An InDel molecular marker linked to rice salt tolerance gene SKC1 and its primers, kit and detection method

Abstract

The present invention provides an InDel molecular marker linked to the rice salt tolerance gene SKC1 and its primers, kit and detection method and its primers, kit and detection method, belonging to genetic engineering. The InDel molecular marker includes the SKC1-69431 marker; the starting end of the SKC1-69431 marker is located at position 11369431 of chromosome 1 of the rice Nipponbare reference genome. The InDel molecular marker provided by the present invention can be used for genotyping by 1.5% agarose gel electrophoresis, thereby reducing the research and development threshold of molecular marker-assisted breeding related research.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and particularly relates to an InDel molecular marker linked to a rice salt-tolerant gene SKC1 and a primer, a kit and a detection method thereof. Background Art

[0002] Salt tolerance of rice refers to its ability to tolerate and resist salt stress in a salt environment, and is a quantitative trait (QTL) controlled by multiple genes. At present, most of the QTLs located for rice salt tolerance are micro-effect QTLs, and their contribution to salt tolerance phenotypic variation is relatively low. Salt tolerance identification at the seedling stage and throughout the growth period is the most commonly used salt tolerance identification method in traditional breeding, but the determination of salt tolerance level requires the naked eye of the observer, which is greatly affected by subjective factors.

[0003] Previous studies have shown that the dominant gene SKC1 located on chromosome 1 of rice is a major salt tolerance QTL. In the backcross population constructed by Koshihikari and Nonabokra, this gene can explain 40.1% of the phenotypic variation. SKC1 encodes an ion transporter of the HKT family. This gene is expressed in the parenchyma cells around the xylem vessels and has Na + Physiological analysis showed that SKC1 is involved in the regulation of K transport under salt stress. + / Na + Homeostatic regulation can reduce K + / Na + The study showed that Koshihikari contains the salt-intolerant skc1 allele, while Nonabokra contains the salt-tolerant SKC1 allele.

[0004] Since the determination of rice salt tolerance is relatively complicated and requires a special salt water pool, the salt tolerance at different stages is greatly affected by the environment, such as treatment time and plant size. In addition, the salt tolerance identification method is subject to the subjective influence of the observer and requires rich phenotypic identification experience. Therefore, the salt tolerance phenotypic identification work has brought a lot of inconvenience to breeders, and it is difficult to screen out salt-tolerant strains. The development of molecular marker technology has reduced the reliance of breeders on phenotypic selection, thereby accelerating the selection of salt-tolerant rice varieties, and has been welcomed by breeders.

[0005] There are two main types of SKC1 molecular markers published in the literature. One is the CAPS marker (Cleavage Amplified Polymorphic Sequence), which requires PCR (Polymerase Chain Reaction) amplification and then enzyme digestion and electrophoresis. The steps are complicated and the reagents are expensive. The other is the KASP (Kompetitive Allele Specific PCR) marker. The identification of this molecular marker requires separate and expensive detection equipment. Generally, grassroots breeding units do not have special funds to purchase such equipment and do not have the conditions for detection, which often hinders molecular breeding. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide an InDel molecular marker linked to the rice salt-tolerance gene SKC1 and its primers, kit and detection method. The InDel molecular marker provided by the present invention enables genotyping by 1.5% agarose gel electrophoresis, so that grassroots breeding units with insufficient equipment and experimental conditions can also carry out molecular marker-assisted breeding, thereby lowering the threshold of molecular marker-assisted breeding.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides an InDel molecular marker linked to a rice salt-tolerance gene SKC1, wherein the InDel molecular marker is obtained by amplifying the SKC1-69431 primer;

[0009] The nucleotide sequence of the upstream primer of the SKC1-69431 primer is shown in SEQ ID No. 1: AGGAAAAGACGAACTGAAGC;

[0010] The nucleotide sequence of the downstream primer of the SKC1-69431 primer is as shown in SEQ ID No. 2: ATGAGCCGGTAGATGTCCCT.

