Preparation method and application of targeted nanovesicles derived from cells

Abstract

The present invention discloses a preparation method and application of targeted nanovesicles derived from cells. The intracellular nanovesicles of the present invention have a large yield, a small particle size, a narrow particle size distribution range, and have a higher encapsulation rate and drug loading rate when used as a carrier to load drugs. The distribution range and degree are wider under the vitreous cavity injection mode. For example, the loaded drug can be absorbed faster under the vitreous cavity injection form, and has very good application and research value in the medical field. In particular, the present invention gives the intracellular nanovesicles targeting, and obtains targeted intracellular nanovesicles by modifying Lamp2b to carry a targeting peptide. The nanovesicles provided by the present invention have a large yield and strong targeting, can more efficiently play a therapeutic role or a drug carrier role, and have very good application prospects and research value.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a preparation method and application of targeted nanovesicles derived from cells, in particular to applications in eye diseases. Background Art

[0002] Cell secretions called "extracellular vesicles" (EVs) released by cells outside the cells or into the plasma and entering the blood circulation have received extensive attention and research. "Extracellular vesicles" are mainly divided into three categories: exosomes, microvesicles or microparticles, and apoptotic bodies, among which the main component is exosomes. At present, exosomes are widely used in the treatment of various damage repair and immune diseases. However, the cell targeting of exosomes still needs to be further improved to reduce side effects and improve efficacy. Secondly, the efficiency of cell secretion of exosomes is limited, and it takes a lot of time to collect a certain amount of exosomes. Therefore, further improving its targeting, biosafety and yield is a problem that needs to be solved in the future.

[0003] Modification strategies for cell nanovesicles include genetic engineering and chemical modification. By using genetic engineering to fuse the gene sequence of the target protein or peptide with the gene sequence of the selected exosome surface protein, the target protein or guide peptide can be expressed on the surface of the exosome. Lysosome associated membrane protein 2b (Lamp2b) is a member of the Lamp family and is a membrane protein that can be used to carry targeted proteins or peptides.

[0004] In addition, there are a large number of nanovesicles in the cell, which are free between various membrane-rich organelles, mediating the intracellular material transport and the cell's secretory pathway. Among them, constitutive secretory vesicles are the main type of intracellular vesicles (IVs), which are produced by the endoplasmic reticulum and exchange substances with the Golgi apparatus, lysosomes and cell membranes, mediating the production, transportation and secretion of various secretory proteins in the cell. It is rich in content and contains a large number of secretory proteins, lipids and nucleic acid molecules. So far, there has been no report on how to enrich and apply intracellular nanovesicles. In addition, our previous results found that compared with EVs, these intracellular nanovesicles have smaller particle sizes, more transmembrane protein Lamp2b content, higher drug delivery efficiency, and are more suitable for disease treatment and drug delivery.

[0005] Autoimmune uveitis is a common blinding eye disease that mainly affects the uvea and retina. It can cause a variety of eye complications such as cataracts, glaucoma, macular degeneration and optic atrophy, leading to severe vision loss. CD4-positive T helper cells (Th cells), especially Th1 cells that secrete IFN-γ and Th17 cells that secrete IL-17A, are the main effector T cells in autoimmune uveitis. Their abnormal activation plays an important pathogenic role in the occurrence of the disease. CD40L belongs to the TNF superfamily and is considered to be an early activation marker of CD4 + T lymphocytes. CD40 / CD40L participates in triggering multiple downstream immune signaling pathways. Early studies have shown that CD40 / CD40L costimulatory signaling is necessary for the production of T cell-dependent antibody responses and memory B cell differentiation. After CD40 / CD40L signal activation in macrophages and DC cells, cytokine secretion and surface activation molecule expression are induced, which participates in regulating the cross-stimulation and activation of CD4 + T cells and CD8 + T cells. In various autoimmune diseases, there is also dysregulation of the expression of the CD40 / CD40L signaling pathway, which may promote the initiation or maintenance of pathogenic autoimmune responses. Therefore, targeting the CD40 / CD40L pathway is expected to become a new therapeutic strategy for autoimmune diseases.

[0006] Pathological retinal neovascularization (RNV) is a key pathological change in several common blinding retinal diseases, including diabetic retinopathy (DR), diabetic macular edema, retinal vascular occlusion, retinopathy of prematurity (ROP), etc. Current clinical treatments include intravitreal injection of anti-VEGF drugs, retinal photocoagulation, and vitrectomy. Although intravitreal injection of anti-VEGF drugs can inhibit the further formation of retinal and choroidal NV, its therapeutic effect has been controversial. About 30% of patients do not respond well to anti-VEGF drug treatment, and laser and surgical treatments have limited effects. A considerable number of patients still lose their visual function. Therefore, it is necessary to find more effective and safer alternatives.

[0007] Previous studies have shown that mesenchymal stem cells (MSCs) have the effects of promoting wound repair and neuroprotection, and are widely used in the treatment of retinal and nervous system diseases. However, their disadvantages in cell proliferation limit their clinical transformation and application. MSC-derived vesicles have the biological characteristics of stem cells, are nucleus-free and genetically non-specific, and have great prospects for transformation and application. Modifying vesicles to make them targeted can improve the bioavailability of vesicles. Therefore, it is of great significance to modify intracellular nanovesicles to make them targeted, conduct research on autoimmune uveitis and retinal neovascularization, and find drugs to treat autoimmune uveitis and retinal neovascularization. Summary of the invention

[0008] In order to overcome the deficiencies of the prior art, the present invention provides a method for preparing and applying targeted nanovesicles derived from cells, in particular, applying the nanovesicles as drug carriers with targeting functions.

[0009] In a first aspect of the present invention, a targeted nanovesicle derived from a cell is provided, which overexpresses a fusion protein of a targeting molecule-Lamp2b.

[0010] Specifically, the targeting molecule includes but is not limited to polypeptides, antibodies, activating or inhibiting receptors, protein ligands, biologically active enzymes, nucleic acid drugs, or combinations thereof, and in particular, the targeting molecule is a polypeptide.

[0011] In some embodiments of the present invention, the targeting molecule is A25 polypeptide, and the intracellular nanovesicles can target T cells.

[0012] In some embodiments of the present invention, the targeting molecule is RGD polypeptide, and the intracellular nanovesicles can target neovascularization (eg, retinal neovascularization).

[0013] Specifically, the targeting molecule is located at the N-terminus of Lamp2b.

[0014] Specifically, the fusion protein structure includes:

[0015] 1) N-terminus of Lamp2b-targeting molecule-C-terminus of Lamp2b;

[0016] 2) Targeting molecule - N-terminus of Lamp2b.

[0017] Specifically, the vesicle is spherical or coaster-shaped.

[0018] Specifically, the average particle size of the vesicles is 50-100 nm (e.g., 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 nm), in particular 65-85 nm.

[0019] Specifically, the cells are derived from mammals, especially humans.

[0020] Specifically, the cells are eukaryotic cells, in particular at least one of stem cells, cardiomyocytes, human embryonic kidney cells (293T), macrophages, T cells and tumor cells; more specifically, the stem cells are mesenchymal stem cells (MSC), including but not limited to: umbilical cord mesenchymal stem cells (UC-MSC), bone marrow mesenchymal stem cells (BM-MSC), adipose mesenchymal stem cells (AD-MSC), dental pulp mesenchymal stem cells, placenta and amniotic fluid, and amniotic membrane mesenchymal stem cells.

[0021] In some embodiments of the present invention, the cells are mesenchymal stem cells, in particular umbilical cord mesenchymal stem cells (UC-MSCs).

[0022] In some embodiments of the present invention, the cells are epithelial cells, such as 293T cells.

[0023] In some embodiments of the present invention, the cell is a tumor cell, such as a Hela cell.

[0024] Specifically, the vesicles are prepared by the method described in the second aspect of the present invention.

[0025] In a second aspect of the present invention, a method for preparing the above-mentioned vesicles is provided.

[0026] Specifically, the method comprises the steps of sequentially subjecting cells overexpressing the fusion protein of the targeting molecule-Lamp2b to ultrasonic treatment, centrifugation treatment, and ultracentrifugation treatment.

[0027] Specifically, the method comprises the following steps:

[0028] (1) Introducing nucleotides encoding a fusion protein of the targeting molecule-Lamp2b into cells;

[0029] (2) dispersing the cells obtained in step (1) in a suspending solvent and subjecting them to ultrasonic treatment;

[0030] (3) centrifuging the liquid obtained in step (2) once or multiple times, discarding cell membranes and organelle fragments, and taking the supernatant;

[0031] (4) subjecting the supernatant obtained in step (3) to ultracentrifugation to obtain the precipitate as intracellular nanovesicles;

[0032] Optionally, (5) resuspending the precipitate obtained in step (4).

[0033] Specifically, the method for introducing the nucleotide encoding the fusion protein of the targeting molecule-Lamp2b into the cell in step (1) can be carried out by transformation, transduction, transfection, infection and the like. The nucleotide can be introduced into the cell via a vector, wherein the vector includes a plasmid vector and a viral vector. The viral vector can be, for example, a reverse transcription vector, a lentiviral vector or other vector (e.g., an adenoviral vector, an adeno-associated viral vector).

[0034] In some embodiments of the present invention, step (1) comprises: constructing a plasmid that overexpresses a fusion protein of the targeting molecule-Lamp2b, then packaging the plasmid into a lentivirus, and transfecting cells with the lentivirus.

[0035] In one embodiment of the present invention, the step of constructing the overexpression plasmid comprises: inserting the cDNA fragment encoding the A25 peptide and Lamp2b downstream of the CMV promoter in the vector plasmid.

[0036] Specifically, the cells in step (2) are cells isolated after culture, digestion and washing (after discarding the cell culture medium, digestion, washing and other steps, the possibility of isolating and obtaining extracellular vesicles can be eliminated).

[0037] Specifically, the method may also include cell digestion and counting steps; in some embodiments of the present invention, the cell digestion step includes: culturing cells to grow to 90% confluence, discarding the cell culture medium, washing the cells, adding trypsin to digest the cells, and then neutralizing and washing the cells.

[0038] Specifically, the cell density of the cells in the suspension solvent is 1-4×10 6 / mL, for example 1×10 6 / mL, 2×10 6 / mL, 3×10 6 / mL, 4×10 6 In some embodiments of the present invention, the cell density is 1×10 6 Pieces / mL.

[0039] Specifically, the suspension solvent is any buffer suitable for culturing cells, such as PBS, Tris buffer, glycine buffer. In some embodiments of the present invention, the solvent is PBS.

[0040] Specifically, the amplitude of the ultrasonic treatment in step (2) is 20%-35% (e.g., 20%, 25%, 30%, 35%), for example, 20%-30%.

[0041] Specifically, the amplitude of the ultrasonic treatment in step (2) is 20%-25% (e.g., 20%, 22%, 24%, 25%); in some embodiments of the present invention, the amplitude of the ultrasonic treatment is 20%.

[0042] Specifically, the ultrasonic treatment time in step (2) is 10-60 s (e.g., 10, 15, 20, 25, 30, 60 s), for example, 10-30 s.

[0043] Specifically, the ultrasonic treatment time in step (2) is 10-20 s (e.g., 10, 15, 18, 20 s), preferably 15 s. In some embodiments of the present invention, the ultrasonic treatment time is 15 s, on 2 s, off 2 s.

[0044] In some embodiments of the present invention, the number of centrifugation treatments in step (3) is two times, and the respective parameters are:

[0045] 1000-3000 g (e.g. 1000, 1500, 2000, 2500, 3000 g), 5-20 minutes (e.g. 5, 8, 10, 12, 15, 20 minutes);

[0046] 10000-30000 g (e.g. 10000, 15000, 20000, 25000, 30000 g), 20-40 min (e.g. 20, 25, 28, 30, 32, 35, 40 min).

[0047] In one embodiment of the present invention, the first centrifugation is performed at 2000 g for 10 minutes.

[0048] In one embodiment of the present invention, the second centrifugation is performed at 20,000 g for 30 minutes.

[0049] Specifically, the parameters of the ultracentrifugation treatment in step (4) include 100,000-180,000 g (e.g., 100,000, 120,000, 140,000, 150,000, 160,000, 180,000), 50-100 minutes (e.g., 50, 60, 65, 70, 75, 80, 90, 100 minutes).

[0050] In one embodiment of the present invention, the ultracentrifugation is performed at 150,000 g for 70 minutes.

[0051] Specifically, the resuspension solvent in step (5) is any buffer suitable for culturing cells, such as PBS, Tris buffer, glycine buffer. In some embodiments of the present invention, the resuspension solvent is PBS.

[0052] Specifically, one or more of the ultrasonic treatment, centrifugal treatment and ultracentrifugal treatment are performed at low temperature, such as 0-5°C; in particular, the ultrasonic treatment, centrifugal treatment and ultracentrifugal treatment are all performed on ice.

[0053] In some embodiments of the present invention, the method comprises: taking 1×10 6 For a cell suspension with a density of cells / mL, the ultrasonic probe was placed in the center of the liquid surface, and ultrasonic treatment was performed with an ultrasonic amplitude parameter range of 20% and a time parameter range of 15s, on 2s, and off 2s; the liquid was then transferred to a centrifuge tube for centrifugation with centrifugation parameters of 2000g×10min and 20000g×30min, and the supernatant was collected; the supernatant was transferred to an ultracentrifuge tube for centrifugation with centrifugation parameters of 150000g×70min.

[0054] In the third aspect of the present invention, there is provided use of the vesicles described in the first aspect as a drug carrier in the preparation of drugs for preventing and / or treating diseases.

[0055] In a preferred embodiment of the present invention, the disease is an eye disease, in particular a uveal or retinal related disease, including, but not limited to, uveitis, such as autoimmune uveitis; retinal vascular diseases, such as retinal artery occlusion, retinal vein occlusion, retinal periphlebitis, diabetic retinopathy, hypertensive retinopathy, retinopathy of prematurity, etc.; macular diseases, such as central serous chorioretinopathy, age-related macular degeneration, myopic macular degeneration, cystoid macular edema, macular hole, macular epiretinal membrane, etc.; retinal detachment diseases, such as rhegmatogenous retinal detachment, tractional retinal detachment, exudative retinal detachment, etc.; retinitis pigmentosa; retinal tumor diseases, such as retinoblastoma, etc.; and other eye diseases, such as glaucoma, dry eye, other ocular inflammatory diseases (such as blepharitis, blepharokeratoconjunctivitis, conjunctivitis, keratitis, optic neuritis, etc.), optic nerve damage (such as optic neuritis, optic atrophy, papilledema, ischemic optic neuropathy, etc.), ocular tumors, etc.

