A peanut seed-specific gene promoter YW4YDB and its application

Abstract

The present invention provides a peanut seed-specific gene promoter YW4YDB and its application, and relates to the technical field of plant genetic engineering. The peanut seed-specific gene promoter YW4YDB is selected from any one of SEQIDNO.01, SEQIDNO.01, a DNA or RNA sequence hybridizing with a sequence of SEQIDNO.01 or SEQIDNO.02, a sequence having at least 95% sequence identity with a sequence described in SEQIDNO.01 or SEQIDNO.02, and a DNA or RNA sequence complementary to any sequence described in SEQID NO.01 or SEQIDNO.02. The present invention overcomes the shortcomings of the prior art, and utilizes the peanut seed-specific gene promoter YW4YDB to drive the expression of the HCMV glycoprotein B gene in peanut seed tissue cells, thereby realizing the expression of the HCMV glycoprotein B gene in peanut seed tissue cells, thereby efficiently producing the HCMV glycoprotein B antigen vaccine.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a peanut seed specific gene promoter YW4YDB and an application thereof. Background Art

[0002] With the rapid development of pharmaceutical technology and genetic engineering technology, in order to meet the low cost and high efficiency in biosynthesis fields such as drug production, plant, animal or microbial cells are used as reactors for genetic modification and gene transformation to efficiently produce heterologous proteins. They are often used in the production of products such as medicinal proteins, antigens and vaccines, and in the cultivation of new varieties of crops with high nutritional value, high active ingredient content or other excellent traits.

[0003] Crops bred through genetic engineering can have a variety of excellent traits that are difficult to obtain or stabilize through conventional breeding models, or enhance the expression of various traits themselves, thereby obtaining new crop varieties with excellent disease and pest resistance, lodging resistance, herbicide resistance, high nutritional value, high active ingredient content or other excellent traits. They have significant cost-reduction and efficiency-enhancing capabilities in agricultural production applications and have broad application prospects. However, there are also potential problems such as certain exogenous ingredients that may induce human immune responses or destroy original nutrients, which need to be avoided in gene editing.

[0004] Among them, the biggest advantage of transgenic plants as oral vaccine synthesis reactors is that they can use plant cell walls to form natural biological capsules to avoid the protein structure being destroyed by the digestive system after oral administration. Only simple ingestion is needed to allow the active ingredients to enter the intestines, stimulate specific immune responses under the stimulation of the intestinal mucosa, and enable the human body to gain immunity. Such vaccines have greatly changed the production methods, vaccination patterns and economic costs of traditional vaccines, and have important social significance and broad development prospects. In addition, important protein and peptide drugs such as human insulin, hemoglobin, immunoglobulin, and enkephalin have also been industrialized and commercialized in the production and application of plant cell reactors.

[0005] At present, the most prominent problem in the production of exogenous gene expression products by transgenic plant cell reactors is the insufficient gene expression, which is the biggest obstacle to the application of plants to produce medicinal proteins. On the one hand, this problem can be solved by using the characteristics of high metabolic rate and continuous division of stem cells such as callus tissue as reactors to make up for this shortcoming. On the other hand, it is also necessary to increase the expression level of such exogenous genes in single cells. To increase the expression level of target genes, we can start from the molecular biology level, such as using strong promoters, specific promoters or leading sequences to allow the target exogenous genes to have higher transcription and translation activities to increase the yield of target products, or control their high expression in seed tissues and specific external environmental conditions, so that in production practice, seeds can be collected under specific conditions for target product extraction instead of whole plant extraction, which will greatly reduce production costs.

[0006] Human cytomegalovirus (HCMV) is the member with the largest genome in the herpes virus family, encoding more than 200 proteins. HCMV has a narrow host range of infection, with humans as the host, and there is no animal model of infection. HCMV lysis, replication and proliferation are slow and have a long cycle. In addition to forming intranuclear inclusions, HCMV has the characteristics of inducing the production of perinuclear and cytoplasmic inclusions and cell swelling (giant cells), hence the name.

[0007] HCMV can infect vascular endothelial cells and leukocytes, and induce typical inclusion body characteristics in endothelial cells. In the in vitro monocyte infection experiment, the virus well could not cause the corresponding cytopathological phenomenon, indicating that the proliferation of HCMV in monocytes is restricted, and it is speculated that such cells may be the latent infection site of HCMV. HCMV can induce the occurrence of diseases through a variety of different mechanisms, including direct tissue damage and immune damage. Although direct damage to mucosal epithelial cells caused by HCMV infection in the lungs may be the pathogenic mechanism of pneumonia caused by HCMV infection, experiments in animal models have shown that immune damage caused by the immune response to HCMV infection may be the main mechanism of HCMV-induced pneumonia. Correspondingly, the HCMV titer in lung tissue does not reflect the severity of pneumonia.

