An antimicrobial peptide and its preparation method and use

Abstract

The present invention belongs to the field of biotechnology, and discloses an antimicrobial peptide and a preparation method and use thereof. The antimicrobial peptide of the present invention is a mixture of any one or more of the polypeptides of RcASScGAK, RcASScGAKS, TGMRcASScGAK, and TGMRcASScGAKS. The present invention also provides a method for preparing the antimicrobial peptide by heterologous co-expression of a whole enzyme and a substrate, as well as a purification process of the antimicrobial peptide, which can successfully obtain high-yield and high-purity antimicrobial peptides, the required reagents are low-priced, the operation steps are simple and easy, and it is suitable for large-scale cultivation and purification; the antimicrobial peptide prepared by the present invention has excellent antimicrobial activity, and provides a new choice for the development of antimicrobial and anti-infective drugs.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an antimicrobial peptide and a preparation method and use thereof. Background Art

[0002] In recent years, due to the evolution of bacteria and the abuse of antibiotics, multidrug-resistant bacteria have continued to grow, making clinical anti-infection treatment more difficult. More and more patients have died because they cannot find suitable antibiotics, and it has become the second leading cause of death in the world, causing great trouble and challenges to frontline clinicians. Existing antibiotic treatments can no longer meet the needs of clinical treatment, so there is an urgent need to find new alternative drugs or treatment strategies.

[0003] Antimicrobial peptides (AMPs) are low molecular weight proteins with broad-spectrum antimicrobial and immunomodulatory activities against infectious bacteria (Gram-positive and Gram-negative), viruses, and fungal infections. At the same time, it is difficult for microorganisms to develop resistance to most antimicrobial peptides, which makes them a long-term effective product. In addition, antimicrobial peptides also exhibit high specificity, low toxicity, and biodiversity. They have attracted great interest because of their potential to overcome the increasingly serious problem of antibiotic resistance.

[0004] Methaneoxidizing bacteria (Mbns) are small peptides that capture copper and secrete from methanotrophic bacteria. The structures and compositions of methanotrophic bacteria produced by different methanotrophic bacteria are somewhat different, but all of these peptides are peptides with post-translational modification groups. The structural characterization of methanotrophic bacteria was difficult in the early days because they are easily degraded. In 2004, Kim et al. first studied and derived the structure of methanotrophic bacteria secreted by the OB3b strain of Methylosinus trichosporium:

[0005]

[0006] The LCGSCYPCSCM sequence is used as the precursor peptide sequence, in which the second and eighth cysteines are modified into oxazolone-thioamide groups. Subsequently, the structures of Mbn secreted by several other strains have been characterized, all of which have typical modification groups, such as oxazolone-thioamide, 2,6-dihydroxypyrazine-thioamide, etc., but so far, the number of Mbn with clear structures is still small (Dassama LM, Kenney GE, Rosenzweig AC. Methanobactins: from genome to function. Metallomics. 2017 Jan 25; 9(1): 7-20. doi: 10.1039 / c6mt00208k. PMID: 27905614; PMCID: PMC5269455.).

[0007] At present, researchers have conducted many studies and reports on the biological activities of Mbns, including antioxidant activity and metal chelation, and found that some Mbns also exhibit certain antibacterial activity. As antimicrobial peptides, they are very promising for use in anti-infective drugs (Zhou Qiqiong, Xin Jiaying, Zhang Yingxin, Dong Jing, Song Hao, Xia Chungu. Research progress on the biological activity of methanotrophins [J]. Biotechnology Communications, 2009, 20(05): 723-725.).

[0008] However, since Mbns are generally extracted from fermentation broth of bacteria that are difficult to culture, the steps are complicated and the cost is high, making it difficult to achieve large-scale preparation. At the same time, the modification groups of Mbns are usually composed of two oxazolone-thioamides, which are difficult to chemically synthesize. Therefore, the development and research of new Mbns still faces many difficulties. Summary of the invention

[0009] The object of the present invention is to provide a novel methanotrophic acid as an antimicrobial peptide with excellent antimicrobial effect.

[0010] The present invention provides an antimicrobial peptide, comprising a mixture of any one or more of the following polypeptides:

[0011] (a) The sequence is the polypeptide shown in SEQ ID NO.1;

[0012] (b) the polypeptide sequence is shown in SEQ ID NO.2;

[0013] (c) a polypeptide having a sequence as shown in SEQ ID NO.3;

[0014] (d) a polypeptide having a sequence as shown in SEQ ID NO.4;

[0015] And the polypeptide sequence includes the following modifications: cysteine ​​is modified to an oxazolone-thioamide group;

[0016] When the antimicrobial peptide is a mixture of multiple polypeptides, the polypeptide with the sequence shown in SEQ ID NO.1 accounts for more than 60% of the total number of peptide segments.

[0017] The antimicrobial peptide is RcASScGAK, RcASScGAKS, TGMRcASScGAK or TGMRcASScGAKS, wherein the lowercase letter c represents an oxazolone-thioamide group.

[0018] The specific structures of the four antimicrobial peptides are as follows:

[0019] RcASScGAK:

[0020]

[0021] RcASScGAKS:

[0022]

[0023] TGMRcASScGAK:

[0024]

[0025] TGMRcASScGAKS:

[0026]

[0027] The aforementioned four antimicrobial peptides of the present invention can be prepared by methods commonly used in the biological field, for example, they can be recombinantly expressed by genetic engineering, or they can be directly synthesized by synthetic methods.

[0028] Furthermore, the above antimicrobial peptide is prepared by the following method:

[0029] (1) preparing a recombinant bacterium containing the RrmbnA gene, the RrmbnB gene and the RrmbnC gene;

[0030] (2) inducing and culturing the recombinant bacteria described in step (1) to obtain a bacterial solution containing the antimicrobial peptide;

[0031] (3) purifying the bacterial solution of step (2) to obtain;

[0032] The RrmbnA gene sequence is shown in SEQ ID NO.5; the RrmbnB gene sequence is shown in SEQ ID NO.6; and the RrmbnC gene sequence is shown in SEQ ID NO.7.

[0033] Furthermore, the preparation method of the recombinant bacteria in step (1) above is as follows:

[0034] 1) constructing a recombinant plasmid A containing a nucleotide fragment as shown in SEQ ID NO.5, and a recombinant plasmid B containing a nucleotide fragment as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively;

[0035] 2) The recombinant plasmids A and B prepared in step 1) are co-transformed into the engineered bacteria to obtain positive clones.

[0036] Furthermore, in step 1) of the above-mentioned method for preparing recombinant bacteria, the recombinant plasmid A contains a nucleotide fragment P4 formed by fusion of the RBS region and SEQID NO.5; the recombinant plasmid B contains a nucleotide fragment of sequence SEQ ID NO.7 with a protein tag, preferably a 6×His tag.

[0037] Furthermore, the inducer used in the induction culture in the above step (2) is IPTG, and the recombinant bacteria is Escherichia coli BL21DE3; the bacterial solution containing antimicrobial peptides is obtained by adding a protease inhibitor to the recombinant bacterial cells after the induced culture and breaking them; preferably, the protease inhibitor is PMSF.

[0038] The present invention also provides a method for preparing the above antimicrobial peptide, which is characterized by comprising the following steps:

[0039] (1') preparing a recombinant bacterium containing the RrmbnA gene, the RrmbnB gene and the RrmbnC gene;

[0040] (2') inducing and culturing the recombinant bacteria described in step (1') to obtain a bacterial solution containing the antimicrobial peptide;

[0041] (3') purifying the bacterial solution of step (2') to obtain;

[0042] The RrmbnA gene sequence is shown in SEQ ID NO.5; the RrmbnB gene sequence is shown in SEQ ID NO.6; and the RrmbnC gene sequence is shown in SEQ ID NO.7.