[0056] Specifically, ocular tumors include tumors of any ocular tissue or any ocular cell, including, but not limited to, choroidal tumors, conjunctival tumors, eyelid tumors, invasive intraocular tumors, iris tumors, metastatic ocular tumors, optic nerve tumors, orbital tumors, and retinal tumors. More specifically, including, but not limited to, choroidal tumors, such as choroidal hemangioma, choroidal melanoma, choroidal metastasis, choroidal nevus, choroidal osteoma, ciliary body melanoma and Ota nevus; conjunctival tumors, such as conjunctival Kaposi's sarcoma, ocular surface dermoid cyst, conjunctival lymphoma, atypical melanoma and PAM, pigmented conjunctival tumor, palpebral fissure macules, pterygium, squamous cell carcinoma and conjunctival intraepithelial neoplasm; eyelid tumors, such as basal cell carcinoma, capillary hemangioma, hidradenoma, palpebral nevus, seborrheic keratosis, eyelid malignant melanoma, eyelid sebaceous gland carcinoma and eyelid squamous cell carcinoma; invasive intraocular tumors, such as chronic lymphocytic leukemia, eyelid tumors, choroidal and intraocular lymphoma; invasive choroidopathy and intraocular lymphoma; Iris tumors, such as anterior uveal metastasis, iris cyst, iris melanocytoma, iris melanoma and iris pearly cyst; metastatic eye tumors, such as metastatic choroidal melanoma; optic nerve tumors, such as choroidal melanoma affecting the optic nerve, peripapillary metastasis of optic neuropathy, optic nerve melanocytoma and optic nerve sheath meningioma; orbital tumors, such as adenoid cystic carcinoma of the lacrimal gland, cavernous hemangioma of the orbit, lymphangioma of the orbit, orbital mucocele, orbital inflammatory pseudotumor, orbital rhabdomyosarcoma, childhood periocular hemangioma and sclerosing inflammatory pseudotumor; retinal tumors, such as retinal pigment epithelial (RPE) hyperplasia, retinal pigment epithelial (RPE) tumor, retinoblastoma, von Hippel angioma.

[0057] In some embodiments of the present invention, the vesicle is an intracellular nanovesicle modified by overexpression of A25-Lamp2b (sIVs-A25), and the disease is autoimmune uveitis.

[0058] In some embodiments of the present invention, the vesicles are RGD-Lamp2b overexpression-modified intracellular nanovesicles (sIVs-RGD), and the disease is retinal neovascularization disease, such as diabetic retinopathy, diabetic macular edema, retinal vascular occlusion, and retinopathy of prematurity.

[0059] Specifically, the vesicles are used as drug carriers to load active pharmaceutical ingredients, such as active pharmaceutical ingredients for the above-mentioned eye diseases; the active pharmaceutical ingredients include one or more of chemical drugs (such as rapamycin, methotrexate), biological drugs (such as proteins (such as PEDF, Lucentis), polypeptides (such as KV11, PEDF34mer, PEDF P5-3), oligonucleotide drugs (such as siRNA)), natural drugs, nanomedicines, radioactive drugs, photothermal therapy and photodynamic therapy drugs.

[0060] Specifically, the polypeptide and protein drugs can be, for example, cytokines (such as interleukins (such as IL-1, IL-2, IL-6, IL-10, IL-11), colony stimulating factors (such as granulocyte colony stimulating factor (G-CSF) and macrophage colony stimulating factor (M-CSF)), interferons (such as α, β, γ interferons), growth factors (such as pigment epithelium-derived factor), tumor necrosis factor (such as TNF-α and TNF-β), transforming growth factor-β family or chemokine family, etc.), human hemoglobin, coagulation factor, Blood factors, vascular endothelial growth factor antibody antagonists, protein hormones (such as insulin, glucagon, calcitonin, hypothalamic hormones, pituitary hormones or gastrointestinal hormones, etc.), antibodies (such as monoclonal antibodies, polyclonal antibodies, dimers, polymers, multispecific antibodies or antibody fragments), enzymes and coenzyme drugs (phenylalanine lyase, arginase, arginine deacylase, pancreatic ribonuclease, superoxide dismutase, asparaginase, glucocerebrosidase or hyaluronidase), other polypeptide drugs (such as KV11, PEDF34mer, PEDF P5-3, etc.).

[0061] In some embodiments of the present invention, the vesicle is sIVs-A25, and the active pharmaceutical ingredient can be hormones, immunosuppressive drugs (rapamycin, methotrexate), siRNA, proteins (such as IL-10) and peptides.

[0062] In some embodiments of the present invention, the vesicle is sIVs-RGD, and the active pharmaceutical ingredient can be siRNA, protein (such as PEDF, Lucentis), or polypeptide (such as KV11, PEDF34mer, PEDF P5-3).

[0063] Specifically, the drug delivery method can be a combination of one or more methods selected from the group consisting of genetic engineering, chemical synthesis, viral vector, ultrasound, electroporation, and co-incubation.

[0064] Specifically, the drug can be administered in any suitable manner, in particular intraocular administration, such as eye drops, eye ointment, retrobulbar injection, parabulbar injection, subconjunctival injection, intravitreal injection, in particular intravitreal injection.

[0065] Specifically, the drug can be formulated into any suitable preparation form, such as, but not limited to, cream, foam, cream, ointment, emulsion, liquid solution, eye drops, injection, powder injection, gel, spray, suspension, microemulsion, eye mask or contact lens, etc., especially injection.

[0066] In a fourth aspect of the present invention, a method for preparing drug-loaded vesicles is provided, which comprises using the vesicles described in the first aspect of the present invention as drug carriers for drug loading.

[0067] Specifically, the drug loading method can be a combination of one or more methods selected from the group consisting of genetic engineering, chemical synthesis, viral vector, ultrasound, electroporation, and co-incubation, in particular the co-incubation method.

[0068] Specifically, the drug loading step includes: mixing the vesicles with active pharmaceutical ingredients and incubating;

[0069] Optionally, free pharmaceutically active ingredient is removed (eg by ultrafiltration centrifugation).

[0070] Specifically, the incubation temperature is 35-40°C (eg 35, 36, 37, 38, 39, 40°C), in particular 37°C.

[0071] Specifically, the incubation time is 1-2 hours (eg 1, 1.2, 1.5, 2 hours), in particular 1 hour.

[0072] In some embodiments of the present invention, the ultrafiltration membrane parameter is 100 kD.

[0073] Specifically, the method for preparing the drug-loaded vesicles may also include the method steps for preparing vesicles described in the first aspect of the present invention.

[0074] In a fifth aspect of the present invention, a drug-loaded vesicle is provided, which uses the vesicle described in the first aspect of the present invention as a drug carrier.

[0075] Specifically, the drug in the drug-loaded vesicle is as described in the third aspect of the present invention.

[0076] Specifically, the drug loading rate of the drug-loaded vesicles can be 40%-90% (e.g., 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%).

[0077] Specifically, the encapsulation efficiency of the drug-loaded vesicles can be 40%-90% (e.g., 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%).

[0078] Specifically, the method for preparing the drug-loaded vesicles can be as described in the fourth aspect of the present invention.

[0079] In the sixth aspect of the present invention, a method for preventing and / or treating a disease is provided, comprising the step of administering the drug-loaded vesicles of the first aspect (e.g., the drug-loaded vesicles of the fourth aspect of the present invention) to a subject in need thereof.

[0080] In particular, the disease is preferably an eye disease, as described in the third aspect of the present invention.

[0081] Specifically, the subject is a mammal, especially a human.

[0082] Specifically, the vesicles are used as drug carriers to load active pharmaceutical ingredients, such as active pharmaceutical ingredients for the above-mentioned eye diseases; the active pharmaceutical ingredients include one or more of chemical drugs, biological drugs, natural drugs, nano drugs, radioactive drugs, photothermal therapy drugs and photodynamic therapy drugs.

[0083] Specifically, the administration can be carried out in any suitable manner, in particular intraocular administration or intravenous injection, wherein the intraocular administration includes eye drops, eye ointment, retrobulbar injection, parabulbar injection, subconjunctival injection, and intravitreal injection, in particular intravitreal injection. In some embodiments of the present invention, intravenous injection is used to treat autoimmune uveitis, and intravitreal administration is used to treat retinal neovascularization disease.

[0084] The present invention provides a preparation method and application of targeted nanovesicles derived from cells. The inventors prepared intracellular nanovesicles sIVs-RGD modified by overexpression of Lamp2b-RGD and intracellular nanovesicles sIVs-A25 modified by overexpression of A25-Lamp2b, giving the vesicles that originally did not have the targeting function the function of targeting neovascularization and T cells respectively. sIVs-RGD and sIVs-A25 with targeting function are further used as carriers to transport drugs to therapeutic targets for the treatment of autoimmune uveitis and retinal neovascularization. The intracellular nanovesicles of the present invention have a large yield, strong targeting, small particle size, and a narrow particle size distribution range. When used as a carrier to load drugs, they have a higher encapsulation rate and drug loading rate, and the distribution range and degree are wider under the vitreous cavity injection method. The modified vesicles obtained by the present invention can not only enhance their own therapeutic effects, but also be used as drug carriers, and have very good application prospects and research value. BRIEF DESCRIPTION OF THE DRAWINGS

[0085] Figure 1 The figure shows the process and steps of the method for producing intracellular nanovesicles, wherein A shows the process diagram and B shows the steps.

[0086] Figure 2 The figure shows the optimization process of the separation parameters of intracellular nanovesicles. AB shows the protein yield (A) and vesicle yield (B) of sIVs obtained at different action times of 20% ultrasonic amplitude; at 20% ultrasonic amplitude, the action time is less than 10 seconds or more than 20 seconds, and the vesicle yield drops sharply. CD shows the protein yield (C) and vesicle yield (D) of sIVs obtained at different ultrasonic amplitudes of 15s ultrasonic action time; at 15s ultrasonic time, the ultrasonic amplitude is higher than 25%, and the vesicle yield drops sharply. E shows the transmission electron micrograph of sIVs obtained at different ultrasonic amplitudes of 15s ultrasonic action time, scale: 100nm. F shows the transmission electron micrograph of sIVs obtained at different action times of 20% ultrasonic amplitude, scale: 100nm.

[0087] Figure 3 Shown is a simplified experimental flow chart.

[0088] Figure 4 The figure shows the construction and identification of MSCs modified by A25-Lamp2b overexpression. A is the A25-Lamp2b overexpression plasmid. B shows the expression of green fluorescent protein GFP after MSCs were transfected with lentivirus at a gradient of transfection multiplicity MOI values ​​(3, 15, 30) for 48 hours. Scale bar 200μm. C shows the expression of Lamp2b mRNA in MSCs before and after lentivirus transfection by qRT-PCR. D shows the expression of Flag tag protein and Lamp2b protein in MSCs before and after lentivirus transfection by WB. Among them, the GFP group represents MSCs transfected with empty virus, the A25 group represents MSCs transfected with A25-Lamp2b overexpression virus, and N represents MSCs not transfected with virus.

[0089] Figure 5 The figure shows the acquisition and identification of sEVs / sIVs-GFP / A25. A shows the transmission electron micrograph of sEVs / sIVs-GFP / A25. Wide field scale bar: 200nm; close-up scale bar: 200nm. BC shows the results of nanoparticle size analysis, which shows the particle size distribution of sEVs / sIVs-A25 and its statistical analysis results. D shows the content of IL-10 after sEVs / sIVs-A25 is loaded with IL-10. EF shows the expression of Flag tag protein and Lamp2b protein in sEVs / sIVs-A25 detected by WB and its statistical analysis results. ( p<0.05, p<0.0001 indicates significant difference among the groups).

[0090] Figure 6 Shown are the changes in CD40L expression in the in vitro T cell model and the experimental autoimmune uveitis animal model. A, B, and C show the differences in CD40L expression detected by flow cytometry 12 hours after in vitro stimulation of Naive CD4+ T cells and their statistical analysis results. The Control group is CD4+T cells without stimulation, the Pma+iono group is CD4+T cells stimulated with PMA and Ionomycin, and the anti-CD3 / CD28 group is CD4+T cells stimulated with anti-CD3 and anti-CD28 antibodies. DE shows the differences in CD40L expression in the draining lymph nodes and spleen 13 days after EAU induction and their statistical analysis results. The Normal group is mice without any treatment, and the EAU group is mice after EAU induction. FG shows the differences in CD40L expression in the lymph nodes and spleen 13 days after EAU induction detected by WB and their statistical analysis results ( p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0091] Figure 7 The figure shows the in vitro T cell targeting validation of sEVs / sIVs-A25. AB shows the flow cytometry detection of CFSE fluorescence intensity in T cells of each group after 12 hours of co-culture and its statistical analysis results ( p<0.05, p<0.001 indicates significant difference between groups). C shows the distribution of DiD fluorescence in T cells of each group after 12h of co-culture by confocal microscopy. Among them, green Anti-CD4 is CD4 expressed on the cell membrane, blue DAPI is the cell nucleus, and red DID is sEVs and sIVs labeled by DID.

[0092] Figure 8 sEVs / sIVs shown A25 @The effect of IL-10 on naive CD4+ T cells. A and C show the inhibitory effect of sEVs and sIVs on T cell proliferation and their statistical analysis; B and D show the promoting effect of sEVs and sIVs on Treg cell differentiation and their statistical analysis. p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0093] Fig. 9The following table shows the fundus inflammation evaluation of EAU mice in each group. A shows the fundus photography of mice in each treatment group and the blank control group on the 17th day of EAU model induction. B shows the OCT images of mice in each group on the 17th day of EAU model induction. C shows the HE staining sections of the retina of mice in each treatment group and the blank control group on the 21st day of EAU model induction. D and E show the clinical and pathological scores of mice in each treatment group and the blank control group after treatment, respectively. ( p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0094] Fig.10 The ERG measurement results of EAU mice in each group are shown. AB shows the b-wave amplitude and its statistical analysis. CD shows the a-wave amplitude and its statistical analysis. p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0095] Fig.11 The figure shows the changes in the proportion of cell subsets in the spleen and draining lymph nodes of EAU mice in each group. A shows the flow cytometry results of IL-17A+ cells and IFN-γ+ cells in the draining lymph nodes and spleen of each treatment group and the blank control group (from left to right: PBS, IL-10, sEVs A25 @IL-10, sIVs GFP @IL-10 and sIVs A25 @IL-10). B shows the flow cytometry results of CD25+FOXP3+ cells in the draining lymph nodes and spleen of each treatment group and the blank control group (from left to right: PBS, IL-10, sEVs A25 @IL-10, sIVs GFP @IL-10 and sIVs A25 @IL-10). C shows the statistical analysis results of the proportion of Th1 (IFN-γ+) and Th17 (IL-17A+) cells in the lymph nodes of each treatment group and the blank control group. D shows the statistical analysis results of the proportion of Th1 (IFN-γ+) and Th17 (IL-17A+) cells in the spleen of each treatment group and the blank control group. E shows the statistical analysis results of the proportion of Treg (CD25+FOXP3+) cells in the lymph nodes of each treatment group and the blank control group. F shows the statistical analysis results of the proportion of Treg (CD25+FOXP3+) cells in the spleen of each treatment group and the blank control group. ( p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0096] Fig.12 Shown is a simplified experimental flow chart.

[0097] Fig.13 Shown are the results of western blot experiments, which show the protein expression of Lamp2b in three types of cells (MSC cells, 293 cells, and Hela cells), sIVs, and sEVs.