[0011] In the present invention, the InDel molecular marker includes the SKC1-69431 marker; the starting end of the SKC1-69431 marker is located at position 11369431 of chromosome 1 of the rice Nipponbare reference genome;

[0012] The present invention also provides a kit for detecting the rice salt tolerance gene SKC1, the kit comprising the above-mentioned SKC1-69431 primer. In the present invention, the kit also preferably contains reagents used for PCR amplification, such as rTaq enzyme, 10×buffer and 2×dNTP, etc. The present invention does not specifically limit the storage amount of each reagent in the kit, and those skilled in the art can store it according to the conventional amount of the kit.

[0013] The present invention also provides an application of the InDel molecular marker and / or the kit in detecting the rice salt-tolerance gene SKC1.

[0014] The present invention provides a method for detecting a rice salt-tolerance gene SKC1, the method comprising the following steps:

[0015] 1) Using the extracted DNA of the tested rice as a template, PCR amplification was performed using the above-mentioned primer SKC1-69431 to obtain a PCR product;

[0016] 2) When the length of the PCR product obtained by amplification in step 1) is 287 bp or 260 bp, the tested rice contains the salt-tolerance gene, which is the SKC1 allele;

[0017] When the length of the PCR product obtained by amplification in step 1) is 884 bp, the tested rice does not contain the salt-tolerance gene and is of the skc1 allele.

[0018] In the present invention, the site for extracting rice DNA in step 1) is rice leaves. The present invention has no particular limitation on the method for extracting rice leaf DNA, and those skilled in the art can use conventional methods, such as the CTAB method.

[0019] In the present invention, the PCR amplification procedure in step 1) includes: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min; 25°C for 2 min.

[0020] In the present invention, the PCR amplification system in step 1) includes: each 15 μL consists of 0.25 μL of 10 μmol forward primer, 0.25 μl of 10 μmol reverse primer, 0.15 μL of rTaq enzyme, 1.5 μL of 10×buffer, 1.75 μL of 2×dNTP and 12.1 μL of ddH2O.

[0021] The present invention also provides application of the above InDel molecular marker and / or the above kit in rice breeding.

[0022] The beneficial effects of the present invention are:

[0023] Compared with the current detection method for rice salt tolerance gene SKC1, the present invention only needs to use agarose electrophoresis for detection, which is very suitable for grassroots breeding units for molecular breeding. The main advantages are as follows: Compared with polyacrylamide gel electrophoresis, agarose electrophoresis has the advantages of fast gel preparation time, easy operation, non-toxicity and low price; compared with markers such as CAPS, the use of InDel markers does not require restriction endonuclease digestion again after amplification, which saves time and labor; compared with markers such as KASP, this marker detection method does not require special reagents and expensive detection equipment, and can be performed using an ordinary electrophoresis instrument, which is very suitable for grassroots breeding units to carry out molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is a flow chart of the present invention;

[0025] Figure 2 This is a diagram of the SKC1-69431 InDel marker polymorphism screening results;

[0026] The samples are arranged from left to right: Reyan1, Reyan2, Nonabokra, Haiyan2, Koshihikari, Yandao160, Nipponbare and Zhenshan97.

[0027] Among them, Reyan1, Reyan2, Nonabokra, Haiyan2, Yandao160 and Zhenshan97 are certified salt-tolerant varieties, while Koshihikari and Nipponbare are certified salt-intolerant varieties.

[0028] Figure 3 This is the result of testing the germplasm genotype of SKC1-69431;

[0029] The A, B, and C banding patterns are shown as PCR products of 260 bp, 287 bp, and 884 bp;

[0030] Figure 4 Several representative varieties of germplasm resources were identified for salt tolerance at the seedling stage;

[0031] From left to right: Nipponbare, Koshihikari, Reyan1, Yandao160 and Nonabokra. DETAILED DESCRIPTION

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1

[0034] The rice materials used in the present invention are mainly derived from some micro-core germplasm resources, including some approved salt-tolerant rice varieties, and also include some intermediate materials for breeding.

[0035] DNA was extracted using the CTAB method, and the source of DNA was rice leaves.