[0043] Furthermore, the preparation method of the recombinant bacteria in the above step (1') is as follows:

[0044] 1') constructing a recombinant plasmid A containing a nucleotide fragment as shown in SEQ ID NO.5, and a recombinant plasmid B containing a nucleotide fragment as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively;

[0045] 2') co-transforming the recombinant plasmids A and B prepared in step 1') into the engineered bacteria to obtain positive clones;

[0046] Preferably, in step 1'), the recombinant plasmid A contains a nucleotide fragment P4 formed by fusion of the RBS region and SEQ ID NO.5; the recombinant plasmid B contains a nucleotide fragment of sequence SEQ ID NO.7 with a protein tag, preferably a 6×His tag.

[0047] Furthermore, the inducer used in the induction culture in the above step (2') is IPTG, and the recombinant bacteria is Escherichia coli BL21DE3; the bacterial solution containing antimicrobial peptides is obtained by adding a protease inhibitor to the recombinant bacterial cells after induction culture and breaking them; preferably, the protease inhibitor is PMSF.

[0048] Or, more specifically, the method for preparing the antimicrobial peptide comprises the following steps:

[0049] Step 1: Construction of the precursor peptide RrMbnA expression vector: Prepare the fusion fragment P4 of the RBS region and the full length of the RrmbnA gene, and construct it into the vector plasmid;

[0050] Step 2: Construction of expression vector for biosynthetic holoenzyme RrMbnBC: Synthesize RrmbnB gene sequence and RrmbnC gene sequence and construct them into vector plasmid;

[0051] Step 3: Double plasmid co-transformation: co-transform the expression vector obtained in step 1 and the expression vector obtained in step 2 into competent cells of the expression bacteria; screen out positive clones with coexistence of double plasmids;

[0052] Step 4: Induce expression: Select the positive clones obtained in step 3 and culture them, then add the protein expression inducer and continue culturing;

[0053] Step 5: Collecting bacteria for crude extraction: centrifuging the bacterial solution obtained by culturing in step 4, discarding the supernatant, and resuspending the bacterial precipitate; adding protease inhibitors to break the bacteria; separating the supernatant and the precipitate; taking the supernatant, which contains the antimicrobial peptide;

[0054] Wherein, the vector plasmid in step 1 and the vector plasmid in step 2 contain different antibiotic resistance genes respectively; and the screening in step 3 is performed according to the different antibiotic resistance genes.

[0055] Furthermore, in step 1, the vector plasmid is a pET28b vector containing a kanamycin resistance gene; in step 2, the vector plasmid is a pETDuet-1 vector containing an ampicillin resistance gene, and / or the RrmbnC gene carries a protein tag, preferably a 6×His tag; in step 3, the expression bacteria is the Escherichia coli expression strain BL21DE3, and the screening is performed by coating the expression bacteria on a double-resistant plate to which ampicillin and kanamycin are added for screening; in step 4, the protein expression inducer is IPTG; in step 5, the resuspended bacterial precipitate uses a 10 mM, pH 8.0 Hepes buffer, and the protease inhibitor is PMSF.

[0056] Furthermore, the fusion fragment P4 of the RBS region and the full-length RrmbnA gene in step 1 is obtained by PCR amplification using F1 and R1, F2 and R2, and F3 and R3 as templates and primers; the nucleotide sequence of F1 is shown in SEQ ID NO.8; the nucleotide sequence of R1 is shown in SEQ ID NO.9; the nucleotide sequence of F2 is shown in SEQ ID NO.10; the nucleotide sequence of R2 is shown in SEQ ID NO.11; the nucleotide sequence of F3 is shown in SEQ ID NO.12; the nucleotide sequence of R3 is shown in SEQ ID NO.13;

[0057] Preferably, the PCR amplification is as follows: using F1 / R1, F2 / R2, and F3 / R3 as templates and primers, respectively, to obtain three short fragments P1, P2, and P3 constituting the RrmbnA gene through PCR amplification; using P1, P2, and P3 as templates and F1 / R3 as primers, to obtain a fusion fragment P4 of the RBS region and the full length of the RrmbnA gene through overlapping extension PCR amplification.

[0058] Furthermore, the culturing in step 4 is: culturing to OD 600 0.5-0.7, continue to culture for 20-40 min; then add inducer IPTG to a final concentration of 100 μM, and continue to culture for 15-17 h;

[0059] Preferably, the culture is: using LB liquid culture medium, culturing at 37°C, 220rpm shaking for 3h; transferring to large bottle culture: inoculating 20mL of bacterial liquid into each 1L of LB culture medium, culturing at 37°C, 220rpm shaking until OD 600 The pH value was 0.5-0.7, the shaker was cooled to 16°C, the speed was reduced to 180 rpm, and the culture was continued for 30 min; then the inducer IPTG was added to the culture to a concentration of 100 μM, and the culture was continued for 16 h.

[0060] Furthermore, the final concentration of the protease inhibitor added in step 5 is 1 mM;

[0061] Preferably, the step of collecting and crudely extracting bacteria is: centrifuging the bacterial solution at 3800 rpm for 12 min, discarding the supernatant, and resuspending the bacterial precipitate with 10 mM, pH 8.0 Hepes buffer; adding protease inhibitors to a final concentration of 1 mM, disrupting the bacteria with a high-pressure cell disruptor, and centrifuging with a high-speed refrigerated centrifuge at 15000 rpm for 30 min to separate the supernatant and the precipitate, and taking the supernatant.

[0062] Furthermore, the above method also includes the following separation and purification steps:

[0063] Step 6: Rough separation: the supernatant obtained in step 5 is passed through a nickel column affinity chromatography column to elute the complex;

[0064] Step 7: Ultrafiltration separation: centrifuge the complex obtained in step 6 in an ultrafiltration tube, and collect the filtrate in the ultrafiltration tube;

[0065] Step 8: Buffer exchange: The filtrate obtained in step 7 is purified by macroporous adsorption resin, the buffer is removed by washing with ultrapure water, the target component is eluted with 50% to 70% acetonitrile or ethanol, and then freeze-dried;

[0066] Step 9: molecular sieve re-purification: resuspend the lyophilized powder obtained in step 8, separate it through a Superdex 75 10 / 300GL gel chromatography column, collect the elution peak, and lyophilize to obtain the purified antimicrobial peptide;

[0067] Preferably, the pore size of the ultrafiltration membrane in the ultrafiltration tube in step 7 is 10 kDa.

[0068] The present invention also provides a codon-optimized RrmbnB gene, the sequence of which is shown in SEQ ID NO.6.

[0069] The present invention also provides a codon-optimized RrmbnC gene, the sequence of which is shown in SEQ ID NO.7.

[0070] The present invention also provides the use of antimicrobial peptides in the preparation of antimicrobial agents;

[0071] Wherein, the antibacterial agent is a drug against any one or more of Acinetobacter baumannii, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Pseudomonas aeruginosa, and Klebsiella pneumoniae; further, the antibacterial agent is a drug against drug-resistant strains of Acinetobacter baumannii.

[0072] Beneficial effects of the present invention: The present invention provides a class of methanotrophic acid antimicrobial peptides with a new structure, and provides a method for preparing the antimicrobial peptide by heterologous co-expression of a whole enzyme and a substrate, as well as a purification process of the antimicrobial peptide, which can successfully obtain high-yield and high-purity antimicrobial peptides, the required reagents are inexpensive, the operation steps are simple and easy, and it is suitable for large-scale cultivation and purification; the antimicrobial peptides of the present invention have excellent antibacterial effects, and provide a new choice for the development of antibacterial and anti-infective drugs.

[0073] Terminology of the present invention: The cysteine ​​described in the present invention is modified into an oxazolone-thioamide group, which refers to the cysteine ​​partial structure in the polypeptide sequence: Became

[0074] "RBS region" refers to the ribosome binding site, which is a purine-rich untranslated region upstream of the start codon.

[0075] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0076] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 A schematic diagram showing the preparation process of the antimicrobial peptide of the present invention.

[0078] Figure 2 This is an SDS-PAGE identification diagram of the co-expression complex after nickel column affinity chromatography, wherein M represents protein marker, C represents whole bacterial sample, S represents supernatant sample separated after disruption, F represents flow-through sample of nickel column affinity chromatography, and E represents sample eluted from nickel column.