[0098] Fig.14 Shown are the results of western blot experiments, which show the protein expression of Lmap2b and Flag (A) and the statistical analysis results of Lmap2b expression (B), GAPDH is the internal reference, NOR shows the virus transfection group, Ctrl shows the empty lentivirus transfection group, and 10 / 30 / 50 shows the lentivirus transfection group (where 10 / 30 / 50 shows the transfection multiplicity MOI).

[0099] Fig.15 The results of western blot experiments are shown, which show the protein expression of Lmap2b and Flag (A) and statistical analysis results (B, C). GAPDH is the internal reference, NOR indicates the non-transfected virus group, Ctrl indicates the empty lentivirus transfection group, 10 / 30 / 50 indicates the lentivirus transfection group, and 10 / 30 / 50 indicates the transfection multiplicity MOI ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0100] Fig.16 The results of ELISA test are shown. RGD @PEDF shows the composite preparation prepared by sEVs loaded with PEDF, sIVs RGD @PEDF shows the composite preparation prepared by sIVs loaded with PEDF ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0101] Fig.17 Shown are the results of western blot experiments, which show the expression of RGD-binding integrins αV and β3 in normal endothelial cells and VEGF-induced proliferating endothelial cells (A) and statistical analysis results (B and C) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0102] Fig.18 Shown are the results of PCR experiments showing the expression of RGD-binding integrins αV (A) and β3 in the retina of normal mice and OIR mice (B) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0103] Fig.19 Shown are the results of western blot experiments, which show the expression of RGD-binding integrins αV and β3 in the retina of normal mice and OIR mice (A) and statistical analysis results (B and C) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0104] Fig. 20 The results of the experiment on endothelial cell uptake of vesicles are shown, which show the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models for 12 hours (A) and statistical analysis results (B). The red color shows DID-stained vesicles, and the blue color shows DAPI-stained cell nuclei. Scale bar: 50um ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0105] Fig.21 The results of the experiment on endothelial cell uptake of vesicles are shown, which show the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models for 24 hours (A) and statistical analysis results (B). The red color shows DID-stained vesicles, and the blue color shows DAPI-stained cell nuclei. Scale bar: 50um ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0106] Fig. 22The results of the experiment on vesicle uptake in the retina of OIR mice are shown, which show the uptake of sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD in normal endothelial cells and proliferating endothelial cell models and statistical analysis results 8h (A and B), 24h (C and D) and 5 days (E and F) after intravitreal injection. The red color shows DID-stained vesicles and the blue color shows DAPI-stained cell nuclei. Scale bar: 50um ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0107] Fig.23 The results of an in vitro CCK assay are shown, which show that sIVs RGD @The therapeutic effect of PEDF on the proliferation of VEGF-induced angiogenesis model cells in vitro ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0108] Fig.24 The results of an in vitro Transwell assay are shown, which show that sIVs RGD @The microscopic results of the therapeutic effect of PEDF on the migration of cells in the VEGF-induced angiogenesis model in vitro (A) and the statistical results of the specific number of migrated cells (B), scale: 100um; ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0109] Fig.25 Shown are the results of western blot experiments, which show the expression of inflammatory factor ICAM-1 in HRECs (A) and statistical analysis results (B) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0110] Fig.26 The results of the retinal flat mount staining experiment of OIR mice are shown, which show the non-perfusion area and neovascularization area of ​​the retina of OIR mice (A), the statistical analysis results of the non-perfusion area (B) and the statistical analysis results of the neovascularization area (C). L represents low concentration (0.5 mg / ml), M represents medium concentration (1 mg / ml), and H represents high concentration (2 mg / ml). ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0111] Fig. 27 The results of the retinal flat mount staining experiment of OIR mice are shown, which show the area of ​​non-perfusion area and neovascularization area of ​​the retina of OIR mice (A), the statistical analysis results of the area of ​​non-perfusion area (B) and the statistical analysis results of the area of ​​neovascularization (C) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups).

[0112] Fig.28 Shown are the ERG measurements of OIR mice in each group, showing the overall b-wave amplitude (A) and the b-wave amplitude at the highest stimulus (2.2 cd•s / m 2 ) (B), the overall a-wave amplitude (C), and the a-wave amplitude at the highest stimulus (2.2 cd•s / m 2 Statistical analysis of (D) p<0.05, p<0.01, p<0.001 indicates significant difference among the groups).

[0113] Fig.29 Shown are the results of western blot experiments, which show the expression of GFAP and VEGF in the mouse retina (A), the statistical analysis results of GFAP (B) and the statistical analysis results of VEGF (C) ( p<0.01, p<0.001 and p<0.0001 indicates significant difference among the groups). DETAILED DESCRIPTION

[0114] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0115] The term "patient" or "subject" and the like are used interchangeably herein and refer to any animal or cell thereof treated according to the methods described herein, whether in vitro or in situ. Specifically, the aforementioned animals include mammals, e.g., rats, mice, guinea pigs, rabbits, dogs, monkeys, humans, particularly humans.

[0116] The term "treating" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, suppressing and / or halting one or more clinical symptoms of a disease after onset of the disease.

[0117] The term "prevent" refers to avoiding, minimizing or making the onset or development of a disease difficult by treating it before it occurs.

[0118] In the present invention, the intracellular nanovesicles modified by overexpression of A25-Lamp2b are referred to as "sIVs-A25" or "sIVs A25 "express.

[0119] In the present invention, the A25-Lamp2b overexpression modified extracellular vesicles are referred to as "sEVs-A25" or "sEVs A25 "express.

[0120] In the present invention, the intracellular nanovesicles modified by overexpression of RGD-Lamp2b are referred to as "sIVs-RGD" or "sIVs RGD "express.

[0121] In the present invention, the extracellular vesicles modified by overexpression of RGD-Lamp2b are referred to as "sEVs-RGD" or "sEVs RGD "express.

[0122]

[00136] Various publications, patents, and published patent specifications are cited herein, the disclosures of which are incorporated by reference in their entireties.

[0123] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0124] Example 1: Extraction and culture of cells

[0125] 1. Extraction and culture of mesenchymal stem cells (MSC)

[0126] Human umbilical cords were provided by Beijing Beilai Biotechnology Co., Ltd., China. Umbilical cords obtained from normal pregnancies without complications after cesarean section were immediately placed in saline containing penicillin (100 U / mL) and streptomycin (100 mg / mL) and then transported to the laboratory within 4 hours. After removing residual blood and blood vessels, the obtained umbilical cords were cut into 1-3 mm pieces and digested with 0.1% type II collagenase for 1 hour at 37°C. The suspension was then filtered through a 100-mesh screen to remove undigested tissue. The supernatant from the filtration was centrifuged and washed three times with PBS. The cell pellet was resuspended in Dulbecco's modified Eagle's medium / nutrient mixture F12 complete medium. The medium contained 10% fetal bovine serum (FBS), 100 U / ml penicillin, and 100 mg / ml streptomycin. The cells were seeded in T175 culture flasks and cultured in a 5% CO2 incubator at 37°C. The medium was changed every 3 days. When the cell confluence reached 80%, the cells were passaged at a subculture ratio of 1:2, and cells from P3 to P5 were used for experiments.

[0127] 2. Culture of 293T cells

[0128] The cells were cultured using DMEM complete medium (DMEM, Invitrogen, USA) with 5% fetal bovine serum (FBS), 1% penicillin-streptomycin (ScienCell, Carlsbad, CA), and the cells were incubated at 37°C and 5% carbon dioxide. The medium was changed every 2-3 days. The cells were used for various experiments at passages 3 to 6 and 70-80% confluence.

[0129] 3. Culture of Hela cells

[0130] The cells were cultured using DMEM complete medium (DMEM, Invitrogen, USA) with 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (ScienCell, Carlsbad, CA) at 37°C and 5% CO2. The medium was changed every 2-3 days. The cells were used for various experiments at passages 3 to 6 and 70-80% confluence.

[0131] At the same time, the above cell culture can refer to the patent application with application number 202410605857.X.

[0132] Example 2: Preparation of cell-derived nanovesicles

[0133] The production process of intracellular nanovesicles is as follows Figure 1 shown.

[0134] 1. Cell digestion and counting

[0135] Taking MSC cells as an example, when the cells grow to 90% confluence, the cell supernatant is aspirated, the cells are washed twice with PBS, and the cells are digested with trypsin. After digestion, the cells are neutralized and washed three times with PBS. Then the cells are counted and the cell number is adjusted to 1×10 using PBS. 6 Pieces / mL.

[0136] 2. Ultrasonic treatment of cells

[0137] Take 1×10 6 2 mL of cell suspension with a density of cells / mL was added to the bottom of a 50 mL centrifuge tube, and the ultrasonic probe was placed in the center of the liquid surface. The ultrasonic amplitude parameters were 20%, the time parameters were 15s, on 2s, off 2s, and the centrifuge tube was placed on ice. The liquid was then transferred to a 2 mL centrifuge tube for centrifugation.

[0138] 3. Collection of Nanovesicles in Small Cells

[0139] The centrifugation parameters were 2000g×10min, 20000g×30min. The supernatant was then collected and transferred to an ultracentrifuge tube, and the centrifugation parameters were 150000g×70min. All the above operations were performed on ice. The obtained precipitate was resuspended in PBS and was small intracellular nanovesicles (sIVs).

[0140] 4. Collection of small extracellular vesicles

[0141] FBS is a necessary condition for in vitro cell culture, but it contains a large number of bovine extracellular vesicles, which will also be present in the complete cell culture medium containing FBS. In order to remove bovine extracellular vesicles, FBS was centrifuged at 110,000×g at 4°C overnight (about 12 hours). When the cell fusion reached 60%, the cells were cultured in complete culture medium containing 10% FBS with exosomes removed for 48 hours. Then, the supernatant was collected and the extracellular vesicles were separated by ultracentrifugation at 4°C. The specific steps included 300g×10min, 2000g×10min, 10000g×30min and 110000g×70min twice. The obtained precipitate was resuspended in PBS, which was small extracellular vesicles (sEVs) mainly composed of exosomes.

[0142] Example 3: Optimization of isolation parameters for intracellular nanovesicles

[0143] Referring to the steps of Example 2, the optimization process of the separation parameters of intracellular nanovesicles is as follows: Figure 2 shown.

[0144] 1. Nanoparticle size analyzer detects the difference in the yield of sIVs

[0145] Take the PBS-resuspended sIVs, dilute them to 1 ml with PBS, and use the Nanoparticle Tracking Analysis (NTA) software NTA 3.3 Dev Build 3.3.104 for detection. Set the temperature to 25°C, the laser to Blue488, the flow rate to 50, the mode to automatic detection, inject three times, analyze three times, and take the peak value average as the Mode particle size result. The camera mode is sCMOS. The laser type is Blue488, and the viscosity is 0.9 cP.

[0146] 2. Observation of the morphology of sIVs in different cells by transmission electron microscopy

[0147] Take the centrifuged sIVs, resuspend them in 200μL PBS solution and mix them evenly. Take 10μL sIVs solution and mix it with 4% PFA in a volume ratio of 1:1, drop it on a clean plastic film to form droplets, then put the front of the electron microscope carbon grid on the droplets and leave it for 20 minutes. Negatively stain with 10μL phosphotungstic acid for 90s, bake the carbon grid dry, and observe it using a HitacW-7500 transmission electron microscope.

[0148] Figure 2 Middle A and Figure 2 B shows the protein yield and vesicle yield of sIVs obtained according to the implementation steps at an ultrasonic amplitude of 20% and an action time of 5s, 10s, 15s, 20s, 25s, 30s and 60s. The results show that the number of vesicles and protein yield dropped sharply when the action time was less than 10 seconds or more than 20 seconds. Figure 2 Middle C and Figure 2 D in the middle shows the protein yield and vesicle yield of sIVs obtained according to the implementation steps at an ultrasound time of 15 s and an amplitude of 20%, 25%, 30%, 35% and 40%. The results show that at an ultrasound time of 15 s, when the ultrasound amplitude is higher than 25%, the vesicle yield drops sharply. Figure 2 Middle E shows the transmission electron micrograph of sIVs obtained according to the present implementation steps at an ultrasonic time of 15 s and ultrasonic amplitudes of 20%, 25%, 30%, 35% and 40%. Figure 2 F shows the transmission electron micrograph of sIVs obtained according to the implementation steps at an ultrasonic amplitude of 20% and ultrasonic times of 5s, 10s, 15s, 20s, 25s, 30s and 60s.

[0149] This optimization process shows that at an ultrasonic amplitude of 20%, the vesicle yield drops sharply when the action time exceeds 10 seconds or 20 seconds. At an ultrasonic time of 15 seconds, the vesicle yield drops sharply when the ultrasonic amplitude is higher than 25%. 20% amplitude and 15 seconds ultrasonic time are the best parameters for collecting intracellular nanovesicles.

[0150] Regarding the preparation of cell vesicles, please refer to the patent application with application number 202410605857.X.

[0151] Example 3: Nanovesicles sEVs / sIVs modified by overexpression of A25-Lamp2b A25 Preparation of @IL-10 complex

[0152] Construction of A25-Lamp2b overexpression modified nanovesicles sEVs / sIVs A25 The steps for preparing the IL-10 complex and conducting in vitro and in vivo experiments in mice are as follows: Figure 3 shown.

[0153] 1. Experimental instruments and materials

[0154] 1.1 Experimental Reagents

[0155] DMEM-F12 culture medium (Gibco, USA); collagenase II (Gibco, USA); phosphate buffered saline (PBS) (Gibco, USA); fetal bovine serum (FBS) (Gibco, USA); insulin-transferrin-selenium (Gibco, USA); double antibody (Penicillin-Streptomycin) (Gibco, USA); trypsin (0.25%Trypsin-EDTA) (Gibco, USA); glutamine (Gibco, USA); polybrene (Solaibao, China); BCA (Solaibao, China); Triton X-100 (Triton X-100) (Solaibao, China); reverse transcription kit (RevertAidTM First Strand cDNA Synthesis Kit) (Thermo Fisher Scientific, USA) Company); GAPDH, Lamp2b primers (Suzhou Jinweizhi Biotechnology Co., Ltd., China); Flag-tag, GAPDH, Lamp2b antibodies (Abcam, USA); 75cm2, 175cm2 cell culture flasks (Corning, USA); -80℃ ultra-low temperature refrigerator (ThermoFisher Scientific, USA); 10ml, 25ml pipettes (Junyao, Tianjin, China).

[0156] 1.2 Experimental instruments

[0157] Water bath (Tianjin Ounuo Instrument Co., Ltd., China); pipette (Eppendorf, Germany); desktop centrifuge (Eppendorf, Germany); inverted phase contrast microscope (OLYMPUS, Japan); high pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany).

[0158] 2. Experimental methods:

[0159] 2.1. Construction of A25-Lamp2b overexpression cells

[0160] 2.1.1. Construction of A25-Lamp2b fusion protein overexpression plasmid

[0161] Figure 4 As shown in A.