[0008] When constructing an HCMV vaccine, HCMV glycoprotein B can be used as an antigen to enter the body to induce an immune response, so that when the animal is infected with HCMV, it can quickly produce a targeted immune response to quickly eliminate the pathogen. There are two different ways for transgenic plants to express exogenous viral antigens:

[0009] 1. Stable genome integration and stable expression of exogenous DNA mediated by Agrobacterium T-DNA vector or microparticle bombardment can be achieved. A large number of transgenic plants can be produced through asexual or sexual reproduction, and multiple genes can be mediated to produce multivalent vaccines, but the expression level is low.

[0010] 2. Use viral vectors for transient expression. Although the transient expression level is relatively high, it needs to be purified or partially purified before oral consumption.

[0011] In the field of plant genetic engineering, when it comes to genetic engineering of HCMV oral vaccine bioreactors, HCMV glycoprotein B is often used as an antigen to introduce the HCMV glycoprotein B gene into the target plant. In previous experiments using tobacco plants, HCMV vaccines can be produced efficiently, but this method often acts on the entire tobacco plant, which poses certain problems for subsequent collection. Agricultural products such as peanuts are collected for seeds to be processed or eaten directly during planting. There are currently no reports on using peanut seed cells as reactors to obtain HCMV glycoprotein B antigen vaccines. Summary of the invention

[0012] In view of the deficiencies in the prior art, the present invention provides a peanut seed-specific gene promoter YW4YDB and its application, and utilizes the peanut seed-specific gene promoter YW4YDB to drive the expression of the HCMV glycoprotein B gene in peanut seed tissue cells, thereby achieving the expression of the HCMV glycoprotein B gene in peanut seed tissue cells, thereby efficiently producing the HCMV glycoprotein B antigen vaccine.

[0013] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0014] A peanut seed-specific gene promoter YW4YDB, wherein the DNA nucleotide sequence of the peanut seed-specific gene promoter YW4YDB is selected from any one of the following sequences:

[0015] (1) The DNA nucleotide sequence shown in SEQ ID NO.01, that is:

[0016] CATAAACATTAAACAATGCATCTAACCGGAGAATTAGGCATCAGCAAGAAAAGAGAAGAACTGAAGCCGTGCATGCGTGGTCCCCGTTGTGAAGAAATCGCAGATAAATGCTTAGCTGTACATGGAGACAAGGTTGCTCTCTTTGTATGCTTATCATGTTATAGAGATGCTTTGCGAGGTGTAACAAAGGAAGGGTGCCATAGCCATGC;

[0017] (2) Reverse complement to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as the sequence shown in SEQ ID NO.02:

[0018] GCATGGCTATGGCACCCTTCCTTTGTTACACCTCGCAAAGCATCTCTATAACATGATAAGCATACAAAGAGAGCAACCTTGTCTCCATGTACAGCTAAGCATTTATCTGCGATTTCTTCACAACGGGGACCACGCATGCACGGCTTCAGTTCTTCTCTTTTCTTGCTGATGCCTAATTCTCCGGTTAGATGCATTGTTTAATGTTTATG;

[0019] (3) a DNA or RNA sequence that can hybridize with SEQ ID NO.01 or SEQ ID NO.02;

[0020] (4) a sequence having at least 95% sequence identity with the sequence described in SEQ ID NO.01 or SEQ ID NO.02;

[0021] (5) A DNA or RNA sequence complementary to any one of SEQ ID NO.01 and SEQ ID NO.02.

[0022] Preferably, the specific gene promoter YW4YDB can drive the HCMV glycoprotein B gene to be specifically and highly expressed in peanut seed tissue cells.

[0023] Preferably, the peanut seed-specific gene promoter YW4YDB is obtained by PCR amplification technology.

[0024] Preferably, during the PCR amplification process, two primers are configured according to the existing original DNA chain:

[0025] (1) The sequence is shown in SEQ ID NO.03:

[0026] CATAAACATTAAACAATGCATCTAA;

[0027] (2) The sequence is shown in SEQ ID NO.04:

[0028] GCATGGCTATGGCACCCTTCCTTTG.

[0029] Preferably, a DNA polymerase-based DNA amplification system is used for amplification during the amplification process.

[0030] The specific gene promoter YW4YDB is used for producing HCMV vaccine.

[0031] Preferably, the application method is to utilize or operate peanut seed cells as a reactor to carry out genetic modification and gene transformation to efficiently produce HCMV glycoprotein B antigen vaccine.

