.

[0120] In general, the dual-stage pretreatment strategy of pretreatment medium 1 and pretreatment medium 2 adopted by the present invention synergistically activates the cell protection mechanism and differentiation promotion mechanism, significantly improving the survival rate and neural differentiation efficiency of NSCs in hypoxic environment. Therefore, the dual-stage pretreatment scheme shows significant advantages in optimizing the hypoxia tolerance and differentiation potential of neural stem cells, providing a solid experimental basis and scientific support for the development of neural repair therapeutic preparations.

Claims

1. A therapeutic preparation for improving the ability of neural stem cells to repair nerve damage in an oxygen-deficient environment, characterized in that: The therapeutic preparation consists of pretreatment medium 1 and pretreatment medium 2; The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor; The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

2. The therapeutic preparation according to claim 1, characterized in that The basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine; The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

3. The therapeutic preparation according to claim 2, characterized in that Improving the ability of neural stem cells to repair nerve damage in an oxygen-deficient environment is to improve the proliferation and neural differentiation ability of neural stem cells in an oxygen-deficient environment to achieve nerve repair; The anoxic environment is 94% N2, 5% CO2, and 1% O2.

4. The therapeutic preparation according to claim 3, characterized in that The pretreatment medium 1 consists of a basal medium, 7.5 mM N-acetylcysteine, 75 μg / mL Kunyuenin-1 polypeptide, 15 ng / mL epidermal growth factor and 15 ng / mL basic fibroblast growth factor; The pretreatment medium 2 consists of a basal medium, 30 μM ligustrazine, 125 μg / mL astragalus polysaccharide and 15 ng / mL brain-derived neurotrophic factor.

5. A method for improving the survival and differentiation ability of neural stem cells in an oxygen-deficient environment, characterized in that: The method comprises the following steps: (1) Inoculating neural stem cells into a cell culture plate, placing it in a cell culture incubator, and culturing the neural stem cells until they are completely attached to the plate; (2) Remove the culture medium, replace it with pretreatment medium 1, and culture in a cell culture incubator for 12 h; (3) removing pretreatment medium 1, adding pretreatment medium 2, and culturing in an incubator for 12 h, thereby improving the survival and differentiation ability of neural stem cells in a hypoxic environment; The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor; The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

6. The method according to claim 5, characterized in that The basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine; The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

7. The method according to claim 6, characterized in that The pretreatment medium 1 consists of a basal medium, 7.5 mM N-acetylcysteine, 75 μg / mL Kunyuenin-1 polypeptide, 15 ng / mL epidermal growth factor and 15 ng / mL basic fibroblast growth factor; The pretreatment medium 2 consists of a basal medium, 30 μM ligustrazine, 125 μg / mL astragalus polysaccharide and 15 ng / mL brain-derived neurotrophic factor.

8. The method according to claim 7, characterized in that The conditions of the anoxic treatment are 94% N2, 5% CO2, 1% O2; The common culture medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine or Neurobasal medium and 10% FBS.

9. Use of a pretreatment culture medium combination in preparing a preparation for improving the hypoxia tolerance of neural stem cells, characterized in that: The pretreatment medium combination consists of pretreatment medium 1 and pretreatment medium 2; The pretreatment medium 1 is composed of a basal medium, 5-10 mM N-acetylcysteine, 50-100 μg / mL Kunyuenin-1 polypeptide, 10-20 ng / mL epidermal growth factor and 10-20 ng / mL basic fibroblast growth factor; The pretreatment medium 2 consists of a basic medium, 20-40 μM ligustrazine, 100-150 μg / mL astragalus polysaccharide and 10-20 ng / mL brain-derived neurotrophic factor.

10. The use according to claim 9, characterized in that: The basal medium consists of Neurobasal medium, 2% B27 supplement and 1% L-glutamine; The amino acid sequence of the Kunyuenin-1 polypeptide is Phe-Leu-Pro-Phe-Phe-Ala-Ala-Cys-Ala-Ile-Thr-Arg-Lys-Cys-CONH2.

Images