[0162] 2.1.2. Isolation and purification of lentivirus overexpressing A25-Lamp2b-Flag fusion protein

[0163] The overexpression plasmid in 2.1.1 is delivered to the company to package the corresponding high-titer A25-Lamp2b-Flag lentivirus. Among them, Flag is a common fusion tag protein composed of eight amino acids (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 4)). After being fused and expressed with the target protein, it can be effectively recognized by anti-Flag antibodies, which makes it convenient to detect and identify the fusion protein A25-Lamp2b containing Flag by Western Blot method.

[0164] 2.1.3 Lentiviral infection of MSCs

[0165] When P2 MSCs or 293T cells grew to 60% confluency, lentivirus and 5 μg / ml Polybrene were added according to the MOI (Multiplicity of Infection) and the medium was replaced by half. Fresh complete medium was replaced 8 hours after infection, and fluorescence expression was observed under a fluorescence microscope 48 hours later ( Figure 4 Middle B).

[0166] 2.1.4. RT-PCR detection of target gene Lamp2b expression

[0167] P5 generation MSCs or 293T cells and normal cells not infected with lentivirus were used as control groups. Total RNA was extracted using Trizol reagent (Invitrogen, USA). cDNA was synthesized using a reverse transcription kit (Thermo, USA) according to the kit instructions. Reverse primers, cDNA, and SYBR Green Master (Roche, Switzerland) were added to a 384-well plate in sequence for RT-PCR, using GAPDH expression as an internal reference. The relevant mRNA expression levels were calculated using the △△Ct method ( Figure 4 Middle C). Lamp2b amplification primers were designed based on the NCBI gene sequence library: F: TGGCTCCGTTTTCAGCATTG (SEQ ID NO: 2) R: TGGTGTCATCATCCAGCGAA (SEQ ID NO: 3).

[0168] 2.1.5 Western Blot analysis of target protein Lamp2b and Flag-tagged protein expression

[0169] 20 μl of sample was taken, protein loading buffer was added, and the sample was denatured in a metal bath at 95°C for 10 minutes; SDS-PAGE gel electrophoresis; transfer to membrane; 5% skim milk powder was used for blocking for 2 hours; primary antibody was incubated at 4°C overnight; the membrane was washed with TBST solution 3 times, 10 minutes each time; secondary antibody was incubated at room temperature for 2 hours; the membrane was washed with TBST solution 3 times, 10 minutes each time; ECL color development was performed to observe the target band ( Figure 4 Middle D).

[0170] 2.2.1. Isolation and storage of sIVs / sEVs

[0171] Taking MSCs as an example, after culturing in complete medium for 2 days, the medium was replaced with one containing 10% exosome-free serum. When the cell density was 70-80%, the cells were digested with trypsin and washed twice with PBS to prepare a concentration of 1x10 6 / ml cell suspension. The cell suspension was ultrasonically treated to break the cell membrane (2ml power: 20%-30%, 2s / 2s, 15s-120s). The suspension after ultrasonication was collected, and the cell debris was removed by gradient centrifugation at 2000g for 10min and then at 20000g for 30min, and then sIVs were obtained by ultracentrifugation (150,000×g for 70min). sEVs were obtained according to a similar method in Example 2 and steps 1-4. sIVs / sEVs overexpressing A25-Lamp2b are sIVs / sEVs after targeted modification, and sIVs / sEVs transfected with empty virus are unmodified sIVs / sEVs, hereinafter referred to as sIVs-A25, sEVs-A25, sIVs-GFP, and sEVs-GFP.

[0172] 2.3 sIVs A25 Preparation and identification of @IL-10 complex

[0173] 2.3.1 sIVs A25 Preparation of @IL-10 complex

[0174] Take sIVs-A25, add IL-10 drug solution in order according to the mass ratio gradient (1:20, 1:10, 1:5, 1:1), mix well and place in a 37℃ incubator for 1 hour, add the liquid to a 100kDa ultrafiltration tube and centrifuge to remove free drugs. Wet the ultrafiltration tube with PBS first, add the liquid and centrifuge at 14000g for 20min, then add 300ul of PBS and centrifuge at 14000g for 20min twice, then invert and centrifuge at 4000g for 2min to recover sIVs A25 @IL-10, temporarily stored at 4°C. At the same time, sIVs were obtained using a similar method GFP @IL-10, sEVsA25 @IL-10, sEVs GFP @IL-10. Among them, sIVs A25 @IL-10 and sEVs A25 @IL-10 represents sIVs and sEVs loaded with IL-10, sIVs GFP @IL-10 and sEVs GFP @IL-10 represents unmodified sIVs and sEVs loaded with IL-10.

[0175] 2.3.2 sIVs A25 Identification of the @IL-10 complex

[0176] 2.3.2.1 Electron microscopy: After fixation with 2% paraformaldehyde, transmission electron microscopy was used to identify the morphology and size. Specific method: 10 μl of the suspension of small intracellular nanovesicles and small extracellular vesicles was added to the copper grid for precipitation for 5-10 minutes; 10 μl of 2% uranyl acetate was added to the copper grid for staining for 1-2 minutes, and the floating liquid was removed by filter paper; and the suspension was dried at room temperature for several minutes. The morphology was observed by imaging at 80 kV.

[0177] 2.3.2.2 Nanosight laser particle size analyzer: Take the small intracellular nanovesicles and small extracellular vesicles resuspended in PBS, dilute them to 1 ml with PBS, and use NTA 3.3 Dev Build 3.3.104 for detection. Set the temperature to 25°C, the laser to Blue488, the flow rate to 50, the mode to automatic detection, inject three times, analyze three times, and take the peak value average as the Mode particle size result.

[0178] 2.3.2.3 Western Blot: Same steps as 2.1.5.

[0179] 2.3.3 Determination of IL-10 content in sIVsA25@IL-10 complex

[0180] ELISA technique was used to detect sIVs A25 @IL-10, sEVs A25 @IL-10, sIVs GFP @IL-10 and sEVs GFP @ Determination of drug loading in IL-10: Take each group of nanovesicles, add them to the ELISA kit plate, and add the corresponding standard control group, incubate at room temperature for 1 hour. Add the corresponding volume of primary antibody, incubate at room temperature for 1 hour, and wash the plate three times. Add the corresponding volume of secondary antibody, incubate at room temperature for 1 hour, and wash the plate three times. Add the corresponding volume of substrate for color development, incubate at room temperature for 20 minutes, and then add the corresponding volume of stop solution to stop color development. Detect the absorbance value by excitation at 562nm on an enzyme reader.

[0181] 2.4 Statistical analysis

[0182] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0183] 3. Experimental results:

[0184] 3.1 Construction and identification of MSCs overexpressing A25-Lamp2b

[0185] Due to the non-phagocytic nature of T cells, targeted delivery of drugs to T cells still faces technical challenges. In T cell targeting studies, the most commonly selected modified receptors are T cell markers, including CD3, CD4, CD7, and CD8. However, this targeted therapy for all T cell subsets may lead to dose-limiting toxicity. Therefore, markers of specific cell subsets or markers that are overexpressed in disease states should be selected as much as possible. CD40 ligand (CD40L, CD154) is a 39KD type II transmembrane protein that belongs to the TNF superfamily and is considered to be an early activation marker for CD4 + T lymphocytes. CD40 / CD40L is involved in triggering multiple downstream immune signaling pathways. Early studies have shown that CD40 / CD40L costimulatory signaling is necessary for the generation of T cell-dependent antibody responses and memory B cell differentiation. After CD40 / CD40L signal activation in macrophages and DC cells, cytokine secretion and surface activation molecule expression are induced, which participates in the regulation of cross-stimulation and activation of CD4 + T cells and CD8 + T cells. During tissue inflammation, CD40 / CD40L activation in epithelial or endothelial cells induces cytokine and chemokine secretion, which may trigger additional leukocyte infiltration. Dysregulation of CD40 / CD40L signaling pathway expression is also present in various autoimmune diseases. For example, CD40L expression is significantly increased in various cell subsets, including B cells, T cells, and monocytes, in patients with systemic lupus erythematosus (SLE), as well as in circulating T cells in patients with psoriatic arthritis (PsA) and rheumatoid arthritis (RA). In addition, overexpression of CD40L in T cells of RA patients is associated with their poor prognosis. In addition, studies have found that soluble CD40L is also increased in several autoimmune diseases. The above results indicate that dysregulation of the CD40 / CD40L signaling pathway may promote the initiation or maintenance of pathogenic autoimmune responses.

[0186] Therefore, targeting the CD40 / CD40L pathway is expected to become a new therapeutic strategy for autoimmune diseases. At present, anti-CD40L therapy has been shown to be effective in SLE, experimental autoimmune meningitis (EAE) and EAU mouse models. Clinical trials have also been conducted for anti-CD40L therapy. Early results showed that although the drug has clinical efficacy, it was terminated due to the occurrence of thromboembolism. Thrombosis may be related to the binding of the Fc domain of CD40L monoclonal antibody to FcγRIIa (CD32a) on the surface of human platelets. Therefore, the clinical trials currently underway all use anti-CD40L monoclonal antibodies or specific ligands without Fc segments. A study designed a CD40L-specific peptide ligand-A25, modified liposomes loaded with methotrexate, and used it to treat EAE, which significantly reduced the proportion of CD40L+T cells in EAE mice and effectively inhibited disease progression. Therefore, using A25 as a CD40L-specific peptide ligand can effectively target CD40L+T cells, thereby enhancing the efficacy of the drug.

[0187] A25-Lamp2b lentivirus and empty lentivirus (such as Figure 4 The results of qPCR showed that the expression of target gene Lamp2b in MSCs of A25-Lamp2b virus transfection group increased compared with that of the non-transfected group and the empty virus transfection group, and the difference was statistically significant (Figure 4C). In addition, Western blot results showed that the expression of Lamp2b and Flag tag proteins in MSCs of A25-Lamp2b virus transfection group was significantly better than that of MSCs of empty virus transfection group, and the difference was statistically significant (Figure 4D).

[0188] 3.2 sIVs A25 Preparation and identification of @IL-10

[0189] Transmission electron microscopy results showed that sIVs and sEVs obtained by ultracentrifugation technology showed relatively uniform sizes, with spherical or cup-shaped shapes ranging from 70-150nm in diameter ( Figure 5A in the middle). The diameters of the extracted sEVs were analyzed using Nanosight technology. Statistical data showed that the average diameters of sEVs-GFP, sEVs-A25, sIVs-GFP, and sIVs-A25 were approximately 154.8±1.3 nm, 154.0±1.3 nm, 128.7.3±0.8, and 119.1±2.2 nm, respectively; and the D50 values ​​were 146.9 nm, 146.1 nm, 113.2 nm, and 100.7 nm, respectively; the D90 values ​​were 215.4 nm, 209.4 nm, 194.2 nm, and 175.2 nm, respectively ( Figure 5 ELISA results showed that the IL-10 protein concentration in the sIVs group was higher than that in the sEVs group ( Figure 5 D), indicating that sIVs have better drug loading capacity than sEVs. WB results showed that the expression level of Lamp2b in sIVs was higher than that in sEVs in both normal and overexpression states; in the overexpression state, the expression level of Flag tag protein in sIVs-A25 was higher than that in sEVs-A25 ( Figure 5 Medium EF).

[0190] 4. Summary

[0191] A25-Lamp2b overexpressing lentivirus was used to successfully transfect MSCs and obtain targeted modified sIVs and sEVs. The expression level of Lamp2b in sIVs-N was higher than that in sEVs-N, indicating that sIVs was more suitable for targeted modification; the expression levels of Lamp2b and Flag tag proteins in sIVs-A25 were higher than those in sEVs-A25. In addition, the drug loading effect of sIVs was better than that of sEVs, indicating that sIVs performed better as a drug carrier than sEVs.

[0192] Example 4: Changes in CD40L expression in in vitro T cell models and experimental autoimmune uveitis animal models

[0193] 1. Experimental Animals

[0194] Seven-week-old female C57BL / 6J mice provided by Jicui Pharmaceuticals were used to construct the EAU animal model. All experimental mice had been free of ocular and systemic lesions before use. The mice were raised in the animal room (SPF grade) of the Institute of Ophthalmology Hospital of Tianjin Medical University, and the environmental conditions were set as follows: stable temperature (23±2)℃, humidity (55%±10%), and 12 hours of light during the day and night. The mice in each group were numbered in advance and grouped according to the generated random number table. During the experiment, we strictly followed the standard procedures of the Animal Care and Use Committee of Tianjin Medical University.

[0195] 2. Experimental methods

[0196] 2.1. Differences in CD40L expression in in vitro T cell models

[0197] 2.1.1 Isolation of mouse naïve CD4+ T cells

[0198] Mouse spleen and draining lymph nodes were taken, placed on a copper grid, and ground with a syringe core. After lysing red blood cells, single cells were obtained by centrifugation and resuspended in a 15 ml centrifuge tube: 90 μL of cold MACS buffer / 10 7 cells, anti-CD4 magnetic beads 10μL / 10 7 cells. Incubate in a 15ml centrifuge tube for 15-30min. Add cold MACS buffer to the 15ml centrifuge tube to 15ml, centrifuge and resuspend the cells with 5ml cold MACS buffer. Slowly add the cells to the magnetic column washed with MACS buffer on the magnetic stand, and rinse 3 times with 5ml MACS buffer. Remove the magnetic column from the magnetic stand, place it on a 15ml centrifuge tube, add 5ml MACS buffer to the magnetic column, and then use a needle plug to quickly push all the liquid in the magnetic column into the centrifuge tube. The resulting Naïve CD4+ T cells are used for in vitro activation, proliferation and differentiation experiments.

[0199] 2.1.2 In vitro T cell activation stimulation model

[0200] During the course of autoimmune uveitis, Naïve T cells are activated into antigen-specific T cells (Th1 and / or Th17 cells) after encountering retinal antigens in vivo, differentiate and proliferate, enter the eye through the draining lymph nodes and / or spleen, recognize intraocular antigens, and are reactivated. Through the secretion of adhesion molecules, chemokines, etc., T cells, mononuclear macrophages, neutrophils, etc. are further recruited to gather in the eye, amplifying the inflammatory response and causing damage to intraocular parenchymal cells. The upregulation of CD40L expression of activated T cells is the basis of the targeted design of this embodiment.

[0201] Anti-CD3&CD28 and PMA&Ionomycin are both commonly used stimulators for in vitro T cell activation. Studies have shown that two signals are required to induce T cell activation and proliferation: one is the specific antigen stimulation signal generated by the binding of TCR / CD3 to the specific MHCⅡ antigen peptide complex on the surface of antigen presenting cells (APCs); the other is a nonspecific co-stimulatory signal, which is generated by the interaction between the co-stimulatory molecules on the surface of APCs and the corresponding receptors of T cells. Among them, CD28 / B7 is the most important co-stimulatory molecule, which can increase the production of IL-2, accelerate T cell proliferation, and prevent cells from entering an unresponsive state or death. The combined use of CD3 and CD28 antibodies to stimulate T cells in vitro to simulate the dual signal effect of T cell activation is currently the most widely used method for T cell activation and expansion. In addition, in cells, the activation of Protein kinase C (PKC) can cause the phosphorylation of many downstream protein kinases, forming a cascade reaction, leading to the expression of multiple proteins, and then causing cell activation. PKC can be activated by the combined action of DAG (diacylglycerol) and Calcium (Ca2+). PMA (phorbol myristoyl ethyl ester) is a DAG mimetic, and Ionomycin is a Ca2+ transporter that can transport Ca2+ from organelles to the cytoplasm. Therefore, the combined action of PMA and Ionomycin can activate PKC, thereby causing a series of downstream reactions.