[0079] Figure 3 Antimicrobial peptide RrMbnA OXA Molecular sieve chromatogram, the gray dotted line, black solid line, and gray solid line represent the peak types corresponding to the 270nm, 280nm, and 335nm UV detectors, respectively. The mature peptide form of RrMbnA has characteristic absorption peaks at 258nm and 335nm. The peak type in the figure is single and there is no contamination from foreign proteins.

[0080] Figure 4 Antimicrobial peptide RrMbnA OXAUV-Vis absorption spectrum (UV-Vis) identification diagram, the black solid line, gray solid line, and gray dashed line represent the RrMbnBC control, the RrMbnABC co-expression product complex, and the purified RrMbnA OXA UV-Vis absorption spectrum of purified RrMbnA OXA It has the characteristic ultraviolet absorption of methanotrophins, i.e. Figure 4 The absorption peaks are near 258nm and 335nm.

[0081] Figure 5 The SDS-PAGE identification diagram of the biosynthetic holoenzyme MbnBC proteins from six species after expression. Among them, only MbnB was expressed in MpMbnBC(Ⅰ), MpMbnBC(II), and MsMbnBC; both MbnB and MbnC were expressed in RrMbnBC, MtMbnBC, and VcMbnBC.

[0082] Figure 6 The modification of MbnA was identified by UV-Vis after the co-expression of RrMbnABC, MtMbnABC and VcMbnABC. VcMbnA and MtMbnA did not show the absorption peak at 335nm, while RrMbnA had an obvious absorption peak at 335nm, which proved that RrMbnA was modified.

[0083] Figure 7 This is the recombinant plasmid map of the RrmbnA gene constructed into the vector pET28b.

[0084] Figure 8 This is the recombinant plasmid map of the RrmbnB gene and RrmbnC gene constructed into the vector pETDuet-1.

[0085] Fig. 9 The antimicrobial peptide RrMbnA OXA The primary and secondary mass spectrometry results of the RcASScGAK fragment.

[0086] Fig.10 It is the antimicrobial peptide RrMbnA OXA The primary and secondary mass spectrometry results of the RcASScGAKS fragment.

[0087] Fig.11 The antimicrobial peptide RrMbnA OXA The primary and secondary mass spectrometry results of the TGMRcASScGAK fragment.

[0088] Fig.12 It is the antimicrobial peptide RrMbnA OXA The primary and secondary mass spectrometry results of the TGMRcASScGAKS fragment.

[0089] Fig.13 It is the antimicrobial peptide RrMbnA OXA Liquid chromatograms of RcASScGAK, RcASScGAKS, TGMRcASScGAK, and TGMRcASScGAKS.

[0090] Fig.14 It is the HPLC single peak of the pure peptide RcASScGAK and its primary mass spectrometry and secondary mass spectrometry results.

[0091] Fig.15 It is the HPLC single peak of the pure peptide RcASScGAKS and its primary mass spectrometry and secondary mass spectrometry results.

[0092] Fig.16 It is the HPLC single peak of the pure peptide TGMRcASScGAK and its primary mass spectrometry and secondary mass spectrometry results.

[0093] Fig.17 It is the HPLC single peak of the pure peptide TGMRcASScGAKS and its primary mass spectrometry and secondary mass spectrometry results.

[0094] Fig.18 RrMbnA OXA Inhibition zone detection of Acinetobacter baumannii. Figure A is RrMbnA OXA The inhibition zone of a standard strain of Acinetobacter baumannii, Figure B is RrMbnA OXA Inhibition zone of RrMbnA against a multidrug-resistant clinical isolate of Acinetobacter baumannii OXA It has an inhibitory effect on the growth of both standard strains and clinical isolates.

[0095] Fig.19 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Escherichia coli.

[0096] Fig. 20 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Staphylococcus aureus.

[0097] Fig.21 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Pseudomonas aeruginosa.

[0098] Fig. 22 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Klebsiella pneumoniae.

[0099] Fig.23The figures are the results of the antibacterial experiments of the pure RcASScGAK, RcASScGAKS, TGMRcASScGAK and TGMRcASScGAKS polypeptides of the present invention on the clinically isolated drug-resistant strains of Acinetobacter baumannii.

[0100] Fig.24 These are the results of the antibacterial experiments of the pure RcASScGAK, RcASScGAKS, TGMRcASScGAK and TGMRcASScGAKS polypeptides of the present invention on other bacteria.

[0101] Fig.25 Results of multidrug resistance experiments of different antibiotics against clinical isolates of Acinetobacter baumannii.

[0102] Fig.26 Antimicrobial peptide RrMbnA of the present invention OXA Inhibitory results against multidrug-resistant Acinetobacter baumannii.

[0103] Fig. 27 Antimicrobial peptide RrMbnA of the present invention OXA Results of real-time monitoring of growth inhibition of clinical isolates of Acinetobacter baumannii.

[0104] Fig.28 The antibacterial activity of antimicrobial peptides at different concentrations against Acinetobacter baumannii AB9.

[0105] Fig.29 The antibacterial activity of antimicrobial peptides at different concentrations against Acinetobacter baumannii AB13.

[0106] Fig.30 The antibacterial activity of antimicrobial peptides at different concentrations against Acinetobacter baumannii AB14.

[0107] Fig.31 The antibacterial activity of antimicrobial peptides at different concentrations against Acinetobacter baumannii AB15.

[0108] Fig.32 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB9 at different pH values.

[0109] Fig.33 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB13 at different pH values.

[0110] Fig.34 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB14 at different pH values.

[0111] Fig.35 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB15 at different pH values.

[0112] Fig.36The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB9 at different temperatures.

[0113] Fig.37 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB13 at different temperatures.

[0114] Fig.38 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB14 at different temperatures.

[0115] Fig.39 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB15 at different temperatures. DETAILED DESCRIPTION

[0116] The raw materials and equipment used in the present invention are all known products, which are obtained by purchasing commercially available products.

[0117] Example 1: Antimicrobial peptide RrMbnA of the present invention OXA Preparation

[0118] Antimicrobial peptide RrMbnA OXA The schematic diagram of the preparation process of the four pure antimicrobial peptides is shown in Figure 1 shown.

[0119] 1. Antimicrobial peptide RrMbnA OXA Preparation and characterization of

[0120] 1. Antimicrobial peptide RrMbnA OXA Preparation method

[0121] (1) Construction of the precursor peptide RrMbnA expression vector: First, three pairs of primers were designed:

[0122] F1 (sequence shown in SEQ ID NO.8):

[0123] 5'- CGGATAACAATTCCCCTCTAGA AATAATTTTGTTTAACTTTAAGAAGGAGATATACC-3';

[0124] R1 (sequence shown in SEQ ID NO.9):

[0125] 5'-CTGAATCTCCACTTTTTTAACGATCACGATTTTCATGGTATATCTCCTTCTTA-3';

[0126] F2 (sequence shown in SEQ ID NO.10):

[0127] 5'-AAAAAGTG GAGATTCAGGTTGCCAGGCCGTACCGGCATGCGT-3';

[0128] R2 (sequence shown in SEQ ID NO.11):

[0129] 5'-GCTTTTGCACCACAAGAAGAAGCGCAACGCATGCCGGTACG-3';

[0130] F3 (sequence shown in SEQ ID NO.12):

[0131] 5'-TGTGGTGCAAAAAGCTAAGAGAACCTGTACTTCCAAGGGCATCATCATCATCA-3';

[0132] R3 (sequence shown in SEQ ID NO.13):

[0133] 5'- TGGTGGTGGTGGTGCTCGAG TCAGTGATGATGATGATGATGCC-3′;

[0134] The underlined part is a fragment homologous to the vector; three short fragments P1, P2, and P3 constituting the RrmbnA gene (with the RBS region at the N-terminus) were amplified by PCR using F1 / R1, F2 / R2, and F3 / R3 as templates and primers, respectively; a fusion fragment P4 of the RBS region and the full length of the RrmbnA gene was amplified by overlap extension PCR using P1, P2, and P3 as templates and F1 / R3 as primers.

