An immune-inducing protein Pst09944 from wheat stripe rust and its related biomaterials and applications

Abstract

The present invention belongs to the field of genetic engineering technology, and relates to an immune-inducing protein Pst09944 from wheat stripe rust and related biological materials and applications. The present invention provides an immune-inducing protein Pst09944 from wheat stripe rust, which has an amino acid sequence as shown in SEQ ID NO:1 and is encoded by a nucleotide sequence as shown in SEQ ID NO:2. The present invention can provide a new material basis and theoretical basis for the development of natural immune-inducing resources for Solanaceae crops; it also provides a new direction for the prevention and control of stripe rust and the improvement of wheat disease resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and relates to an immune-inducing protein Pst09944 from wheat stripe rust and related biological materials and applications thereof. Background Art

[0002] Puccinia striae wheat-specific form (Puccinia striae, Puccinia striiformis f. sp. tritici ) is a disease in wheat-growing areas. After the stripe rust fungus infects the host plant, the host plant will show symptoms such as wilt and necrosis, which will weaken the vitality of the host plant, reduce the number of tillers, ears and seeds, and reduce the plant height and seed weight and quality, resulting in yield loss and quality decline. In order to broaden and enrich the wheat stripe rust resistance gene resource pool, scientific and technological workers continue to discover stripe rust resistance genes from wheat promotion varieties, local varieties, wild relatives and distant species. The rapid mutation of the toxic subspecies of stripe rust enables it to overcome the disease-resistant genes in wheat varieties and adapt to different environmental conditions. Based on the plant immune defense mechanism, discovering natural immune inducer resources from pathogens and clarifying the activation mechanism of inducers to improve crop resistance are the core issues in formulating crop disease prevention and control strategies, and are also the molecular basis for designing plant immune inducers as pesticides. Therefore, identifying the immune elicitors of stripe rust, exploring new genetic resources, and conducting in-depth research on the targets, receptor recognition, key activation sites, signal transduction, and activation mechanisms of inducers are of great theoretical significance for the long-term prevention and control of wheat stripe rust.

[0003] With the continuous struggle between pathogens and plants, plants have evolved pattern recognition receptors (PRRs) located on the cell surface to recognize pathogen-associated molecular patterns (PAMPs) and stimulate a series of downstream immune responses. Taking bacterial flagellin as an example, flagella are a whip-like motility organ of bacteria, mainly found in Gram-negative bacteria. Flagella not only provide motility for bacteria, but also help bacteria invade and adhere to host cells through chemotaxis. They also participate in biofilm formation and are related to the bacterial virulence secretion system. They are essential structures for bacterial pathogenic potential. In 1999, Felix et al. first discovered that the 22 conserved amino acids at the N-terminus of flagellin from pathogens such as Pseudomonas syringae DC3000 can be recognized by plants, and the polypeptide composed of this amino acid sequence (flg22) can induce immune responses in tomatoes and Arabidopsis. Through map-based cloning and receptor-ligand binding analysis, FLS2 (Flagellin-sensitive 2) was confirmed as the receptor of flg22. flg22 is the most intensively studied PAMP, and flg22-induced immunity is also one of the most frequently used model systems for studying plant-microbe interactions. INF1 is a lipid-binding protein and one of the most representative PAMPs in oomycetes. It can be recognized by a variety of cruciferous and solanaceous plants and stimulate defense responses. In addition. Phytophthora LRR-RLK has a relatively short extracellular domain, a small number of LRR motifs, and the kinase region has evolved independently from plant kinases. The latest research has found that the extracellular LRR (Leucine-rich repeat) fragment of the oomycete RLK6 protein can be recognized by plants as a PAMP. Chitin oligosaccharides are typical PAMPs from fungi. Chitin is composed of a series of 1,4-linked N-acetylglucosamines, which are widely distributed in fungal cell walls, arthropod exoskeletons and nematodes. During the process of plant pathogenic fungi infecting the host, the hydrolases produced by the host, such as chitinase, can degrade the fungal cell wall to produce chitin oligomers, which in turn activate the host immune response. Molecules that recognize chitin oligomers are located on the cell surface. It is known that there are immune receptors such as CERK1. After CERK1 recognizes chitin oligomers, it will induce a series of immune responses. In addition to chitin, a series of PAMP molecules from pathogenic fungi have been reported in recent years. For example, a serine-threonine-rich glycosylphosphatidylinositol anchored protein SGP1 of rice smut fungus induces an immune response on rice leaves, and plants can specifically recognize the 22 conserved amino acids SNP22 at its N-terminus.The secretory protein VP2 of Verticillium dahliae is mainly expressed in the middle stage of pathogen invasion of cotton, and can cause reactive oxygen burst and necrosis in tobacco, Arabidopsis and cotton leaves. The resistance of VP2 transgenic cotton to Verticillium dahliae at the seedling stage was significantly enhanced, and the expression of genes involved in cell wall modification, response to fungi and lignin metabolism in transgenic cotton was significantly enhanced. The lignin content in transgenic cotton was also significantly enhanced, indicating that VP2 can induce immunity in cotton.