[0202] Therefore, 6ng / ml PMA and 1ug / ml ION or 10μg / ml anti-CD3 and 5μg / ml anti-CD28 were added to the above-sorted naïve CD4+T cell culture system for stimulation for 6-12h. The cells were collected, washed with PBS twice, stained with the corresponding anti-CD40L antibody, and then the changes in the proportion of CD40L+T cells were detected by flow cytometry.

[0203] 2.2 Changes in CD40L expression in experimental autoimmune uveitis animal models

[0204] 2.2.1 Induction of experimental autoimmune uveitis (EAU) animal model

[0205] EAU is an animal model of T cell-mediated autoimmune disease. CD4+ T cells are the main immune cell type with upregulated CD40L expression after EAU. Female C57BL / 6 mice, 6-8 weeks old, were selected. 651-670Add complete Freund's adjuvant in a 1:1 ratio to two syringes connected to a three-way tube, with a final volume of 200 μL per mouse and an antigen dosage of 300 μg per mouse. After thorough mixing on ice, 200 μL of the emulsion was subcutaneously injected at 6 points on the flank and tail root of each mouse. 30 minutes before subcutaneous injection of the emulsion, PTX was intraperitoneally injected at 1 μg per mouse.

[0206] 2.2.2 Detection of changes in CD40L expression

[0207] Flow cytometry: Single cell suspensions were prepared from spleen and lymph node tissues of EAU mice on day 13 and naïve mice of the same age. The suspensions were stained with corresponding anti-CD40L antibodies and then tested on a flow cytometer to detect changes in the proportion of CD40L+T cells.

[0208] Western Blot: The spleen and lymph node tissues of EAU mice on day 13 and naïve mice of the same age were taken for protein extraction, and then protein loading buffer was added and denatured in a 95℃ metal bath for Western Blot detection. The Western Blot experimental steps were the same as before.

[0209] 2.3 Statistical analysis

[0210] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were statistically significant.

[0211] 3. Experimental results

[0212] 3.1 CD40L is upregulated in the in vitro T cell activation stimulation model

[0213] like Figure 6 As shown in Figures AC, after in vitro stimulation, the proportion of CD40L+ cells in CD4+ T cells increased significantly compared with the unstimulated group.

[0214] 3.2 CD40L is upregulated in the spleen and lymph nodes of the EAU mouse model

[0215] like Figure 6 The results of DE flow cytometry showed that the proportion of CD40L+ cells in CD4+T cells in the spleen and draining lymph nodes of mice after EAU induction was significantly increased compared with the non-modeling group; Figure 6 The Western Blot results of FG showed that the expression of CD40L protein in the spleen of mice after EAU induction was upregulated compared with the non-modeling group.

[0216] 4. Summary

[0217] The results showed that CD40L expression was significantly upregulated after T cell activation. Therefore, targeting the CD40 / CD40L pathway is expected to become a new treatment strategy for autoimmune diseases.

[0218] Example 5: Evaluation of sIVs-A25 and sEVs-A25 targeting T cell function

[0219] 1. Experimental instruments and materials

[0220] 1.1 Experimental Reagents

[0221] CFSE (Invitrogen, USA); RPMI 1640 culture medium (Gibco, USA); Glutamine (Gibco, USA); FBS fetal bovine serum (Gibco, USA); Magnetic bead positive selection mouse NavieCD4 kit (ebioscience, USA); Magnetic bead positive selection mouse Total CD4 kit (ebioscience, USA); IL-10 protein (MCE, USA); BSA (Biyuntian, China); phosphate buffered saline (PBS) (Gibco, USA); DID (Biyuntian, China); DAPI (Sigma, USA); anti-fluorescence quenching mounting medium (Solaibao, China); adhesive slide (Shitai, China); Polybrene (Gibco, USA); CD3 antibody (Thermo Fisher Scientific, USA); CD28 antibody (Thermo Fisher Scientific, USA); 15ml / 50ml centrifuge tube (Corning, USA); 48-well plate, 96 Well plate (Corning, USA); LS-column (Miltenyi, Germany); 1ml, 50ml syringes (Ganfa, China); 1.5ml EP tube (Axygen, USA); cell counting chamber (Thermo Fisher Scientific, USA); 0.45μm, 0.22μm filters (Sigma, USA).

[0222] 1.2 Experimental instruments

[0223] Water bath (Tianjin Ounuo Instrument Co., Ltd., China); pipette (Eppendorf, Germany); desktop centrifuge (Eppendorf, Germany); confocal microscope (Ceiss, USA); inverted phase contrast microscope (OLYMPUS, Japan); high-pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany); flow cytometer (BD, USA).

[0224] 2. Experimental methods

[0225] 2.1 Verification of the targeting activity of sIVs-A25 in vitro

[0226] 2.1.1 CFSE labeling of sIVs and sEVs

[0227] Use PBS to dilute the sIVs and sEVs resuspension to 400ul, add CFSE to the sEVs dilution to make the final CFSE concentration 5μM. Incubate at room temperature for 10min, neutralize the excess dye with a large volume of PBS, wash once by centrifugation at 11000g for 70min, resuspend in an appropriate amount of PBS, and filter with a 0.22μm filter. The sIVs and sEVs are from the sIVs and sEVs obtained in 2.2.1 of Example 3.

[0228] 2.1.2 DID labeling of sIVs and sEVs

[0229] Use PBS to dilute the sIVs resuspension to 400ul, add DID to the sIVs dilution to make the final concentration of DID 5ug / ml. Incubate at 37℃ in the dark for more than 30min, add the DID suspension to a 100kd ultrafiltration tube, and centrifuge at 14000g for 15min. Add 400ul PBS to the ultrafiltration tube to resuspend the precipitate, and centrifuge at 14000g for 15min. Add 50ul PBS to resuspend the precipitate, invert the ultrafiltration tube, replace with a new collection tube, and centrifuge at 1000g for 2min. Transfer to a new 1.5ml EP tube, centrifuge at 14000g for 3min, and take the supernatant.

[0230] 2.1.3 T cell co-culture

[0231] Magnetic bead negative selection kit to isolate naïve CD4+T cells, 2x10 5 The cells were plated in 96-well plates pre-incubated with CD3 antibodies. After culturing in a cell culture incubator for 24 h, 20 μg / ml of nanovesicles in each group were added and cultured for 1 h, 6 h, 12 h, and 24 h, respectively. The cells were collected for flow cytometry and confocal microscopy.

[0232] 3. Experimental results

[0233] 3.1 sIVs are more easily internalized by T cells than sEVs

[0234] like Figure 7 As shown, when sEVs-GFP, sEVs-A25, sIVs-GFP, and sIVs-A25 were co-incubated with CD4+ T cells, flow cytometry and confocal microscopy results showed that the proportion of T cells taking up A25-modified sEVs and sIVs was higher than that of their corresponding unmodified groups, and the T cell uptake ratio of sIVs-A25 was significantly higher than that of sEVs-A25.

[0235] 4. Summary

[0236] The above experimental results show that sIVs are more easily internalized by T cells than sEVs; and A25 modification significantly increased the number of sIVs and sEVs taken up by T cells. Compared with sEVs, the modification of sIVs significantly improved the targeting of T cells.

[0237] Example 6: sIVs A25 @IL-10 inhibits CD4+T cell proliferation in vitro and promotes Treg cell differentiation in vitro

[0238] 1. Experimental instruments and materials

[0239] 1.1 Experimental Reagents

[0240] CFSE (Invitrogen, USA); RPMI 1640 culture medium (Gibco, USA); Glutamine (Gibco, USA); FBS fetal bovine serum (Gibco, USA); Magnetic bead positive selection mouse NavieCD4 kit (ebioscience, USA); Magnetic bead positive selection mouse Total CD4 kit (ebioscience, USA); IL-10 protein (MCE, USA); BSA (Biyuntian, China); phosphate buffered saline (PBS) (Gibco, USA); CD3 antibody (Thermo Fisher Scientific, USA); CD28 antibody (Thermo Fisher Scientific, USA); 15ml / 50ml centrifuge tube (Corning, USA); 48-well plate, 96-well plate (Corning, USA); LS-column (Miltenyi, Germany); 1ml, 50ml syringe (Ganfa, China); 1.5ml EP tube (Axygen, USA); cell counting chamber (Thermo FisherScientific Company); 0.45μm, 0.22μm filters (Sigma Company, USA).

[0241] 1.2 Experimental instruments

[0242] Water bath (Tianjin Ounuo Instrument Co., Ltd., China); desktop centrifuge (Eppendorf, Germany); inverted phase contrast microscope (OLYMPUS, Japan); high pressure steam sterilizer (SAKURA, Japan); electronic balance (Sartori, Germany); flow cytometer (BD, USA).

[0243] 2. Experimental methods

[0244] 2.1 T cell proliferation assay in vitro (CFSE method)

[0245] Pretreatment of 96-well plate (plating): dilute CD3 antibody in PBS to a concentration of 10 μg / ml, add 100 μl to each well of the 96-well plate, add 100 μl PBS to the outer wells of the 96-well plate to prevent excessive evaporation, incubate at 4°C overnight or place in a cell incubator at 37°C for 2 hours, aspirate the antibody, wash the wells twice with PBS and set aside.

[0246] Magnetic beads were used to sort naïve CD4+T cells from mouse spleen. The volume of naïve CD4+T cells was adjusted to 5 ml and placed in a centrifuge tube. 1 μl of CFSE storage solution (5 mmol / L) was added, and the cells were quickly mixed. The cells were incubated at room temperature in the dark for 10 min, and the same volume of RPMI1640 medium containing 10% FBS was added to terminate the staining. After centrifugation, the cells were resuspended in complete medium (configuration: 90% 1640 basal medium + 10% FBS + 2 μg / ml CD28 antibody + 100 U / ml double antibody + 50 μM β-mercaptoethanol) and the cells were centrifuged at 3x10 5 The cells were plated in a pretreated 96-well plate, and a blank control group and each nanovesicle treatment group were set up, with three duplicate wells in each group. After 72 hours of culture, the cells were collected and stained with CD4 antibody, and the CFSE fluorescence expression was detected by flow cytometry.

[0247] 2.2 Treg differentiation assay in vitro

[0248] 2.2.1 Treg differentiation in vitro

[0249] The separation of naive CD4+T cells was performed according to the instructions of the magnetic bead negative sorting kit. After separation, 2x10 5 Cells were plated in 96-well plates pre-incubated with CD3 antibodies and cultured in a cell incubator under the following differentiation conditions: X-VIVO 15 medium + 2μg / ml CD28 antibody + 5ng / ml TGF-β + 20ng / ml IL-2, cultured for 5 days. A blank control group and each nanovesicle treatment group were set up, with three wells in each group. Flow cytometry was performed after 5 days.

[0250] 2.2.2 Detection of Treg cell proportion by flow cytometry

[0251] The cells to be tested were placed in a flow cytometer, PBS was added and centrifuged at 400g for 5 min, resuspended in 100μl PBS, stained with 1μl CD4-BV711 antibody, incubated in the dark for 30 min, PBS was added and centrifuged at 400g for 5 min, fixative / permeabilization solution was added in sequence for fixation and permeabilization, 1μl FOXP3-PE antibody was added for staining, incubated in the dark for 30 min, centrifuged at 400g for 5 min, resuspended in 500μl PBS, and the proportion of FOXP3+CD4+ cells was detected by flow cytometer.

[0252] sEVs used in the experiment A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 @IL-10 was obtained according to Example 3.

[0253] 2.3 Statistical analysis

[0254] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0255] 3. Experimental results

[0256] 3.1 In vitro T cell proliferation assay

[0257] When using sEVs at a concentration of 10 μg / ml A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 @IL-10, the results showed that they could inhibit the proliferation of T cells stimulated by CD3 / CD28 antibodies to a certain extent ( Figure 8 A, C). Among them, sIVs GFP @IL-10 group has a significantly better inhibitory effect on T cell proliferation in vitro than sIVs GFP @IL-10 group and sEVs A25 @IL-10 group, the difference was statistically significant, indicating that the targeted modification of sIVs increased the targeted delivery efficiency of the loaded drug IL-10 and enhanced the inhibitory effect of IL-10 on the proliferation of T cells stimulated by CD3 / CD28 antibodies.

[0258] 3.2 Treg cell differentiation assay

[0259] Treg cells are the main suppressive cell population in the body, playing an important role in transplant tolerance, suppressing autoimmune reactions and maintaining the body's immune balance. In autoimmune diseases, Treg cells can suppress pathogenic T cells and promote disease regression, and their abnormal function and regulation can lead to autoimmune diseases.

[0260] Figure 8 Results in B and D show sIVs GFP @IL-10 group had no significant promoting effect on Treg differentiation, but sIVs A25 @IL-10 group, sEVs A25 The @IL-10 group showed a significant promoting effect in the differentiation of T cells into Treg cells, and the difference was statistically significant (P < 0.05). This indicates that the targeted modification of sIVs increased the targeted delivery efficiency of the loaded drug IL-10 and enhanced the promoting effect of IL-10 on TGF-β-induced Treg cell differentiation.

[0261] 4. Summary

[0262] By encapsulating IL-10 in sIVs and sEVs, the aim is to enhance the inhibitory ability of MSCs-derived sIVs and sEVs on T cell proliferation in vitro and promote the development of Treg cells in vitro, thereby achieving a more significant immunosuppressive effect. A25 @IL-10 can not only effectively inhibit the in vitro proliferation induced by CD3 / CD28 antibody stimulation, but also promote the differentiation of naïve CD4+T cells into Treg cells. In addition, the effect of sIVs after targeted modification is more obvious than that of unmodified ones, and sIVs after targeted modification and sEVs show comparable immunosuppressive efficacy.

[0263] Example 7: sIVs A25 The therapeutic effect of IL-10 on experimental autoimmune uveitis

[0264] 1. Experimental subjects

[0265] 1.1 Experimental animals

[0266] Seven-week-old female C57BL / 6 mice provided by Jicui Pharmaceuticals were used to construct the EAU animal model. All experimental mice had been free of ocular and systemic lesions before use. The mice were raised in the animal room (SPF grade) of the Institute of Ophthalmology Hospital of Tianjin Medical University, and the environmental conditions were set as follows: stable temperature (23±2)℃, humidity (55%±10%), and 12 hours of light during the day and night. The mice in each group were numbered in advance and grouped according to the generated random number table. During the experiment, we strictly followed the standard procedures of the Animal Care and Use Committee of Tianjin Medical University.

[0267] 2. Experimental methods

[0268] 2.1 EAU induction

[0269] Female C57BL / 6 mice, 6-8 weeks old, were selected. 651-670 Add complete Freund's adjuvant in a 1:1 ratio to two syringes connected to a three-way tube, with a final volume of 200 μL per mouse and an antigen dosage of 300 μg per mouse. After thorough mixing on ice, 200 μL of the emulsion was subcutaneously injected at 6 points on the flank and tail root of each mouse. 30 minutes before subcutaneous injection of the emulsion, PTX was intraperitoneally injected at 1 μg per mouse.