[0135] The sequence of the RrmbnA gene is (SEQ ID NO.5):

[0136] ATGAAAATCGTGATCGTTAAAAAAGTGGAGATTCAGGTTGCAGGCCGTACCGG CATGCGTTGCGCTTCTTCTTGTGGTGCAAAAAGCTAA

[0137] The sequence of the fusion fragment P4 of the RBS region and the full length of the RrmbnA gene is (SEQ ID NO.14):

[0138] CGGATAACAATTCCCCTCTAGAAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGAAAATCGTGATCGTTAAAAAAGTGGAGATTCAGGTTGCAGGCCGTACCGGCATGCGTTGCGCTTCTTCTTGTGGTGCAAAAAGCTAAGAGAACCTGTACTTCCAAGGGCATCATCATCATCATCACTGACTCGAGCACCACCACCACCA

[0139] The vector pET28b was linearized by double restriction digestion with XbaⅠ and XhoⅠ, and homologous recombination was carried out with fragment P4 to construct the expression vector pET28b-RrmbnA, which was transformed into DH5α competent cells and sequenced for identification.

[0140] (2) Construction of expression vector for biosynthetic holoenzyme RrMbnBC: The codon-optimized RrmbnB (nucleotide sequence: SEQ ID NO.6) and RrmbnC gene sequences (nucleotide sequence: SEQ ID NO.7) were synthesized by GENEWISE Biotechnology Co., Ltd. and constructed into the pETDuet-1 vector, where RrmbnC was constructed into the first MCS region with a 6×His tag, and RrmbnB was constructed into the second MCS region without a tag. The recombinant plasmid was named pETDuet-1-RrmbnBC.

[0141] SEQ ID NO.6:

[0142] ATGCGCATTGGCTTTAACTTTACCCTGGGCGAAACCCTGCCGCTGGTGCGTCAGTTAGCGCAAGAAGGTGCGATTGATTATTGCGAACTGCTGATTGATAACTTTATGCAAGTGCCGCCGCAAGAACTGGCGGAAGCGTTTGATGTGCCGGTGGGCTTTCATATTATGTTTAGCCGCTTTATTGAAAGCGATGAAGAACAGCTGCGCGATTTTGCGGCGCGCCTGCGCCCGTATATTGAAGCGCTGCGCCCGCTGTATGTGAGCGATCATATTGCGTATTTTAGCCATCAAGGCCGCGCGCTGTATCATCTGGGCGAAATTGATTATGCGGCGGATTATGAACGCGTGCGCGCGCGCGCGGCGCTGTGGCAGAGCCTGCTGGGTCAGACCATTCATTTTGAAAACTATCCGAGCATTGTGGATGGCGGCCATGCGGCGCCGGCGTTTTTTCAGCGCCTGGCGCGCGATACCGGCGCGGGCGTGCTGTTTGATGTTAGCAACGCGGTGTGCGCGTGGCGCAACGATGGCCCGGAGGTTGCGGCCTGGCGCGGCGTGATGGCGGGCGCGAGCCATTTTCATGTGGGCGGCTATGCGGGCGCGTTTATTGATGAAGGCGTGACCGTGGATACCCATGATCGCGCGCTGGCGCAAGATACCCTGGATAGCCTGCGCCGCCATCGCGATGTGCTGGATAAACCGGGCGCGACCATTACCTATGAACGCGATGAAAACATTGACATTGACGGTGTGCGCGCGGATCTGCTGGCGCTGCGCGCCATCTTTCCGCGTGGCCAAGCCCGTCAGCCGGCGCCGGCGGAAGCGGTGGCGAGCTAA

[0143] SEQ ID NO.7:

[0144] ATGAACGCGCCGACCACCGCGGCCGCGGGCGCGGCCGGGCCGCCAAGTGAAAGATAGCGAACTGCTGGCGCGCCTGGCCGATCCGGCGGCGCGGCGATTTTCCGCCGGGCTGCCGCGCGCATGTGCGCATTGATATTAGCATTCGC GCGTATTGGCATACCCTGTTTGATATTTGCCCGGGCCTGCTGGATATTGCCGATCCGGATGGCATGGCGATTTTTGCGCCGTTTATGGATTGGGCGCGCCGCGAAAACCTGACCATGGGCTGGAGCTTTTATATTTGGGTGGGCCGCTGG CTGGCGCAGAGCCCGTGGCGCGAACGCCTGGATGAAGAACTGACCCAAGCGCTGTTAAGCGCGAGCGCGGCGCGCTGGGCGGTGTTAGATCGTAGCGCCGATGTGGGCGTGGTTCTGGGCCGCCGCGGCAGCGATGATTGGATTATCGGC TGGAAACCGAACACCCTGGCGGCGGGCCGCCGTGTGGAACTGGTGAGCTTAGATGGTCAGCTGCCGCGCCCGGCGGAAGATGTGGGCGTGTTTCATCTGGCGGGCTATGAACTGGATAGCTTTCCGGGCTGGTTAGCGCTGCCGCGCTAA

[0145] (3) Dual plasmid co-transformation: The kanamycin-resistant plasmid pET28b-RrmbnA and the ampicillin-resistant plasmid pETDuet-1-RrmbnBC were co-transformed into competent cells of the expression bacterium BL21DE3, spread on dual-resistance plates supplemented with ampicillin and kanamycin, and screened for positive clones with coexistence of the two plasmids.

[0146] (4) Induced expression: Select 5 positive clones obtained in (3) to 100 mL LB liquid culture medium and culture in a shaker at 37°C, 220 rpm for 3 h; transfer to 15 1 L LB culture medium at a volume ratio of 1:50 and culture in a shaker at 37°C, 220 rpm until OD 600 The temperature of the shaker was lowered to 16°C and the speed was reduced to 180 rpm, and the culture was continued for 30 min. The inducer IPTG was added to each 1 L of culture at a final concentration of 100 mM, and the culture was continued for 16 h.

[0147] (5) Collecting and crudely extracting bacteria: centrifuging 15 L of bacterial solution from step (4) at 3800 rpm for 12 min, discarding the supernatant, and resuspending the bacterial precipitate in a buffer containing 10 mM Hepes (pH 8.0); adding PMSF, a protease inhibitor at a final concentration of 1 mM, and disrupting the bacteria using a high-pressure cell disruptor; centrifuging at 15000 rpm for 30 min in a high-speed refrigerated centrifuge to separate the supernatant and precipitate; taking the supernatant and passing it through a nickel column affinity chromatography column to elute the enzyme and RrMbnA OXA The co-expressed complex was identified by SDS-PAGE with nickel column affinity chromatography. Figure 2 As shown, M represents protein marker, C represents whole bacterial sample, S represents supernatant sample separated after disruption, F represents flow-through sample of nickel column affinity chromatography, and E represents sample eluted from nickel column.

[0148] (6) Ultrafiltration separation: The complex eluted in (5) was placed in a 10 kDa ultrafiltration tube and centrifuged at 3800 rpm for 30 min. The filtrate in the ultrafiltration tube was collected and the main component was RrMbnA with a smaller molecular weight. OXA .

[0149] (7) Buffer exchange: The filtrate collected in (6) was purified by macroporous adsorption resin HP-20, washed with ultrapure water to remove the buffer component, and finally the target component was eluted with 200 mL of 60% acetonitrile and freeze-dried overnight.

[0150] (8) Molecular sieve repurification: resuspend the lyophilized powder obtained in (7) with 2 mL of ultrapure water, separate it with a Superdex 75 10 / 300GL gel chromatography column, collect the elution peak, and perform absorption spectrum analysis. The identification result is as follows: Figure 3 and Figure 4 As shown, freeze-dried again to obtain the finished antimicrobial peptide RrMbnA OXA .