[0036] Primer design:

[0037] According to the information in the RGAP database (http: / / rice.uga.edu / ), the physical location of SKC1 was found to be Chr1:11458955-11463442 (LOC number of MSU: LOC_Os01g20160). After comparing the three published genomes: Minghui 63 and Zhenshan 97 (sequences from RIGW (http: / / rice.hzau.edu.cn / rice_rs3 / )) and the SKC1 gene sequence of Nipponbare (sequences from the RGAP database), it was found that there was no difference in InDel. Therefore, 20-70 bp InDel was screened in the 100 kb interval upstream and downstream of SKC1, and a total of 1 InDel was obtained. This InDel is closely linked to the SKC1 gene and can often be used as a linkage marker to identify the genotype of SKC1 in breeding, and its effect is basically the same as the internal marker of SKC1 gene. Primers were designed using the online primer design website BatchPrimer3 (http: / / probes.pw.usda.gov / batchprimer3 / ) (Table 1). Primers were commissioned to be synthesized by Tianyi Huiyuan Company. SKC1-69431 is located 89.5 kb upstream of SKC1 and is a tightly linked marker of SKC1, which can be used to identify the SKC1 gene. The flow chart of the present invention is shown in FIG. Figure 1 shown.

[0038] Table 1 Marking information

[0039]

[0040] Example 2

[0041] The design process of molecular markers is as follows: the physical location is determined by cloning the target gene SKC1, and the InDel information within the 100 kb upstream and downstream intervals is extracted based on the released genome sequences of Minghui 63, Zhenshan 97 and Nipponbare. The primer sequences are designed and synthesized, and the primers obtained in Example 1 are screened and tested for the markers.

[0042] 1. Sample testing

[0043] PCR product test: PCR product test was performed on a six-one electrophoresis instrument. 20 ng of DNA sample was added to the microwell reaction plate, and the reaction system was shown in Table 2.

[0044] The PCR reaction conditions were as follows: pre-denaturation at 94°C for 3 minutes; amplification program was denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 30 seconds, extension at 72°C for 5 minutes after 35 cycles, and termination of the reaction at 25°C for 2 minutes.

[0045] After the PCR product reaction is completed, electrophoresis is performed in a 61 electrophoresis instrument, and the gel is photographed after electrophoresis at 400V and 200mA for 30 minutes. The genotype is determined according to the size of the product after electrophoresis. If the sample amplification product is the "Zhenshan 97" genotype (PCR product is 287bp) or the Nonabokra genotype (PCR product is 260bp), the tested rice sample is determined to be homozygous for the salt-tolerant genotype SKC1; if the sample amplification product is the "Koshihikari" genotype (PCR product is 884bp), the tested rice sample is determined to be homozygous for the non-salt-tolerant genotype skc1.

[0046] Table 2 PCR amplification system

[0047]

[0048]

[0049] 2. Genotype data

[0050] According to the above detection method, the designed markers were verified using the donor Nonabokra with the salt-tolerance gene SKC1 and several other salt-tolerant varieties Reyan1, Reyan2, Haiyan2, Yandao160, Zhenshan97 and the salt-intolerant rice varieties Koshihikari and Nipponbare. The SKC1-69431 marker could be normally typed ( Figure 2). The detection result of SKC1-69431 on the donor Nonabokra of SKC1 was that it carried the salt-tolerant genotype SKC1 (band type A); the detection results of several other salt-tolerant varieties Reyan1, Reyan2, Haiyan2, Yandao160, and Zhenshan97 were that they carried the salt-tolerant genotype SKC1 (band type B); the control varieties Koshihikari and Nipponbare were not carrying the salt-tolerant genotype skc1 (band type C), which proved the accuracy of the present invention in detecting the SKC1 gene.

[0051] 3. Genotype verification of germplasm resource population

[0052] SKC1-69431 was selected as the identification marker for 96 germplasm resource populations SKC1. Figure 3 The results of natural population typing of the marker are shown in Table 3. It can be seen from Table 3 that 25 rice materials were detected with the haplotype of Nonabokra (band type A); 32 rice materials were detected with the haplotype of Zhenshan 97 (band type B), and both genotypes belong to the homozygous SKC1 genotype; the remaining 39 materials were salt-intolerant skc1 genotypes (band type C). It can be seen from the name of the variety in the table that the skc1 genotype has been used in the common rice salt tolerance breeding tested, so the SKC1-69431 marker can be used for the efficient detection of the rice SKC1 gene.