[0032] Preferably, the specific process is to perform transgenic operation on peanut seeds, use the pCAMBIA2300 plasmid sequence as a vector, construct a DNA double strand of peanut seed specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

[0033] The present invention provides a peanut seed-specific gene promoter YW4YDB and its application, which has the advantages of:

[0034] The invention discloses a peanut seed specific gene promoter YW4YDB which can activate RNA polymerase in required specific seed tissue cells, so that RNA polymerase can be accurately combined with template DNA and has the specificity of transcription initiation. After a combination of promoter YW4YDB and HCMV glycoprotein B gene is integrated into the chromosome DNA chain of the cell by using a specific vector, the peanut seed specific gene promoter YW4YDB is used or operated to drive the target gene to be expressed in the peanut seed tissue cells, thereby achieving the purpose of expressing the HCMV glycoprotein B gene in the peanut seed tissue cells. In breeding at the molecular biology level of agricultural production, the peanut seed tissue cells can be used as reactors in this way to carry out genetic modification and gene transformation so as to efficiently produce HCMV glycoprotein B antigen vaccines. DETAILED DESCRIPTION

[0035] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0036] Embodiment 1:

[0037] PCR amplification of the peanut seed-specific gene promoter YW4YDB:

[0038] 1. Select the DNA nucleotide sequence shown in SEQ ID NO.01 below as the peanut seed-specific gene promoter YW4YDB sequence:

[0039] SEQ ID NO.01 sequence:

[0040] CATAAACATTAAACAATGCATCTAACCGGAGAATTAGGCATCAGCAAGAAAAGAGAAGAACTGAAGCCGTGCATGCGTGGTCCCCGTTGTGAAGAAATCGCAGATAAATGCTTAGCTGTACATGGAGACAAGGTTGCTCTCTTTGTATGCTTATCATGTTATAGAGATGCTTTGCGAGGTGTAACAAAGGAAGGGTGCCATAGCCATGC;

[0041] 2. Configure two primers (25 bp in length) based on the existing original DNA chain:

[0042] SEQ ID NO.03 sequence: CATAAACATTAAACAATGCATCTAA

[0043] SEQ ID NO.04 sequence: GCATGGCTATGGCACCCTTCCTTTG;

[0044] 3. Prepare a certain amount of DNA amplification system based on Phusion DNA polymerase:

[0045] The configuration method is to mix the following, the ratio here is based on a total system volume of 50μL as an example:

[0046] (1) dd H2O 30.5μL

[0047] (2) 10× Buffer 5 μL

[0048] (3) dNTP (10mmol / L) 1μL

[0049] (4)Sequence SEQ ID NO.03 (10μmol / L)5μL

[0050] (5)Sequence SEQ ID NO.04 (10μmol / L)5μL

[0051] (6) MgCl2 (50mmol / L) 0.5μL

[0052] (7) Peanut genomic DNA 2μL

[0053] (8) Phusion DNA polymerase 1 μL;

[0054] 4. Run the PCR amplification program:

[0055] Place the above amplification system into a PCR thermal cycler and perform the following thermal cycle steps:

[0056] (1) 98°C, 5 min

[0057] (2) 98°C, 30 seconds

[0058] (3) 55°C, 30 seconds

[0059] (4) 72°C, 3 min

[0060] (5) Repeat steps (2) to (4) 20 times

[0061] (6) 72°C, keep warm for 20 min;

[0062] 5. Run the gel electrophoresis to recover a DNA fragment with a length of 0.20 kb;

[0063] 6. Use pEASY-Blunt to perform blunt-end ligation, transform DH5α E. coli competent cells, and complete sequencing.

[0064] Embodiment 2:

[0065] The peanut seed-specific gene promoter YW4YDB obtained in Example 1 above was used for crop genome integration operation:

[0066] 1. Construction of transgenic vector: Using the pCAMBIA2300 plasmid sequence as a vector, a double-stranded DNA of peanut seed-specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator was constructed through enzyme digestion and ligation reaction;

[0067] 2. Tissue culture and subsequent differentiation induction were performed on the callus tissues of Quanhua 806 peanut in MB medium to obtain 20 complete plants of the original Quanhua 806 peanut variety and the transgenic Quanhua 806 peanut variety (genetic transformation positive variety) with the HCMV glycoprotein B gene inserted into the peanut seed-specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator plasmid sequence. The plants were planted under normal greenhouse conditions for 120 days until the plants matured and bore fruit. The seeds of the two plants were collected and the seed parts were separated separately. The expression of glycoprotein B in the two peanut seeds was detected by Western blot to investigate the enhanced expression of HCMV glycoprotein B gene to produce antigen vaccine, as shown in the following table:

[0068]

[0069]

[0070] The above tests show that the peanut seed-specific gene promoter YW4YDB can enhance the expression of HCMV glycoprotein B gene in peanut seed tissue cells to produce antigen vaccine;

[0071] 3. In order to verify that the effect of the peanut seed-specific gene promoter YW4YDB on the enhanced expression of the HCMV glycoprotein B gene when used for gene editing to produce antigen vaccines is only specific to peanut seed tissue cells, the following experimental tests were performed on the plants obtained in the above experiment:

[0072] The remaining parts of the original Quanhua 806 peanut variety obtained after the above planting and the transgenic Quanhua 806 peanut variety (genetic transformation positive variety) in which the HCMV glycoprotein B gene was inserted using the peanut seed specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator plasmid sequence, i.e., the roots, stems, leaves, and shells were tested for the expression of glycoprotein B by Western blot:

[0073] The results were: no protein with the same molecular weight as the glycoprotein B subunit and antigenicity was detected in other tissues except the seeds.

[0074] After comparison, it was found that there was no obvious difference in the promotion of the expression of HCMV glycoprotein B gene by the promoter in the two plants except for the seeds.

[0075] From the above detection, it can be seen that the expression of HCMV glycoprotein B gene was not significantly enhanced in the remaining plant cells except seeds of both the original peanut variety Quanhua 806 and the transgenic peanut variety Quanhua 806 (genetic transformation positive variety) in which the HCMV glycoprotein B gene was inserted using the peanut seed-specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator plasmid sequence.

[0076] Based on the above experiments, it can be concluded that the HCMV glycoprotein B content in the seed tissue cells of Quanhua 806 peanut seedlings inserted with the peanut seed-specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator plasmid sequence was significantly increased compared with the untreated peanut seed tissue cells of the same species under the same growth conditions, while no significant change was found in the HCMV glycoprotein B content in the rest of the plant. Therefore, the peanut seed-specific gene promoter YW4YDB has obvious tissue specificity and expression enhancement effects on the expression of the HCMV glycoprotein B gene in seed tissue cells when used for gene editing.

[0077] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a ..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0078] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A peanut seed-specific gene promoter YW4YDB, characterized in that: The DNA nucleotide sequence of the peanut seed-specific gene promoter YW4YDB is the DNA nucleotide sequence shown in SEQ ID NO.01, that is: CATAAACATTAAACAATGCATCTAACCGGAGAATTAGGCATCAGCAAGAAAAGAGAAGAACTGAAGCCGTGCATGCGTGGTCCCCGTTGTGAAGAAATCGCAGATAAATGCTTAGCTGTACATGGAGACAAGGTTGCTCTCTTTGTATGCTTATCATGTTATAGAGATGCTTTGCGAGGTGTAACAAAGGAAGGGTGCCATAGCCATGC.

2. The peanut seed-specific gene promoter YW4YDB according to claim 1, characterized in that: The specific gene promoter YW4YDB can drive the HCMV glycoprotein B gene to be specifically and highly expressed in peanut seed tissue cells.

3. The peanut seed-specific gene promoter YW4YDB according to claim 1, characterized in that: The peanut seed-specific gene promoter YW4YDB is obtained by PCR amplification technology.

4. The peanut seed-specific gene promoter YW4YDB according to claim 3, characterized in that: During the PCR amplification process, two primers are configured according to the existing original DNA chain: (1) The sequence is shown in SEQ ID NO.03: CATAAACATTAAACAATGCATCTAA; (2) The sequence is shown in SEQ ID NO.04: GCATGGCTATGGCACCCTTCCTTTG.

5. The peanut seed-specific gene promoter YW4YDB according to claim 3, characterized in that: In the amplification process, a DNA amplification system based on DNA polymerase is used for amplification.

6. An application of the peanut seed-specific gene promoter YW4YDB as claimed in claim 1, characterized in that: The specific gene promoter YW4YDB is used for producing HCMV vaccine.

7. The use of a peanut seed-specific gene promoter YW4YDB according to claim 6, characterized in that: The application method is to utilize or operate peanut seed cells as a reactor to carry out genetic modification and gene transformation to efficiently produce HCMV glycoprotein B antigen vaccine.

8. The use of a peanut seed-specific gene promoter YW4YDB according to claim 7, characterized in that: The specific process is to perform transgenic operation on peanut seeds, use pCAMBIA2300 plasmid sequence as a vector, construct a DNA double chain of peanut seed specific gene promoter YW4YDB-HCMV glycoprotein B gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

Images