[0151] 2. Antimicrobial peptide RrMbnA OXA Structural confirmation

[0152] (1) Method: Take the antimicrobial peptide RrMbnA prepared by the above method OXALiquid chromatography tandem mass spectrometry (HPLC-MS / MS) was performed on an Orbitrap Fusion Lumos mass spectrometer (ThermoFisher Scientific, San Jose, CA, USA) equipped with a nano-ESI ion source that provides HCD, CID, and ETD fragmentation analysis. Peptides were separated by an analytical capillary column packed with 3 μm spherical C18 reversed-phase material (Dr. Masch GmbH, Germany). The following HPLC gradient was generated using an EASY-nLC 1200 (Thermo Fisher Scientific, USA): 0%-65% B in 50 min, 50%-80% B in 5 min, and 80% B in 2 min (A = 0.1% formic acid, 99.9% H2O; B = 80% acetonitrile, 20% H2O, 0.1% formic acid). The mass spectrometer was operated in data-dependent mode, performing one MS scan at the highest speed within 3 seconds, followed by HCD (high-energy collision dissociation) MS / MS scan and ETHCD (electron transfer / high-energy collision dissociation). The raw data were analyzed using Thermo XcaliburQualBrowser and Thermo Proteome Discoverer 2.5.0.400 to identify and confirm the peptides.

[0153] (2) Results: Figures 9 to 12 As shown in the figure, the mass of the primary mass spectrometry is consistent with the expected double-site modification of the peptide, and the secondary mass spectrometry further identifies the composition of the peptide and the specific site where the modification occurs; the peptide corresponding to the peak with a mass-to-charge ratio of 874.32727 is the modified RCASSCGAK, which has the highest content and accounts for more than 60% of the total number of peptides; the fragments corresponding to the parent ions with mass-to-charge ratios of 961.35809, 556.24329, and 625.73944 are the modified RCASSCGAKS, TGMRCASSCGAK, and TGMRCASSCGAKS, respectively, indicating that the antimicrobial peptide RrMbnA OXA The polypeptide containing fragments is modified RCASSCGAK (SEQ ID NO.1), RCASSCGAKS (SEQ ID NO.2), TGMRCASSCGAK (SEQ ID NO.3), and TGMRCASSCGAKS (SEQ ID NO.4), wherein the cysteine ​​is modified into an oxazolone-thioamide group. The modification process involves multiple reaction steps such as oxygenation, hydrogen abstraction, dehydration, and hydrogenation, and the mass is reduced by -4Da when the modification of a single cysteine ​​is completed. The secondary mass spectrometry results show that there is a mass change of -4Da at each cysteine, indicating that both cysteines in the polypeptide are modified by oxazolone-thioamide. Since the HPLC separation is carried out in a strong acid environment, some polypeptides undergo acid hydrolysis, and -30Da comes from the hydrolysis of -4Da, which is equivalent to a -4Da modification.

[0154] (3) Conclusion: As shown in Table 1, the antimicrobial peptide RrMbnA of the present invention OXA The fragment structure contained. The lowercase letter c in the sequence in the table is the position where the cysteine ​​undergoes a -4Da mass change on the mass spectrum, that is, oxazolone-thioamide modification occurs, and cysteine ​​is modified into an oxazolone-thioamide group. -30Da is formed by acid hydrolysis during the HPLC loading process at the -4Da modification, which is equivalent to the -4Da modification before hydrolysis. Antimicrobial peptide RrMbnA OXA The fragments in the protein are mainly RcASScGAK, and the cleavage between the last two amino acids K and S is relatively random, and the proportion will vary each time it is purified.

[0155] Table 1

[0156]

[0157] II. Preparation and characterization of four pure antimicrobial peptides

[0158] 1. Preparation methods of 4 pure antimicrobial peptides

[0159] The antimicrobial peptide RrMbnA obtained in the first part OXA The peptides were further separated by high performance liquid chromatography (HPLC) to obtain pure peptides.

[0160] Mobile phase A is 10 mM ammonium acetate (pH 7.0) buffer salt, and mobile phase B is 100% acetonitrile. HPLC conditions: 1-10 min, 5% mobile phase B isocratic elution; 10.01-15 min, 5-60% mobile phase B gradient elution; 15.01-20 min, 60% mobile phase B isocratic elution, the finished antimicrobial peptide RrMbnA obtained by molecular sieve can be OXA The four antimicrobial peptides in the mixture were separated, and the liquid chromatogram was as follows: Fig.13 As shown, single peaks were collected to obtain pure products of four polypeptides, which were named Sequence 1, Sequence 2, Sequence 3, and Sequence 4, respectively.

[0161] 2. Detection and characterization

[0162] The four peptide samples of sequence 1, sequence 2, sequence 3, and sequence 4 prepared by the above method were analyzed for purity on HPLC under the same conditions as above, and then identified by mass spectrometry. The mass spectrometry identification conditions were the same as those for the antimicrobial peptide RrMbnA. OXA The identification conditions are the same.

[0163] The HPLC test results and mass spectrometry test results of sequence 1, sequence 2, sequence 3, and sequence 4 are as follows: Figure 14 to Figure 17 As shown. Figure 14 to Figure 17It can be seen that the HPLC detection of these four samples is a single peak, indicating that the present invention has obtained four kinds of pure polypeptides. The mass spectrometry detection determines their molecular weight and sequence respectively, among which:

[0164] Fig.14 The peptide showing sequence 1 is RcASScGAK. The lowercase letter c indicates the position where the cysteine ​​undergoes a -4Da mass change in the mass spectrum, that is, the cysteine ​​undergoes oxazolone-thioamide modification, and the cysteine ​​is modified into an oxazolone-thioamide group. The specific structure is:

[0165]

[0166] Fig.15 The peptide sequence 2 is RcASScGAKS. The lowercase letter c indicates the position where the mass change of cysteine ​​by -4Da occurs in the mass spectrum, that is, cysteine ​​undergoes oxazolone-thioamide modification. Cysteine ​​is modified into an oxazolone-thioamide group. The specific structure is:

[0167]

[0168] Fig.16 The sequence 3 is TGMRcASScGAK. The lowercase letter c indicates the position where the mass change of -4Da occurs in the mass spectrum of cysteine, that is, oxazolone-thioamide modification occurs in cysteine. Cysteine ​​is modified into an oxazolone-thioamide group. The specific structure is:

[0169]

[0170] Fig.17 The lowercase letter c indicates the position where cysteine ​​undergoes a -4Da mass change in the mass spectrum, that is, cysteine ​​undergoes oxazolone-thioamide modification, and cysteine ​​is modified into an oxazolone-thioamide group. The specific structure is:

[0171]

[0172] The following experimental examples demonstrate the beneficial effects of the antimicrobial peptides of the present invention.

[0173] Experimental Example 1: Plasmid and gene selectivity test

[0174] In the preliminary experiments of the present invention, the plasmid pET28b with kanamycin resistance and the plasmid pETDuet-1 with ampicillin resistance were selected, and the biosynthetic full enzyme was selected:

[0175] In this experiment, the activity of MbnBC purified and co-expressed complexes from different species was compared, and six species were selected, including Methylocystis parvus OBBP(I)(Mp), Methylocystis parvus OBBP(II)(Mp), Methylosinus sp.LW3(II)(Ms), Rugamonas rubra ATCC 43154(Rr), Methylosinustrichosporium OB3b(Mt), and Vibrio caribbenthicus BAA-2122(Vc). Figure 5 and Figure 6 shown.

[0176] Figure 5 In the figure, from left to right, they are from Methylocystis parvus OBBP(I)(Mp), Methylocystis parvus OBBP(II)(Mp), Methylosinus sp.LW3(II)(Ms), Rugamonas rubraATCC 43154(Rr), Methylosinus trichosporium OB3b(Mt), Vibrio caribbenthicus BAA-2122(Vc), M: Marker, C: whole bacterial sample;

[0177] Since only one of the two genes of the synthase in the first three samples was expressed, it was impossible to have enzyme activity. Therefore, the last three samples were selected for co-transformation of mbnA and mbnBC, among which only RrmbnABC could obtain a co-expression complex with modification activity (gray solid line, i.e., absorption peak at 335nm) (e.g. Figure 6 ). Therefore, mbnA, mbnB and mbnC genes from Rugamonas rubra ATCC43154 (Rr) were selected.