[0053] Table 3 InDel molecular marker identification germplasm resource typing data

[0054]

[0055]

[0056]

[0057]

[0058] 4. Verification of salt tolerance of germplasm resource population

[0059] In order to verify the correspondence between the salt tolerance of germplasm resources and genotypes, the salt tolerance of germplasm resources was identified at the seedling stage. The germplasm resources were sown in small red buckets and treated with 0.6% (M / V, 600gNaCl / 1000L tap water) salt at the 6-7 leaf stage. The salt tolerance phenotype was statistically analyzed 3 weeks after the treatment. The salt tolerance grade was based on the seedling salt tolerance identification standard established by the International Rice Research Institute (IRRI) (Table 4), with the "average percentage of dead leaves" as the grading standard for rice salt tolerance at the seedling stage. Several representative individual plants such as Figure 4 Among them, Nipponbare and Koshihikari have a salt tolerance level of 1, and the corresponding SKC1-69431 genotype is C; Reyan1 has a salt tolerance level of 5, Yandao160 has a salt tolerance level of 7, and the corresponding SKC1-69431 genotype is B; Nonabokra has a salt tolerance level of 9, and the SKC1-69431 genotype is A. After the salt tolerance phenotypes were matched to the genotypes one by one, as shown in Table 3, the average salt tolerance level corresponding to the A genotype was 6.4±1.7, the average salt tolerance level corresponding to the B genotype was 6.3±1.6, and the average salt tolerance level corresponding to the C genotype was 1.9±1.3. There was no difference in the salt tolerance level between the A genotype and the B genotype in the t test (P=0.68), and there were significant differences between A and C (P<0.01) or between B and C (P<0.01). This shows that the A genotype and the B genotype belong to the salt tolerance allele, and there is no difference in salt tolerance between the two alleles, while the C allele belongs to the salt intolerant allele, and the salt tolerance is poor.

[0060] Table 4 Classification standard of average dead leaf percentage of rice salt tolerance

[0061] level Average dead leaf percentage (%) Salt resistance level 1 80.1～100 Very weak 3 60.1～80.0 weak 5 40.1～60.0 middle 7 20.1～40.0 powerful 9 0.0～20.0 Very strong

[0062] Note: This table is developed with reference to the International Rice Research Institute. Average dead leaf percentage = number of dead leaves per plant / total number of leaves per plant.

[0063] It can be concluded from the above embodiments that the present invention selects molecular markers with larger InDels so that they can be genotyped by 1.5% agarose gel electrophoresis, thereby enabling grassroots breeding units with insufficient equipment and experimental conditions to carry out molecular marker-assisted breeding linked to the salt-tolerance gene SKC1, thereby lowering the threshold for molecular marker-assisted breeding.

[0064] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An InDel molecular marker linked to the rice salt tolerance gene SKC1, characterized in that: The InDel molecular marker is obtained by amplification with primer SKC1-69431; The nucleotide sequence of the upstream primer of the SKC1-69431 primer is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer of the SKC1-69431 primer is shown in SEQ ID No.

2.

2. A kit for detecting the rice salt tolerance gene SKC1, characterized in that: The kit comprises the SKC1-69431 primer according to claim 1.

3. Use of the InDel molecular marker according to claim 1 and / or the kit according to claim 2 in detecting the rice salt tolerance gene SKC1.

4. A method for detecting the rice salt-tolerance gene SKC1, characterized in that: The detection method comprises the following steps: 1) using the extracted DNA of the tested rice as a template, and performing PCR amplification using the primer SKC1-69431 described in claim 1 to obtain a PCR product; 2) When the length of the PCR product obtained by amplification in step 1) is 287 bp or 260 bp, the tested rice contains the salt-tolerance gene, which is the SKC1 allele; When the length of the PCR product obtained by amplification in step 1) is 884 bp, the tested rice does not contain the salt-tolerance gene and is of the skc1 allele.

5. The detection method according to claim 4, characterized in that: The site for extracting rice DNA in step 1) is the rice leaves.

6. The detection method according to claim 4, characterized in that: The PCR amplification procedure in step 1) includes: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, 72°C for 30 s, 35 cycles; 72°C for 5 min; 25°C for 2 min.

7. The detection method according to claim 4, characterized in that: The PCR amplification system in step 1) includes: each 15 μL consists of 0.25 μL of 10 μmol upstream primer, 0.25 μl of 10 μmol downstream primer, 0.15 μL of rTaq enzyme, 1.5 μL of 10×buffer, 0.75 μL of 2×dNTP and 12.1 μL of ddH2O.

Images