[0270] 2.2 sIVs A25 @IL-10 in vivo efficacy verification

[0271] 2.2.1 Treatment and grouping of EAU model mice

[0272] On the 11th day after modeling, the EAU model mice were randomly divided into groups, ensuring that each group contained 6 mice. Each group of mice was injected with 1ug IL-10, 30ug sIVs A25 @IL-10, 30ug sIVs GFP @IL-10 and 30ug sEVs A25 @IL-10. Similarly, in the blank control group, mice were injected with an equal volume of phosphate buffered saline (PBS) to ensure the consistency of experimental conditions. sEVs used in the experiment A25 @IL-10, sIVs GFP @IL-10, and sIVs A25 @IL-10 was obtained according to Example 3.

[0273] 2.2.2 Clinical / pathological inflammatory scores in experimental autoimmune uveitis

[0274] Starting from the 9th day after model induction, the severity of the disease in each group of mice was observed every 2 days with an indirect ophthalmoscope. The eyeballs of the mice were removed at different stages of the disease, fixed and paraffin sections were prepared for routine HE staining. The degree of damage to the retinal tissue structure of the mice was recorded under an optical microscope. The clinical and histopathological scores of the fundus were recorded according to the Caspi classification.

[0275] 2.2.3 Mouse OCT and fundus imaging examination

[0276] Starting from the 10th day after model induction, the changes in the fundus structure of mice were observed every 4 days using the German Heidelberg SPECTRALIS-OCT. Tropicamide and epinephrine eye drops were used to dilate the mouse's eyes, and then Avertin was used to anesthetize the mouse by intraperitoneal injection. After the mouse entered the stable period of anesthesia, sodium hyaluronate gel was applied to the mouse's eyes and a retinal scan was performed. The scanned image was centered on the mouse optic disc, and one horizontal and one vertical section were taken.

[0277] 2.2.4 Electroretinogram (ERG)

[0278] Each group of EAU mice was dark-adapted for more than 12 hours in a dark room 25 days after modeling. The electrophysiological response of the retina of each group of mice under dark adaptation was detected. The mice were dark-adapted for 12 hours, and the pupils were fully dilated after intraperitoneal anesthesia. After anesthesia of the ocular surface, the mice were placed on a 37°C constant temperature operating table. The red electrode needle was inserted into the neck skin of the mouse, with the lower needle facing the head. The green electrode needle was inserted into the tail of the mouse, and the electrode was fixed with tape. Gatifloxacin ophthalmic gel was applied to the cornea to keep the cornea moist and prevent the instrument from scratching the cornea and causing infection. The angle of the cornea was adjusted to align with the corneal electrode. According to the standardized protocol of the International Society for Clinical Electrophysiology of Vision (ISCEV), the mice were stimulated from low to high and the electroretinogram was recorded. The stimulation intensity ranged from -1.7 to 3.1 log (cd•s / m2). Stimulation was given according to low (-1.7~0.4), medium (0.7~2.2), and high stimulation intensities (2.5~3.1), which were repeated 7, 5, and 3 times respectively and the average value of single flash was recorded. The stimulation interval was 15, 30, and 60 seconds respectively.

[0279] 2.2.5 Isolation of draining lymph node and spleen tissue cells and determination of T cell subsets by flow cytometry

[0280] On the 17th day after the induction of the EAU mouse model, the draining lymph nodes and spleen tissues of the EAU mice in each group were obtained, and the single cell suspension was separated after grinding. The single cell suspension was divided into two parts.

[0281] Part of the cells were stained intracellularly. Under the co-stimulation of PMA, ION and BFA, the cells were cultured in a CO2 incubator for 6 h. The cells were collected and rinsed with PBS. Live / Dead antibody and CD4 antibody were added for staining respectively, and incubated at 4°C in the dark for 30 min. After rinsing, fixative was added and fixed at room temperature for 30 min. After centrifugation, permeabilization agent was added and rinsed twice, and then permeabilization agent and IFN-γ, IL-4, IL-17A antibodies were added to the sample for intracellular staining, and incubated at 4°C in the dark for 30 min. After staining, the permeabilization agent was thoroughly rinsed, and after PBS reselection, the BD FacsCelesta was loaded to detect changes in Th1, Th2 and Th17 cell subsets.

[0282] Another part of unstimulated cells was stained for FOXP3+CD25+CD4+T cell nuclei. Live / Dead antibody and CD4+ antibody were added to the cell samples for staining, and incubated at 4℃ in the dark for 30 min. After rinsing, nuclear membrane fixative was added and fixed at room temperature for 30 min. After centrifugation, nuclear membrane fixative was added and rinsed twice, and then membrane fixative and FOXP3+CD25+ antibody were added to the sample for intranuclear staining. Incubated at 4℃ in the dark for 30 min. After staining, the membrane fixative was thoroughly rinsed, and after PBS reselection, the BD Facs Celesta was loaded to detect changes in Treg cell subsets.

[0283] 2.4 Statistical analysis

[0284] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0285] 3. Experimental results

[0286] 3.1 sIVs A25 @IL-10 and sEVs A25 @IL-10 is similar and can significantly alleviate fundus inflammation in EAU mice

[0287] The results showed that the fundus inflammation scores and pathological scores of the three treatment groups were lower than those of the control group (P < 0.05) ( Fig. 9 sEVs A25 @IL-10 and sIVs A25 The therapeutic effect of the IL-10 treatment group was comparable, with significantly improved fundus inflammation, reduced optic disc edema, disappearance of vascular white sheaths, and reduced vitreous inflammatory cells; HE sections showed that the retinal structure was restored to a flat state, and the structure of each layer of the retina was better than that of sIVs GFP @IL-10 treatment group, the difference was statistically significant. OCT results were consistent with it.

[0288] 3.2 sIVs A25 @IL-10 has a stronger neuroprotective effect on EAU mice

[0289] like Fig.10 The results showed that unmodified sIVs GFP@IL-10 group can significantly increase the amplitude of a wave and b wave under high stimulation compared with PBS and IL-10 groups. The modified sIVs can significantly increase the amplitude of a wave and b wave compared with the modified sEVs. This shows that the modified sIVs have better neuroprotective effect.

[0290] 3.3 sIVs A25 @IL-10 and sEVs A25 @IL-10 is similar to IL-10, which can increase the proportion of Treg cells in the draining lymph nodes and reduce the proportion of Th1 cells in the draining lymph nodes and spleen.

[0291] like Fig.11 The results showed that the modified sIVs A25 @IL-10 and sEVs A25 The proportion of Treg (CD4+CD25+FOXP3+) cells in the draining lymph nodes of mice treated with IL-10 was significantly higher than that in PBS, IL-10 and sIVs GFP @IL-10 group significantly improved; and the modified sIVs A25 @IL-10 and sEVs A25 The proportion of Th1 (CD4+IFN-γ+) cells in the draining lymph nodes and spleen of mice treated with IL-10 was significantly higher than that in PBS, IL-10 and sIVs GFP The @IL-10 group was significantly reduced, indicating that the modified sIVs improved the tissue-targeted delivery efficiency of IL-10, enhanced the promoting effect of IL-10 on Treg cell differentiation in the draining lymph nodes of EAU mice, and enhanced the inhibitory effect of IL-10 on the proliferation of Th1 cells in the draining lymph nodes and spleen of EAU mice.

[0292] 4. Summary

[0293] EAU mice were injected with sIVs via tail vein A25 After IL-10 treatment, the severity of the disease was significantly improved, and HE staining showed that the retinal structure returned to normal and the infiltration of inflammatory cells was reduced. A25 @IL-10 can effectively inhibit the progression of inflammation in EAU mice. The ERG electrophysiological results showed that sIVs A25 @IL-10 has obvious retinal neuroprotective function. Flow cytometry results suggest that sIVs A25 @IL-10 may inhibit the progression of inflammation in EAU mice by promoting the differentiation of Treg cells in the draining lymph nodes and spleen of EAU mice.

[0294] Example 8: The expression level of Lamp2b in sIVs of cells is higher than that in sEVs

[0295] 1. Experimental methods

[0296] The specific experimental process is as follows Fig.12 shown.

[0297] 1.1 Cell culture

[0298] The extraction and culture of cells were the same as in Example 1.

[0299] 1.2 Extraction of sIVs

[0300] When the cells grow to 90% confluence, the cell supernatant is aspirated, the cells are washed twice with PBS, and the cells are digested with trypsin. After digestion, the cells are neutralized and washed three times with PBS. Then the cells are counted and the cell number is adjusted to 1×10 with PBS. 6 / mL. Take 1×10 6 2 mL of cell suspension with a density of cells / mL was added to the bottom of a 50 mL centrifuge tube, and the ultrasonic probe was placed in the center of the liquid surface. The ultrasonic amplitude parameters were 20%, the time parameters were 15s, on 2s, off 2s, and the centrifuge tube was placed on ice. The liquid was then transferred to a 2 mL centrifuge tube for centrifugation.

[0301] Use a 50ml syringe and a 0.45μm filter to filter the supernatant (wet the filter membrane with PBS first), and use differential centrifugation to extract and separate IVs. The speed is RCF 150000, the time is 70min, and the temperature is 4°C. Resuspend the precipitate in each tube with 60ul of clean PBS, collect it in an EP tube, and quantify the protein using the BCA method, and then perform protein denaturation for western blot experiments.

[0302] 1.3 Collection of sEVs

[0303] FBS is a necessary condition for in vitro cell culture, but it contains a large number of bovine extracellular vesicles, which will also be present in the complete cell culture medium containing FBS. In order to remove bovine extracellular vesicles, FBS was centrifuged at 110,000 × g at 4 ° C overnight (about 12 hours). When the cell fusion reached 60%, the cells were cultured in complete culture medium containing 10% FBS to remove exosomes for 48 hours. Then, the supernatant was collected and the extracellular vesicles were separated by ultracentrifugation at 4 ° C. The specific steps included 300g × 10min, 2000g × 10min, 10000g × 30min and 110000g × 70min twice. The obtained precipitate was resuspended in PBS, which was mainly sEVs with exosomes, collected in EP tubes, and protein quantification was performed by BCA method, and then protein denaturation was performed for western blot experiments.

[0304] The intracellular vesicle collection and western blot experimental procedures of 293T cells and Hela cells are the same as above.

[0305] 2. Statistical processing

[0306] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0307] 3. Experimental results

[0308] 3.1 The expression level of Lamp2b in sIVs is higher than that in sEVs in MSC cells, 293 cells and Hela cells

[0309] In this study, cell proteins, sIVs proteins and sEVs proteins of three types of cells (MSC cells, 293 cells and Hela cells) were used for western blot experiments to detect the protein expression of Lamp2b ( Fig.13 ), the results showed that the protein expression level of Lamp2b in sIVs was much higher than that in sEVs.

[0310] 4. Summary

[0311] This example demonstrates that the expression of Lamp2b in sIVs of MSCs cells, 293T cells and Hela cells is higher than that in sEVs, indicating that the expression level of Lamp2b in sIVs of cells is higher than that in sEVs.

[0312] Example 9: sIVs RGD Preparation of @PEDF

[0313] 1. Experimental methods

[0314] 1.1 Isolation, culture and lentiviral infection of MSCs

[0315] MSCs were extracted from human umbilical cords by digestion and centrifugation, and MSCs were obtained and purified by differential adhesion method. MSC-RGD was constructed by lentiviral transfection of MSCs. P3 generation UMSCS cells in good condition were taken, and lentiviral transfection was performed after 12 hours when the cell confluence reached 50%-70%. Prepare lentiviral transfection solution: take 6 50ml centrifuge tubes, add half the amount of complete culture medium of the normal culture system to each of them, add polybrene transfection reagent to make the final concentration reach 6ug / ml, add the corresponding volume of Lamp2b-RGD lentivirus calculated with MOI values ​​of 10, 30, and 50 to the experimental group, and add the control lentivirus with the same MOI value gradient to the control group, and blow to mix the liquid. Aspirate the original cell culture medium, add the above-mentioned virus transfection solution respectively, shake gently to evenly cover the cell surface, and gently place the cells in the cell culture incubator for incubation. After 6 hours, add complete culture medium to the cells until the normal culture system is sufficient, and change the cell medium after adding lentiviral transfection solution for 24 hours. The infection steps of 293T cells were the same as above.

[0316] 1.2 Collection and storage of sIVs

[0317] When the UMSCs culture reached 90% confluence, the culture medium was first aspirated to remove the cell supernatant, and then the cells were washed with warm PBS, and 3 ml of trypsin was added to digest the cells for 3 min. After neutralization with 6 ml of PBS, the cells were centrifuged at 1000g for 5 min, and then resuspended with PBS and centrifuged and washed twice. After resuspending with PBS, the cells were counted using an automatic cell counter, and the cell reselection liquid was diluted with PBS to adjust the density to 1*10^6 / ml. Then, IVs were obtained by using an ultrasonic machine to break the cells, and 2 ml was taken each time for ultrasonication on ice (2 ml power: 20%-30%, 2s / 2s, 15s-120s). The liquid after ultrasonication was collected in a 2 ml EP tube and centrifuged at 2000g for 10 min and then 20000g for 30 min, and then the supernatant was collected and finally transferred to a new 15 ml centrifuge tube, marked with the date and stored at -80°C.

[0318] The steps for collecting intracellular vesicles from 293T cells are the same as above.

[0319] 1.3 Extraction of sIVs

[0320] Use a 50 ml syringe and a 0.45 μm filter to filter the supernatant (wet the filter membrane with PBS first), and use differential centrifugation to extract and separate IVs at a speed of RCF 150,000, a time of 70 min, and a temperature of 4°C. Resuspend the precipitate in each tube with 60 ul of clean PBS, collect it in an EP tube, and quantify the protein using the BCA method.

[0321] sEVs were obtained according to 1.1-1.3 and similar methods as in Example 8. sIVs / sEVs overexpressing Lamp2b-RGD are targeted modified sIVs / sEVs, and sIVs / sEVs transfected with empty vector virus are unmodified sIVs / sEVs, hereinafter referred to as sIVs-RGD, sEVs-RGD, sIVs-GFP, and sEVs-GFP.

[0322] 1.4 sIVs RGD Preparation of @PEDF

[0323] Take sIVs-RGD, add PEDF drug solution, mix well and place in a 37℃ incubator for 1 hour, add the liquid to a 100kDa ultrafiltration tube and centrifuge to remove free drugs. Wet the ultrafiltration tube with PBS, add the liquid and centrifuge at 14000g for 20min, then add 300ul of PBS and centrifuge at 14000g for 20min twice, then invert and centrifuge at 4000g for 2min to recover sIVs RGD @PEDF, temporarily stored at 4°C. At the same time, sIVs were obtained using a similar method GFP @PEDF and sEVs RGD @PEDF. Among them, sIVs RGD @PEDF and sEVs RGD @PEDF stands for sIVs and sEVs loaded with PEDF, sIVs GFP @PEDF and sEVs GFP @PEDF represents unmodified sIVs and sEVs loaded with PEDF.