[0178] Furthermore, since the substrate polypeptide gene mbnA needs to be co-transformed with the synthase mbnB and mbnC genes, mbnB and mbnC were constructed on the dual gene expression vector pETDuet-1 with ampicillin resistance. In order to achieve resistance screening after co-transformation, mbnA needs to be constructed on a resistance vector different from ampicillin. Therefore, the kanamycin resistance vector pET28b was selected. The plasmid map after the construction of pET28b-RrmbnA is as follows: Figure 7 shown.

[0179] In order to achieve heterologous expression of antimicrobial peptides and their biosynthetic holoenzyme genes, the present invention optimizes the sequences of RrmbnA, RrmbnB and RrmbnC according to the codon preference of Escherichia coli.

[0180] The synthase of antimicrobial peptides is composed of two genes, which need to be expressed simultaneously to form a heterodimer to exert enzyme activity. Duet-1 series vectors contain two multiple cloning sites, which are suitable for expressing two foreign genes simultaneously in E. coli. The plasmid map of pETDuet-1-RrmbnBC after construction is as follows: Figure 8 shown.

[0181] Experimental Example 2: Antibacterial Test

[0182] 1. Inhibitory effects on standard strains and clinical isolates of Acinetobacter baumannii

[0183] This experiment was conducted on the antimicrobial peptide RrMbnA prepared in Example 1. OXA The antibacterial test was carried out and the results were as follows Fig.18 shown.

[0184] Fig.18 The antimicrobial peptide RrMbnA OXA Inhibition zone assay for Acinetobacter baumannii. Fig.18 A is the antimicrobial peptide RrMbnA OXA The inhibition zone of a standard strain of Acinetobacter baumannii (ATCC 19606) Fig.18 B is the antimicrobial peptide RrMbnA OXA The inhibition zone of a clinical isolate of multidrug-resistant Acinetobacter baumannii (derived from a clinical isolate from West China Hospital of Sichuan University). As can be seen from the figure, the antimicrobial peptide RrMbnA OXA It has a good inhibitory effect on the growth of standard strains and clinical isolates of Acinetobacter baumannii.

[0185] 2. Broad-spectrum antibacterial activity

[0186] 1. The antimicrobial peptide RrMbnA prepared in Example 1 of the present invention was verified by double-layer plate method OXA The broad-spectrum antibacterial activity of

[0187] 1) Preparation of bacterial strains (Escherichia coli DH5α, Staphylococcus aureus Newman, Pseudomonas aeruginosa PAO1, Klebsiella pneumoniae ATCC11296, Acinetobacter baumannii ATCC19606)

[0188] Transfer the -80℃ frozen bacterial solution or the 4℃ stored bacterial solution into fresh LB medium at a ratio of 1:100 and shake at 220rpm / 37℃ until the mid-logarithmic growth period, about 3h.

[0189] 2) Preparation of double-layer agar

[0190] Prepare the lower layer of gel in advance: spread about 10 mL of autoclaved LB (containing 1.5% agar powder) on a 10 cm dish, open the lid and air-dry for about ten minutes, and store for later use.

[0191] Preparation of the upper layer gel: After high pressure application of LB containing 0.3% agar powder, place in a 50°C oven for later use.

[0192] 3) Packaging of upper layer glue

[0193] Prepare 10 mL centrifuge tubes, add 4 mL of upper gel to each tube, and quickly place them in a 42°C water bath for later use.

[0194] 4) Dilute the bacterial solution and mix it with the upper layer of glue

[0195] Dilute the bacterial solution in the middle logarithmic growth period with fresh culture medium at a ratio of 1:5 and add it to the 10 mL centrifuge tube containing the upper layer of agar. Mix by inverting it about 10 times. Quickly pour it onto the lower layer of agar prepared in advance and spread it evenly. After covering it with a lid, let it stand in the biosafety cabinet for 10 minutes until it solidifies.

[0196] 5) Antimicrobial peptide RrMbnA OXA Add

[0197] Three concentration gradients were set up, 23 mg / mL, 2.3 mg / mL and 0.23 mg / mL. The set groups were added dropwise onto the above double-layer agar at 1.5 μL / drop; at the same time, the same volume of ultrapure water was added dropwise as a control.

[0198] 6) Place in a 37°C incubator and incubate overnight

[0199] Let it sit on the biosafety counter for a few minutes to allow the droplets to dry, then carefully place it in the incubator. After half an hour, invert and culture it.

[0200] 7) Observe whether there are clear antibacterial spots

[0201] Observe the presence of antibacterial spots where the liquid droplets were added on the gel imaging instrument and take photos.

[0202] The results are as follows Fig.19 , Fig. 20 , Fig.21 and Fig. 22 As shown: Among them, Fig.19 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Escherichia coli; Fig. 20 Antimicrobial peptide RrMbnA OXA Antibacterial activity against Staphylococcus aureus; Fig.21 Antimicrobial peptide RrMbnA OXAAntibacterial activity against Pseudomonas aeruginosa; Fig. 22 Klebsiella pneumoniae RrMbnA OXA Antibacterial activity against Escherichia coli.

[0203] Antimicrobial peptide RrMbnA OXA It exhibits broad-spectrum antibacterial activity against Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and Klebsiella pneumoniae, and exhibits high inhibitory effects on all four bacterial plates. OXA Obvious inhibition zones appeared around the droplets in a concentration-dependent manner, while no inhibition zones appeared in the control area.

[0204] 2. This experiment also carried out antibacterial tests on the four pure polypeptides (RcASScGAK, RcASScGAKS, TGMRcASScGAK, and TGMRcASScGAKS) prepared in Example 1.

[0205] The experimental steps are as follows: In the clean bench, soak the blank drug-sensitive sheet in the antimicrobial peptide solution. After it is completely soaked, take out the drug-sensitive sheet, air-dry it, and gently place it on the corresponding bacterial plate with tweezers; incubate it in a 37°C incubator overnight; on the next day, observe whether there is an antibacterial zone to determine whether the peptide has an antibacterial effect on the corresponding bacteria.

[0206] The experimental results are as follows Fig.23 and Fig.24 shown.

[0207] Fig.23 It was shown that RcASScGAK, RcASScGAKS, TGMRcASScGAK, and TGMRcASScGAKS had excellent inhibitory effects on standard strains and clinical isolates of Acinetobacter baumannii; Fig.24 It was shown that RcASScGAK, RcASScGAKS, TGMRcASScGAK and TGMRcASScGAKS had excellent inhibitory effects on Staphylococcus aureus Newman, Pseudomonas aeruginosa PAO1 and Escherichia coli DH5a.

[0208] The experimental results show that the pure peptides of RcASScGAK, RcASScGAKS, TGMRcASScGAK and TGMRcASScGAKS have inhibitory effects on Acinetobacter baumannii, Staphylococcus aureus, Pseudomonas aeruginosa and Escherichia coli, respectively, and also have inhibitory effects on drug-resistant strains of Acinetobacter baumannii, and can all be made into antibacterial agents.

[0209] Experimental Example 3: Determination of multidrug resistance of clinical isolates of Acinetobacter baumannii by double-layer plate method and the inhibitory effect of the antimicrobial peptides of the present invention on multidrug-resistant clinical isolates of Acinetobacter baumannii

[0210] 1) Preparation of strains

[0211] Four clinical isolates of Acinetobacter baumannii were selected and labeled as AB 9, AB 13, AB 14 and AB 15. The -80°C frozen bacterial solution or the 4°C stored bacterial solution was transferred to fresh LB medium at a ratio of 1:100 and shaken at 220 rpm / 37°C until the mid-logarithmic growth period for about 3 hours.

[0212] 2) Preparation of double-layer agar

[0213] Prepare the lower layer of gel in advance: spread about 10 mL of autoclaved LB (containing 1.5% agar powder) on a 10 cm dish, open the lid and air-dry for about ten minutes, and store for later use.

[0214] Preparation of the upper layer gel: After high pressure application of LB containing 0.3% agar powder, place in a 50°C oven for later use.

[0215] 3) Packaging of upper layer glue

[0216] Prepare 10mL centrifuge tubes, add 4mL of upper gel to each tube, and quickly place in a 42℃ water bath

[0217] 4) Dilute the bacterial solution and mix it with the upper layer of glue

[0218] Dilute the bacterial solution in the middle logarithmic growth phase with fresh culture medium at a ratio of 1:5 and add it to the 10 mL centrifuge tube containing the upper layer of gel, mix it by inverting it for about 10 times, and quickly pour it onto the lower layer of agar prepared in advance, spread it evenly, cover it, and let it stand in the biosafety cabinet for 10 minutes until it solidifies. Prepare two double-layer agar plates for each bacteria.

[0219] 5) Experimental treatment of double-layer plates

[0220] ① Determination of multidrug resistance of clinical isolates of Acinetobacter baumannii

[0221] The double-layer agar plates for each bacteria were divided into 5 areas, and different drug-susceptibility sheets (a total of 20 antibiotics, placed in different areas of 4 plates) were placed in the center of each area to allow them to fully adhere to the culture medium and placed at room temperature for 15 minutes.

[0222] ② Determination of antimicrobial peptide RrMbnA OXA Inhibitory effects on multidrug-resistant Acinetobacter baumannii clinical isolates

[0223] Antimicrobial peptide RrMbnA OXA Set up three concentration gradients, 23 mg / mL, 2.3 mg / mL and 0.23 mg / mL, and drip them onto the double-layer agar plate of each bacteria, 1.5 μL / drop; at the same time, drip the same volume of sterile water as a control. Leave at room temperature for 15 minutes.

[0224] 6) After turning the plate over, place it in a 37°C incubator and incubate overnight;

[0225] The drug sensitivity of Acinetobacter baumannii was determined by the presence and size of the inhibition zone.

[0226] The results are as follows Fig.25 As shown:

[0227] Fig.25 It was shown that the four strains of Acinetobacter baumannii (AB9, AB13, AB14 and AB15, all of which were clinical isolates from West China Hospital of Sichuan University) used in the present invention all exhibited multidrug resistance, with inhibition zones of different sizes appearing around different antibiotic filter papers, showing different sensitivities; Table 2 shows the antibiotic tolerance of the four strains of Acinetobacter baumannii.

[0228] Table 2 Antibiotic resistance of Acinetobacter baumannii

[0229]

[0230] At the same time, the antimicrobial peptide RrMbnA OXA It has a significant inhibitory effect on multidrug-resistant Acinetobacter baumannii clinical isolates, such as Fig.26 As shown, the antimicrobial peptide RrMbnA of the four clinical isolates OXA An obvious inhibition zone appeared around the cells, which was concentration-dependent.

[0231] Experimental Example 4: Growth curve method verifies the polypeptide RrMbnA of the present invention OXA Antibacterial activity against four multidrug-resistant Acinetobacter baumannii strains

[0232] 1) Treatment of bacterial solution

[0233] Transfer the -80℃ frozen bacterial solution or the 4℃ stored bacterial solution to fresh culture medium at a ratio of 1:100, shake at 220rpm / 37℃ until the mid-logarithmic growth period, about 3h; then dilute it 1:50 with fresh culture medium, and dispense the bacterial solution into a 96-well cell culture plate with a dispenser, 100μL / well.

[0234] (2) Antimicrobial peptide RrMbnA OXA Processing

[0235] Set up antimicrobial peptide RrMbnA OXA The final concentration was 75 μg / mL, and it was added to the wells of the above 96-well plate, 3 parallel wells / concentration, 2 μL / well. At the same time, a control group was set up: no RrMbnA was added OXA , make up with sterile ultrapure water.

[0236] (3) ELISA instrument to measure bacterial growth in real time

[0237] After the 96-well plate is covered and sealed with sealing tape, it is placed in the microplate reader for measurement. Parameter settings: the detection temperature is 37°C, the plate is shaken at medium speed for 10 seconds before each measurement, the detection wavelength is 600nm, and the detection interval is 15min.

[0238] (4) Data processing

[0239] The software used was Graphpad Prism 8.3.

[0240] result:

[0241] like Fig. 27 As shown, the polypeptide RrMbnA of the present invention OXA It can effectively inhibit the growth of clinical isolates of Acinetobacter baumannii.

[0242] Experimental Example 5: Determination of the minimum effective inhibitory concentration

[0243] Double dilution of antimicrobial peptide RrMbnA OXA Then the growth curve method was used to determine the concentration gradient of the antimicrobial peptide RrMbnA OXA (300μg / mL, 150μg / mL, 75μg / mL, 38μg / mL, 19μg / mL, 9.5μg / mL, 4.7μg / mL, 2.3μg / mL and 1.2μg / mL) The antibacterial activity. The experiment was repeated 3 times. OXA It is effective antibacterial activity but cannot completely kill bacteria. Therefore, the minimum inhibitory concentration (MIC) is defined as: the lowest antimicrobial peptide concentration that effectively inhibits bacterial growth compared with the growth curve of the control group.

[0244] result:

[0245] The minimum inhibitory concentration (MIC) of the antimicrobial peptides against Acinetobacter baumannii was determined by the doubling dilution method. Figure 28-Figure 31 ,in, Fig.28 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB9 at different concentrations; Fig.29 is the antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB13 at different concentrations; Fig.30 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB14 at different concentrations; Fig.31 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB15 at different concentrations. OXA The MIC of the four strains of Acinetobacter baumannii tested was similar, at 38 μg / mL. OXA It has good antibacterial activity.

[0246] Experimental Example 6: Effect of different pH values ​​on the antibacterial effect of antimicrobial peptides

[0247] Antimicrobial peptide RrMbnA OXA The samples were mixed with aqueous solutions of pH 4, 5, 6, 7, 8, 9 and 10 (pH adjusted with NaOH and HCl) in equal amounts and incubated at 37°C for 30 min. The antibacterial activity of the antimicrobial peptides was then determined by the growth curve method. The experiment was repeated 3 times.

[0248] result:

[0249] Antimicrobial peptide RrMbnA OXA The solution was diluted with aqueous solutions of different pH values ​​and the antibacterial activity against four strains of Acinetobacter baumannii, AB9, AB13, AB14 and AB15, was determined after 30 minutes of action. The results are shown in Table 1. Figure 32-Figure 35 ;in, Fig.32 The antibacterial activity of the antimicrobial peptide against Acinetobacter baumannii AB9; Fig.33 The antibacterial activity of the antimicrobial peptide against Acinetobacter baumannii AB13; Fig.34 The antibacterial activity of the antimicrobial peptide against Acinetobacter baumannii AB14; Fig.35 The antibacterial activity of the antimicrobial peptide against Acinetobacter baumannii AB15. OXA It showed good antibacterial activity at pH 4-10, and there was no significant difference between different pH values. OXA It has good acid-base stability.

[0250] Experimental Example 7: Effect of different temperatures on the antibacterial effect of antimicrobial peptides

[0251] Antimicrobial peptide RrMbnA OXA The cells were placed at -80°C, 0°C, 25°C, 50°C, 65°C, 75°C and 100°C for 30 min, and then the antibacterial activity of the antimicrobial peptides was determined by the growth curve method. The experiment was repeated 3 times.

[0252] result:

[0253] Antimicrobial peptide RrMbnA OXA The antibacterial activity against four strains of Acinetobacter baumannii, AB9, AB13, AB14 and AB15, was determined at different temperatures for 30 min. The results are shown in Table 1. Figure 36-Figure 39 .in, Fig.36 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB9 at different temperatures; Fig.37 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB13 at different temperatures; Fig.38 The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB14 at different temperatures; Fig.39The antibacterial activity of antimicrobial peptides against Acinetobacter baumannii AB15 at different temperatures. OXA The antibacterial activity of the antimicrobial peptide RrMbnA did not fluctuate significantly with temperature changes, and all had good antibacterial activity. OXA Has good thermal stability.