[0324] 1.5 Quantification of sIVs by ELISA RGD @PEDF drug loading

[0325] Detection of sIVs by ELISA RGD @The concentration of the drug loaded in PEDF is determined by generating a standard curve from a series of 0~6ng / mL drug concentrations. 100ul of the standard solution and sample solution are added to the ELISA plate for detection. The drug concentration is used as the horizontal axis and the absorbance is used as the vertical axis to draw the standard curve and calculate the regression equation. This is used to calculate the drug loading rate and encapsulation rate.

[0326] 2. Statistical processing

[0327] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0328] 3. Experimental results

[0329] 3.1 Lamp2b-RGD lentivirus successfully expressed in MSCs

[0330] RGD is known to specifically target integrins, with weak expression in resting endothelial cells and most normal tissues, and strong high expression on proliferating endothelial cells, especially integrin αv and integrin β3. Therefore, we chose to overexpress RGD in MSCs, thereby collecting sIVs and sEVs that highly express RGD, aiming to target the lesion site of the retinal neovascularization model for treatment. Lamp2b is a lysosomal membrane protein and a transmembrane protein on the surface of the exosome membrane. In Example 8, we found that the expression level of Lamp2b in sIVs of cells was higher than that in sEVs, so Lamp2b-RGD lentivirus was constructed to transfect MSCs. Flag is a common lentiviral tag protein, and the successful expression of Flag can also be used to prove the successful transfection of lentivirus.

[0331] In the preliminary experiment, the MOI values ​​of transfection of lentivirus into MSC were 10, 30, and 50. The MSC cells of the normal control group, the empty group, and the transfected group were collected for protein denaturation and Western Blot experiments. The results showed that the target lentivirus Lamp2b-RGD was successfully overexpressed in MSC. The western blot results showed that when the MOI was 30, the overexpression multiple of Lamp2b had reached the maximum value ( Fig.14 ), and Flag, as a common lentiviral tag protein, was also successfully highly expressed, indicating that Lamp2b-RGD lentivirus was successfully overexpressed in MSCs. When the MOI was 30, the overexpression multiple of Flag tag protein reached the maximum value, and subsequent experiments were performed using MOI=30.

[0332] 3.2 In the MSC group with high expression of Lamp2b-RGD, the expression of Lamp2b in sIVs was higher than that in sEVs

[0333] Through the collection of sIVs and sEVs of normal MSC, empty group MSC and MSC with high expression of Lamp2b-RGD, protein denaturation and Western Blot experiments, we found that the expression of Lamp2b-RGD in sIVs of MSC in normal group and empty group was higher than that in sEVs ( Fig.15 ). It is worth noting that in the MSC group with high expression of Lamp2b, the expression of Lamp2b in sIVs was still higher than that in sEVs ( Fig.15 ).

[0334] 3.3 The drug loading capacity of sIVs is superior to that of sEVs

[0335] sEVs RGD sEVs loaded with PEDF-prepared composite formulations RGD @PEDF said that sIVs RGD sIVs loaded with PEDF-prepared composite formulations RGD @PEDF indicates that sEVs were detected by ELISA RGD @PEDF and sIVs RGD The results showed that the concentration of PEDF contained in sIVs was higher than that in sEVs, which proved that the drug loading capacity of sIVs was better than that of sEVs. Fig.16 ).

[0336] 4. Summary

[0337] This example demonstrates that Lamp2b-RGD lentivirus is successfully highly expressed in MSCs, and in the MSC group with high expression of Lamp2b-RGD, the expression of Lamp2b in sIVs is still higher than that in sEVs. The drug loading capacity of sIVs is better than that of sEVs.

[0338] Example 10: RGD-binding integrins are highly expressed in neovascularization in vitro and in vivo models

[0339] 1. Experimental methods

[0340] 1.1 Cell culture

[0341] Human HRECs were purchased from Angioproteomie, USA. Preparation of complete cell culture medium: Add 5 ml of fetal bovine serum, 1 ml of growth factor and 1 ml of penicillin-streptomycin to 93 ml of ECM basic medium to obtain a complete culture medium containing 5% serum. Use a low-power microscope to check the cell growth density, and use a high-power microscope to observe that the cells are round, oval or polygonal flat cells, with rich components in the cytoplasm and small vacuoles in the cells. The cells were inoculated in a culture flask and cultured in a 5% CO2 incubator at 37°C. The culture medium was changed every 3 days. When the cell fusion reached 80%, it was subcultured at a subculture ratio of 1:2, and cells from P3 to P5 were used for the experiment.

[0342] 1.2 Experimental animals

[0343] Healthy male C57BL / 6 mice, 8 weeks old, weighing 21-22 g, SPF grade, were purchased from Spaif (animal production license: SCXK (Beijing) 2019-0010). All experimental animals were fed a normal diet at room temperature, with a light and dark time of 12 h respectively. The animal breeding environment and experimental operation contents were in accordance with the provisions of the "Regulations on the Administration of Laboratory Animals" of the State Science and Technology Commission, and were approved by the Animal Ethics Committee of this hospital (ethics number: TJYY2023120297). The mice were divided into groups according to the random number table method for intravitreal injection.

[0344] 1.3 VEGF-induced proliferation of endothelial cells model

[0345] HRECs cells were seeded into 12-well culture plates with half culture medium (FBS 2.5% / ECG 0.05%), and the medium was changed after 12 hours of incubation and divided into two groups: normal group and VEGF group (10ng / ml), and incubated at 37°C for 24 hours. After removing the culture medium, the cells were washed with PBS, and the RNA and protein of the cells were collected respectively. PCR and Western blot were used to detect the expression levels of RGD-targeted integrins αV and β3 in VEGF-induced HRECs.

[0346] 1.4 Oxygen-induced retinopathy model (OIR mouse)

[0347] Neonatal C57BL / 6J mice and lactating mothers were exposed to hyperoxia (75% O2) for 5 days at postnatal day 7 (P7) and returned to room air at P12. The number of neonatal mice assigned to each lactating mother was equal, and the mothers were switched between oxygen chamber and normoxia every 24 h. Mice were provided with standard diet and water and randomly assigned to each treatment group. Retinal tissues of mice were collected on days 12, 14, and 17 to extract RNA and protein, and PCR and Western blot were used to detect the expression levels of RGD-targeted integrins αV and β3 in OIR mice.

[0348] 2. Statistical processing

[0349] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0350] 3. Experimental results

[0351] 3.1 RGD-binding integrins are highly expressed in VEGF-induced endothelial cells

[0352] Vascular endothelial growth factor (VEGF) is a highly specific endothelial cell growth factor that promotes vascular permeability, endothelial cell migration, proliferation and angiogenesis. The VEGF-induced endothelial cell proliferation model is the most common in vitro model of retinal neovascularization. RGD is known to specifically target integrins, which are weakly expressed in resting endothelial cells and most normal tissues, and strongly expressed in proliferating endothelial cells, especially integrin αv and integrin β3. Therefore, we first detected the expression of integrin αv and integrin β3 in VEGF-induced endothelial cells.

[0353] Western bolt experiments were performed by collecting proteins from VEGF-induced HRECs, and the results showed that RGD-binding integrins αV and β3 were highly expressed in VEGF-induced proliferating endothelial cells ( Fig.17 ).

[0354] 3.2 RGD-binding integrins are highly expressed in the retina of OIR mice

[0355] The oxygen induced retinopathy (OIR) mouse model uses high oxygen to create a non-perfused area of ​​the retina, inducing a significant upregulation of angiogenic factors, thereby forming new blood vessels. It is often used to verify the effects of drugs or therapeutic targets targeting retinal neovascularization.

[0356] The RNA of P12, P14 and P17 mouse retinas was collected for PCP, and the results showed that RGD-binding integrin αV was highly expressed in the retinas of OIR mice at P12, P14 and P17, and integrin β3 was highly expressed in the retinas of OIR mice at P14 and P17 ( Fig.18 ). Western bolt experiments were performed by collecting proteins from the mouse retinas at P12, P14, and P17. The results showed that RGD-binding integrin αV was highly expressed in the OIR mouse retinas at P12, P14, and P17, and integrin β3 was highly expressed in the OIR mouse retinas at P17 ( Fig.19 ).

[0357] 4. Summary

[0358] This example demonstrates that RGD-binding integrin αV and integrin β3 are highly expressed in VEGF-induced endothelial cells and OIR mice, indicating that sIVs and sEVs that highly express RGD can be used to study therapeutic effects.

[0359] Example 11: sIVs-RGD has a stronger ability to target neovascular endothelial cells than sEVs-RGD

[0360] 1. Experimental methods

[0361] 1.1 Cell culture

[0362] Human HRECs were purchased from Angioproteomie, USA. Preparation of complete cell culture medium: Add 5 ml of fetal bovine serum, 1 ml of growth factor and 1 ml of penicillin-streptomycin to 93 ml of ECM basic medium to obtain a complete culture medium containing 5% serum. Use a low-power microscope to check the cell growth density, and use a high-power microscope to observe that the cells are round, oval or polygonal flat cells, with rich components in the cytoplasm and small vacuoles in the cells. The cells were inoculated in a culture flask and cultured in a 5% CO2 incubator at 37°C. The culture medium was changed every 3 days. When the cell fusion reached 80%, it was subcultured at a subculture ratio of 1:2, and cells from P3 to P5 were used for the experiment.

[0363] 1.2 Experimental animals

[0364] Healthy male C57BL / 6 mice, 8 weeks old, weighing 21-22 g, SPF grade, were purchased from Spaif (animal production license: SCXK (Beijing) 2019-0010). All experimental animals were fed a normal diet at room temperature, with a light and dark time of 12 h respectively. The animal breeding environment and experimental operation contents were in accordance with the provisions of the "Regulations on the Administration of Laboratory Animals" of the State Science and Technology Commission, and were approved by the Animal Ethics Committee of this hospital (ethics number: TJYY2023120297). The mice were divided into groups according to the random number table method for intravitreal injection.

[0365] 1.3 Co-culture of DiD-labeled sIVs and sEVs with cells

[0366] The vesicles were incubated with the lipid-soluble tracer DiD solution at 37°C for 30 minutes. Excess DiD was removed by Amicon® Ultra centrifugal filter. The cells were seeded into pre-placed circular pieces on a 24-well culture plate and incubated for 24 hours. DiD-labeled vesicles were added to the culture medium of the cells and grouped into: sIVs and sEVs collected by UMSCs in the empty group and the Lamp2b-RGD high expression group (sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD vesicles were obtained as described in 1.3 of Example 9), and incubated at 37°C for different times: 12 hours or 24 hours. After removing the culture medium, the cells were washed with PBS at room temperature. The cells were fixed with 4% PFA for 10 minutes and then incubated with 0.1% Triton X-100 for 5 minutes at room temperature to permeabilize the cells. Subsequently, the cells were stained with CoraLite® Plus 488-conjugated Phalloidin antibody for 30 minutes at room temperature. The cell nuclei were labeled with DAPI. Finally, the cells were imaged using a confocal laser scanning microscope, and the amount of endocytosed vesicles was analyzed using Image J.

[0367] 1.4 Intravitreal injection of DiD-labeled vesicles into OIR mice

[0368] OIR mice were modeled as described above, and vesicles were stained with DiD as described above. DiD-labeled vesicles were injected into the conjunctiva of OIR mice at a mass of 1 μg. Eyeballs were collected for observation and evaluation at 8 hours, 24 hours, and 5 days after injection.

[0369] 1.5 Retinal sections

[0370] Frozen retinal sections (8 μm thick) were used for immunofluorescence analysis. Retinal sections were fixed with PFA for 15 minutes at room temperature, then the slides were washed with PBS and the cell nuclei were stained with DAPI. Finally, the slides were mounted with anti-fluorescence attenuation mounting medium and observed using a confocal laser scanning microscope.

[0371] 2. Statistical processing

[0372] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. SPSS22.0 was used to analyze all quantitative data. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. Nonparametric tests were used for non-normally distributed data and data with unequal variance. P Values ​​< 0.05 were considered statistically significant.

[0373] 3. Experimental results

[0374] 3.1 Cells have a better ability to internalize sIVs-RGD than sEVs-RGD

[0375] In order to evaluate the phagocytic ability of cells to the two types of vesicles, HRECs were co-cultured with the above four groups of vesicles (sEVs-GFP, sEVs-RGD, sIVs-GFP and sIVs-RGD) for 12 h ( Fig. 20 ) and 24h ( Fig.21 ). In brief, an equal amount of DiD-labeled vesicles were incubated with normal cells and VEGF-induced HRECs, and the distribution of DiD was observed using confocal microscopy at different time points to observe the cellular uptake of vesicles. The results showed that in HRECs, the internalization rate of sIVs by cells always exceeded that of sEVs. It is worth noting that the internalization rate of RGD-targeted sIVs-RGD by cells was always higher than that of sEVs-RGD.

[0376] 3.2 sIVs-RGD penetrates into the retina faster and stays there longer than sEVs-RGD

[0377] To evaluate the phagocytic ability of the retina to four groups of vesicles (sEVs-GFP, sEVs-RGD, sIVs-GFP, and sIVs-RGD), the same amount of DiD-labeled vesicles were administered to the eyes of OIR mice, a retinal neovascularization model mouse, by intravitreal injection. Eyeball samples were collected at different time points, and frozen sections were prepared, and confocal microscopy was used to observe the vesicle uptake in the retina.

[0378] After intravitreal injection of DiD-labeled vesicles, the vesicles spread from the vitreous cavity to the retina. The results showed that 8 hours after injection, sEVs were distributed in the vitreous cavity and had not yet reached the retina, while sIVs had reached the entire retinal layer and were internalized by the cells of the ganglion cell layer and the inner nuclear layer. The internalization rate of sIVs-RGD exceeded that of sIVs-GFP and sEVs-RGD ( Fig. 22 24 hours after intravitreal injection, the four types of vesicles were diffusely distributed throughout the retina, and the internalization rate of sIVs-RGD was always higher than that of sIVs-GFP and sEVs-RGD ( Fig. 22 C and D). Then, on day 5, the distribution of the four types of vesicles in the retina gradually decreased, but the distribution trend remained the same as the previous observations ( Fig. 22 E and F). Notably, sIVs-RGD penetrated into the retina faster and retained longer than sEVs, and the internalization rate of sIVs with high RDG expression in the retina of OIR mice was always higher than that of sIVs.

[0379] 4. Summary

[0380] This example shows that cells cultured in vitro have a better ability to internalize sIVs than sEVs, and compared with sIVs and sEVs with high RDG expression, sIVs with high RDG expression have a higher uptake rate in proliferating endothelial cells. Through intravitreal injection of mice, it was observed that the retina has a better ability to internalize sIVs than sEVs, sIVs-RGD penetrates into the retina faster and has a longer retention time than sEVs, and the internalization rate of sIVs with high RDG expression in the retina of OIR mice always exceeds that of sIVs. This finding fully demonstrates that sIVs have good tissue compatibility and that sIVs-RGD has a stronger ability to target neovascular endothelial cells.