[0254] In summary, the present invention provides an antimicrobial peptide, which can be any one of RcASScGAK, RcASScGAKS, TGMRcASScGAK, TGMRcASScGAKS, or a mixed peptide RrMbnA of these four peptides. OXA . The present invention also provides a method for preparing the antimicrobial peptide by heterologous co-expression of the whole enzyme and the substrate, as well as a purification process of the antimicrobial peptide, which can successfully obtain high-yield and high-purity antimicrobial peptides, the required reagents are inexpensive, the operation steps are simple and easy, and it is suitable for large-scale culture and purification; the antimicrobial peptide prepared by the present invention has excellent antimicrobial activity, which provides a new choice for the development of antimicrobial and anti-infective drugs. The antimicrobial peptide of the present invention has an antibacterial effect on a variety of bacteria such as Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Klebsiella pneumoniae, and Acinetobacter baumannii, especially for multidrug-resistant Acinetobacter baumannii. It has excellent antibacterial activity and has good application prospects in the fields of antimicrobial and anti-infective drugs, preservatives, etc.

Claims

1. An antimicrobial peptide, It is characterized in that A mixture comprising any one or more of the following polypeptides: (a) The sequence is the polypeptide shown in SEQ ID NO.1; (b) a polypeptide having a sequence as shown in SEQ ID NO.2; (c) a polypeptide having a sequence as shown in SEQ ID NO.3; (d) a polypeptide having a sequence as shown in SEQ ID NO.4; And the polypeptide sequence includes the following modifications: cysteine ​​is modified to an oxazolone-thioamide group; When the antimicrobial peptide is a mixture of multiple polypeptides, the polypeptide with the sequence shown in SEQ ID NO.1 accounts for more than 60% of the total number of peptide segments.

2. The antimicrobial peptide according to claim 1, It is characterized in that The antimicrobial peptide is RcASScGAK: RcASScGAKS: TGMRcASScGAK: or TGMRcASScGAKS: 。 3. The antimicrobial peptide according to claim 1, It is characterized in that It is prepared by the following method: (1) Preparation of R Gene, R Genes and R Genetic recombinant bacteria; (2) inducing and culturing the recombinant bacteria described in step (1) to obtain a bacterial solution containing antimicrobial peptides; (3) purifying the bacterial solution of step (2) to obtain; The purification in step (3) comprises the following steps: collecting bacteria for crude extraction: centrifuging the bacterial solution obtained in step (2), discarding the supernatant, and resuspending the bacterial precipitate; adding a protease inhibitor to disrupt the bacteria; separating the supernatant and the precipitate; taking the supernatant, which contains the antimicrobial peptide; Crude separation: the supernatant obtained from the crude extraction of the collected bacteria is passed through a nickel column affinity chromatography column to elute the complex; Ultrafiltration separation: The crudely separated complex is centrifuged in an ultrafiltration tube, and the filtrate of the ultrafiltration tube is collected. The pore size of the ultrafiltration membrane in the ultrafiltration tube is 10 kDa; Buffer exchange: The filtrate obtained by ultrafiltration separation is purified by macroporous adsorption resin, the buffer is removed by washing with ultrapure water, and the target component is eluted with 50%~70% acetonitrile or ethanol and then freeze-dried; Repurification by molecular sieve: The freeze-dried powder obtained by resuspending the buffer solution is separated by Superdex 75 10 / 300 GL gel chromatography column, and the elution peak is collected and freeze-dried to obtain the purified antimicrobial peptide; Said R The gene sequence is shown in SEQ ID NO.5; R The gene sequence is shown in SEQ ID NO.6; R The gene sequence is shown in SEQ ID NO.

7.

4. The antimicrobial peptide according to claim 3, It is characterized in that The preparation method of the recombinant bacteria in step (1) is as follows: 1) constructing a recombinant plasmid A containing a nucleotide fragment as shown in SEQ ID NO.5, and a recombinant plasmid B containing a nucleotide fragment as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively; 2) co-transform the recombinant plasmids A and B prepared in step 1) into the engineered bacteria to obtain positive clones; The inducer used in the induction culture in step (2) is IPTG, and the recombinant bacteria is Escherichia coli BL21DE3; the bacterial solution containing antimicrobial peptides is obtained by adding protease inhibitors to the recombinant bacterial cells after induction culture and breaking them.

5. The antimicrobial peptide according to claim 4, It is characterized in that The protease inhibitor was PMSF.

6. The antimicrobial peptide according to claim 4, It is characterized in that In step 1) of the method for preparing the recombinant bacteria, the recombinant plasmid A contains a nucleotide fragment P4 formed by fusion of the RBS region and SEQ ID NO.5; the recombinant plasmid B contains a nucleotide fragment of sequence SEQ ID NO.7 with a protein tag.

7. The antimicrobial peptide according to claim 6, It is characterized in that The protein tag is a 6×His tag.

8. The method for preparing the antimicrobial peptide according to any one of claims 1 to 7, It is characterized in that The steps include: (1') Preparation containing R Gene, R Genes and R Genetic recombinant bacteria; (2') inducing and culturing the recombinant bacteria described in step (1') to obtain a bacterial solution containing antimicrobial peptides; (3') purifying the bacterial solution of step (2'); The purification in step (3') comprises the following steps: collecting bacteria for crude extraction: centrifuging the bacterial solution obtained in step (2'), discarding the supernatant, and resuspending the bacterial precipitate; adding protease inhibitors to disrupt the bacteria; separating the supernatant and the precipitate; taking the supernatant, which contains the antimicrobial peptide; Crude separation: the supernatant obtained from the crude extraction of the collected bacteria is passed through a nickel column affinity chromatography column to elute the complex; Ultrafiltration separation: The crudely separated complex is centrifuged in an ultrafiltration tube, and the filtrate of the ultrafiltration tube is collected. The pore size of the ultrafiltration membrane in the ultrafiltration tube is 10 kDa; Buffer exchange: The filtrate obtained by ultrafiltration separation is purified by macroporous adsorption resin, the buffer is removed by washing with ultrapure water, and the target component is eluted with 50%~70% acetonitrile or ethanol and then freeze-dried; Repurification by molecular sieve: The freeze-dried powder obtained by resuspending the buffer solution is separated by Superdex 75 10 / 300 GL gel chromatography column, and the elution peak is collected and freeze-dried to obtain the purified antimicrobial peptide; Said R The gene sequence is shown in SEQ ID NO.5; R The gene sequence is shown in SEQ ID NO.6; R The gene sequence is shown in SEQ ID NO.

7.

9. The preparation method according to claim 8, It is characterized in that The preparation method of the recombinant bacteria in step (1') is as follows: 1') constructing a recombinant plasmid A containing a nucleotide fragment as shown in SEQ ID NO.5, and a recombinant plasmid B containing a nucleotide fragment as shown in SEQ ID NO.6 and SEQ ID NO.7 respectively; 2') The recombinant plasmids A and B prepared in step 1') are co-transformed into the engineered bacteria to obtain positive clones.

10. The preparation method according to claim 9, It is characterized in that In step 1'), the recombinant plasmid A contains a nucleotide fragment P4 formed by the fusion of the RBS region and SEQ ID NO.5; the recombinant plasmid B contains a nucleotide fragment of sequence SEQ ID NO.7 with a protein tag; The inducer used in the induction culture in step (2') is IPTG, and the recombinant bacteria is Escherichia coli BL21DE3; the bacterial solution containing the antimicrobial peptide is obtained by adding a protease inhibitor to the recombinant bacterial cells after the induction culture and breaking them.

11. The preparation method according to claim 10, It is characterized in that In step 1'), the protein tag is a 6×His tag; The protease inhibitor in step (2') is PMSF.

12. A codon-optimized R Gene, It is characterized in that The sequence is shown as SEQ ID NO.

6.

13. A codon-optimized R Gene, It is characterized in that The sequence is shown as SEQ ID NO.

7.

14. Use of the antimicrobial peptide according to any one of claims 1 to 7 in the preparation of an antimicrobial agent.

15. The use according to claim 14, It is characterized in that The antibacterial agent is a drug that is resistant to any one or more of Acinetobacter baumannii, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa and Klebsiella pneumoniae.

16. The use according to claim 15, It is characterized in that The antibacterial agent is a drug against drug-resistant strains of Acinetobacter baumannii.

Images