[0381] Example 12: sIVs RGD @PEDF therapeutic effect on angiogenesis model in vitro

[0382] 1. Experimental methods

[0383] 1.1 Proliferation assay

[0384] HRECs were seeded in 96-well plates at a cell density of 4500 / well. VEGF solution (10 ng / ml) was added to the culture medium. Different groups were designed, with only VEGF solution added as the positive control group, and groups including sIVs-GFP, PEDF, sIVs GFP @PEDF, sIVs RGD @PEDF, sEVs RGD @PEDF, the sources of each vesicle refer to Example 9.

[0385] After culturing the experimental groups for 24 h, the proliferation of cells in each group was tested using the CCK method.

[0386] 1.2 Transwell migration assay

[0387] HRECs were planted at 8000 / well on the upper layer of the semipermeable membrane of the Transwell chamber of a 24-well plate. The semipermeable membrane was coated with an extracellular matrix to allow cell adhesion and migration. The culture medium was added to the lower chamber of the semipermeable membrane. After continuing to incubate for 24 hours according to the above grouping, the HRECs that passed through the semipermeable membrane were stained and counted, and the data were recorded and analyzed for their inhibitory effect on the migration ability of HRECs.

[0388] 1.3 Protein expression levels of inflammatory factors and angiogenesis-related factors

[0389] The BCA method was used to quantify the proteins extracted from HRECs after 24 hours of treatment in the above experimental groups. After the equal amount of protein was fully mixed with the loading buffer for denaturation, 7.5-12.5% ​​SDS-PAGE gel was used for electrophoresis, membrane transfer, blocking, antibody incubation and color development to detect the expression of the target protein and evaluate its effect on the protein expression level of inflammatory factors and angiogenesis-related factors.

[0390] 2. Statistical processing

[0391] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0392] 3. Experimental results

[0393] 3.1 sIVs RGD @PEDF inhibits VEGF-induced endothelial cell proliferation--CCK experiment

[0394] CCK test is a commonly used method to detect cell proliferation. The results show that simple sIVs cannot significantly inhibit the proliferation of endothelial cells, while sIVs RGD @PEDF can significantly inhibit the proliferation of endothelial cells, although it is similar to sEVs RGD -PEDF had no significant statistical difference, but compared with sIVs GFP @PEDF has a significant inhibitory effect on the proliferation of HRECs ( Fig.23 ).

[0395] 3.2 sIVs RGD @PEDF inhibited VEGF-induced endothelial cell migration--Transwell experiment

[0396] Transwell assay is a commonly used method to detect cell migration. The results show that sIVs alone cannot significantly inhibit the migration of endothelial cells, while sIVs RGD @PEDF can significantly inhibit the migration of endothelial cells, although it is similar to sEVs RGD -PEDF had no significant statistical difference, but compared with sIVs GFP @PEDF has a significant inhibitory effect on HRECs migration ( Fig.24 ).

[0397] 3.3 sIVs RGD @PEDF inhibits the release of inflammatory factors from endothelial cells induced by VEGF

[0398] ICAM-1 (intercellular cell adhesion molecule-1) is a member of the immunoglobulin superfamily of adhesion molecules and is an important adhesion molecule that mediates adhesion reactions. ICAM-1 is expressed at low levels on resting endothelial cells and is highly expressed in VEGF-induced endothelial cells.

[0399] The expression level of ICAM-1 was detected by collecting proteins from endothelial cells. The results showed that sIVs RGD @PEDF significantly reduced the expression level of ICAM-1, compared with simple PEDF and sIVs RGD Compared with sIVs, RGD @PEDF and sEVs RGD @PEDF has the same ability to inhibit ICAM-1 ( Fig.25 ), indicating that sIVs RGD @PEDF and sEVs RGD @PEDF has the same effect of suppressing inflammation.

[0400] 4. Summary

[0401] sIVs RGD @PEDF inhibited the proliferation and migration of endothelial cells induced by VEGF, which was significantly higher than that of sIVs-GFP, PEDF and sIVs GFP @PEDF has a significant inhibitory effect on the proliferation of HRECs and sEVs RGD @There was no significant statistical difference in the effect of PEDF.

[0402] Example 13: sIVs RGD In vitro experiments of PEDF compound preparations

[0403] 1. Experimental methods

[0404] 1.1 Intravitreal injection of OIR mice

[0405] OIR mice were modeled as described above. The intravitreal injection was performed at P12, with 1 μl of liquid injected into each eye. The groups included PBS, sIVs-GFP, PEDF, sIVs GFP @PEDF, sIVs RGD @PEDF, sEVs RGD @PEDF, the sources of each vesicle refer to Example 9, and then observation and evaluation are carried out.

[0406] 1.2 Retinal flat mount staining and analysis of neovascularization area and non-perfusion area

[0407] Retinal flat-slides were performed at p17. The mouse eyeballs were removed and fixed in paraformaldehyde at room temperature for 15 minutes, placed in cold PBS for 5-10 minutes, and the eyeballs were transferred to gauze. An incision was made at the corneoscleral limbus under an operating microscope. The sclera was gently torn open with two toothed forceps to remove the lens. The retina was cut into four petals with small scissors, and the obvious blood vessel clusters were cut off. Cold anhydrous methanol was gently dripped on the top of the retina for fixation. After the retina turned white, it was transferred to a 2ml flat-bottomed EP tube. The anhydrous methanol in the EP tube was aspirated, washed twice with PBS on a 4℃ shaker, 1ml of blocking solution was added and shaken at 4℃ for 2h, washed again with PBS twice, and then 200ul of IB4 was added and shaken at 4℃ overnight in the dark, washed with PBS 5 times, 1h each time, and sealed after washing. The stained retina was photographed under a confocal microscope, and the area of ​​retinal neovascularization and non-perfusion area was marked and counted using photoshop software to analyze whether there were significant statistical differences between the groups.

[0408] 1.3 Electroretinogram (ERG)

[0409] Retinal neurological function was assessed using an electroretinogram (ERG) instrument on P25 (±1 d) and P42 (±1 day) mice to assess retinal function in OIR mice. Mice were dark-adapted overnight and anesthetized before ERG. The cornea was anesthetized with 0.5% propoxytacaine, and gatifloxacin ophthalmic gel was applied to the ocular surface to prevent tissue drying. A reference electrode was inserted under the scalp, near the midline between the ears, and another electrode was inserted into the tail of the mouse. The −1.1, 0.1, 1.0, and 3.0 log (cd•s / m 2 ) light intensity stimulation parameter range, and each mouse was tested three times to obtain the average value. The a-wave amplitude was measured from the baseline to the trough of the a-wave, and the b-wave amplitude was measured from the peak of the a-wave to the peak of the b-wave, and was automatically quantified using the ERG software.

[0410] 1.4 Protein expression levels of inflammatory factors and angiogenesis-related factors

[0411] The BCA method was used to quantify the proteins extracted from the retinas of P17 mice in the above experimental groups. After the equal amount of protein was fully mixed with the loading buffer for denaturation, 7.5-12.5% ​​SDS-PAGE gel was used for electrophoresis, membrane transfer, blocking, antibody incubation and color development to detect the expression of the target protein and evaluate its effect on the protein expression level of inflammatory factors and angiogenesis-related factors.

[0412] 2. Statistical processing

[0413] The experimental data are expressed as mean ± standard deviation ( ). All experimental data were tested for normality. All quantitative data were analyzed using SPSS22.0. One-way ANOVA was used for variance analysis, and the least significant difference (LSD) analysis was used for post hoc test. For non-normally distributed data and data with unequal variance, nonparametric tests were used, and P values ​​< 0.05 were considered statistically significant.

[0414] 3. Experimental results

[0415] 3.1 sIVs RGD @PEDF significantly reduced the area of ​​retinal non-perfusion in OIR mice and inhibited the formation of new blood vessels

[0416] OIR mice were treated with different concentrations of sIVs RGD @PEDF and sEVs RGD @PEDF intravitreal injection, retinal flat mount was performed at P17, and the area of ​​retinal non-perfusion area and neovascularization area were counted. The results showed that sIVs RGD @PEDF inhibited the formation of retinal non-perfusion areas and new blood vessels at low concentrations (0.5 mg / ml), medium concentrations (1 mg / ml) and high concentrations (2 mg / ml). The therapeutic effect of the medium concentration was more obvious than that of the low concentration, but there was no significant statistical difference between the medium concentration and the high concentration. Therefore, the medium concentration of sIVs was selected. RGD @PEDF and sEVs RGD @PEDF conducted follow-up experiments ( Fig.26 ).

[0417] The retinal non-perfusion area and the area of ​​new blood vessels were counted by flat mount of the mice in each treatment group. The results showed that sIVs RGD @PEDF significantly inhibited the formation of retinal non-perfused areas and neovascularization, which was similar to sEVs RGD @PEDF has the same therapeutic effect as untargeted sIVs GFP@PEDF has better therapeutic effect than Fig. 27 ).

[0418] 3.2 sIVs RGD @PEDF has a better neuroprotective effect than sEVs RGD @PEDFStrong

[0419] We used ERG to evaluate the retinal electrophysiological function of OIR mice at P42 and found that the amplitudes of the a-wave and b-wave of the ERG in untreated OIR mice were reduced ( Fig.28 Figure 3 (A and C) represents the reduction in bipolar cell and photoreceptor cell function. Statistically, OIR mice showed a significant reduction in light responses at all flash intensities tested, with sIVs, sIVs GFP @PEDF, sIVs RGD @PEDF and sEVs RGD @PEDF treatment significantly rescued the retinal light response ( Fig.28 In addition, sIVs RGD @PEDF significantly outperformed sEVs in terms of improvements in a-wave amplitude and b-wave amplitude at the highest stimulation RGD @PEDF and sIVs GFP @PEDF Fig.28 In summary, our results suggest that sIVs RGD @PEDF has a better neuroprotective effect than sEVs RGD @PEDF and sIVs GFP @PEDF Strong.

[0420] 3.3 sIVs RGD @PEDF has a better ability to inhibit inflammation than sEVs RGD @PEDFStrong

[0421] GFAP is a marker of astrocyte activation and an important factor related to retinal inflammation. The expression level of GFAP was detected by collecting retinal proteins of OIR mice at P17. The results showed that sIVs RGD PEDF significantly reduced the expression level of GFAP and was more effective than non-targeted sIVs GFP @PEDF has a more significant therapeutic effect than sIVs RGD @PEDF has a higher ability to inhibit GFAP expression than sEVs RGD @PEDF is stronger, indicating sIVs RGD @PEDF is more effective than non-targeted treatments, and sIVs RGD@PEDF has a better ability to inhibit inflammation than sEVs RGD @PEDF is stronger ( Fig.29 A and B).

[0422] Vascular endothelial growth factor (VEGF) is a highly specific growth factor that promotes vascular endothelial cell growth. It has the functions of increasing vascular permeability, promoting vascular endothelial cell migration, proliferation and angiogenesis. It is an important angiogenesis-related factor. The expression level of VEGF was detected by collecting retinal proteins of OIR mice at P17. The results showed that sIVs RGD @PEDF significantly reduced the expression level of VEGF and was more effective than non-targeted sIVs GFP @PEDF has a more significant therapeutic effect than sIVs RGD @PEDF and sEVs RGD @PEDF has the same ability to inhibit VEGF, indicating that sIVs with angiogenesis targeting RGD @PEDF is more effective than non-targeted treatments, and sIVs RGD @PEDF and sEVs RGD @PEDF has the same inhibitory effect on VEGF ( Fig.29 A and C).

[0423] 4. Summary

[0424] sIVs RGD The therapeutic effect of PEDF on OIR mice was dose-dependent. At a dose of 1 mg / ml, it significantly reduced the area of ​​retinal non-perfusion in OIR mice, inhibited the formation of new blood vessels, inhibited retinal inflammation, protected the structure and function of the retina, and was more effective than sIVs with the ability to target new blood vessels. GFP @PEDF has a stronger effect. It is worth noting that sIVs RGD @PEDF has better ability to inhibit inflammation and protect neurons than sEVs RGD @PEDF Strong.

[0425] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0426] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience and preference of those skilled in the art.

[0427] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. A method for preparing targeted nanovesicles derived from cells, comprising the following steps: (1) Introducing nucleotides encoding a fusion protein of the targeting molecule-Lamp2b into cells; (2) dispersing the cells obtained in step (1) in a suspending solvent and subjecting them to ultrasonic treatment; (3) centrifuging the liquid obtained in step (2) once or multiple times, discarding cell membranes and organelle fragments, and taking the supernatant; (4) The supernatant obtained in step (3) is subjected to ultracentrifugation to obtain the precipitate as intracellular nanovesicles. The amplitude of the ultrasonic treatment in step (2) is 20%-25%, and the time of the ultrasonic treatment is 10-20s; The number of centrifugation treatments in step (3) is two times. Their respective parameters are: 1000-3000g, 5-20 minutes; 10000-30000g, 20-40 minutes; The parameters of the ultracentrifugation treatment in step (4) include 100000-180000g, 50-100 minutes, The targeting molecule is selected from A25 polypeptide or RGD polypeptide, the cell is a stem cell, and the stem cell is a mesenchymal stem cell.

2. The method according to claim 1, characterized in that Step (1) comprises: constructing a plasmid that overexpresses a fusion protein of the targeting molecule-Lamp2b, then packaging the plasmid into a lentivirus, and transfecting cells with the lentivirus.

3. The method according to claim 1, characterized in that The targeting molecule is located at the N-terminus of Lamp2b.

4. The preparation method according to claim 1, characterized in that: The amplitude of the ultrasonic treatment in step (2) is 20%; and / or the time of the ultrasonic treatment is 15s, on 2s, off 2s.

5. The preparation method according to claim 1, characterized in that: The mesenchymal stem cells include: umbilical cord mesenchymal stem cells, bone marrow mesenchymal stem cells, adipose mesenchymal stem cells, dental pulp mesenchymal stem cells, placenta and amniotic fluid and amniotic membrane mesenchymal stem cells.

6. A vesicle prepared according to the method according to any one of claims 1 to 5.

7. The vesicle according to claim 6, characterized in that The vesicles are intracellular nanovesicles modified by overexpression of A25-Lamp2b or intracellular nanovesicles modified by overexpression of RGD-Lamp2b.

8. Use of the vesicles prepared according to the method according to any one of claims 1 to 5 as drug carriers in the preparation of drugs for preventing and / or treating diseases, wherein the vesicles are intracellular nanovesicles modified by overexpression of A25-Lamp2b, the drug is IL-10, and the disease is autoimmune uveitis.

9. Use of the vesicles prepared according to the method according to any one of claims 1 to 5 as drug carriers in the preparation of drugs for preventing and / or treating diseases, wherein the vesicles are intracellular nanovesicles modified by overexpression of RGD-Lamp2b, the drug is PEDF, and the disease is retinal neovascularization disease.

10. A method for preparing drug-loaded vesicles, comprising using the vesicles prepared by the method according to any one of claims 1 to 5 as drug carriers for drug loading.

Images