[0004] Ion influx is one of the fastest known pathogen-associated molecular pattern-triggered immune responses (PAMP-triggered immunity, PTI). Different PAMPs or DAMPs can cause the opening of ion channels located on the cell membrane and the activation of extracellular Ca within 0.5-2 minutes. 2+ Influx. Under normal circumstances, free Ca in the apoplast 2+ The concentration is much higher than that in the cytoplasm. When the plant immune receptor recognizes the pathogen, it can quickly activate Ca 2+ channels, triggering intracytoplasmic Ca 2+ The instantaneous increase of Ca 2+ The influx of PAMPs is the basis for triggering downstream immune signal transduction. The production of reactive oxygen species (ROS) induced by PAMPs is another typical early immune response. 2+ The influx of ROS and the production of ROS are one of the basic responses of plant cells to pathogen stress. When plants are infected by pathogens, they will quickly produce a large amount of ROS, which will reach a peak at a certain time. This is called reactive oxygen burst. ROS itself can act as an antibacterial agent, and it can also promote the cross-linking of glycoproteins in the cell wall, causing the cell wall to thicken. In addition, the mechanism of ROS production is similar to Ca 2+ Closely related: After PTI activation, the PRR complex can activate Ca through cytoplasmic receptor kinases 2+ channels, leading to cytoplasmic Ca 2+ Up-regulated; Ca 2+It can also directly bind to and activate RBOHD, or activate the activity of related kinases to induce phosphorylation of RBOHD, thereby causing the rapid generation of ROS. The mitogen-activated protein kinase (MAPK) cascade is an evolutionarily highly conserved and functionally important signaling module in eukaryotes. It transmits and amplifies these signals step by step through the step-by-step phosphorylation of MAPKKKs, MAPKKs, and MAPKs. Activated MAPKs phosphorylate downstream substrates, causing changes in cellular physiological activities. Currently, the plant MAPK cascade with the most responses is the MKK4 / 5-MPK3 / 6 cascade. In addition to the above signal events, PTI classical signal transduction events also include the expression of defense genes, stomatal closure, callose deposition, etc. Since the immunity level of plants is closely related to their growth inhibition, the continuous activation of plant immunity may also lead to the weakening of plant growth, which is also called immune self-activation.

[0005] It is worth noting that although great progress has been made in the study of apoplast effectors such as PAMP, the PAMP molecules in rust fungi have not yet been identified. Discovering the PAMP molecules of rust fungi and exploring their molecular mechanisms of action are important scientific issues that need to be solved urgently, and also provide new genetic resources and green immune induction materials for breeding wheat resistance to stripe rust. Summary of the invention

[0006] The present invention screens out the immune-resistant protein Pst09944 and the immune-resistant gene Pst09944 by means of genetic engineering, and reveals their disease-resistant mechanism in the interaction between Solanaceae plants and stripe rust by functional analysis of the protein and gene, thus providing a solution for the cultivation of stripe rust-resistant materials.

[0007] To achieve this technical purpose, the present invention adopts the following technical solution.

[0008] In a first aspect, the present invention provides an immunity-inducing protein Pst09944 from wheat stripe rust, having an amino acid sequence as shown in SEQ ID NO:1.

[0009] In a second aspect, an immunity-inducing gene Pst09944 from wheat stripe rust is provided, comprising a nucleotide sequence encoding the immunity-inducing protein Pst09944 of the present invention.

[0010] Preferably, the immune inducing gene Pst09944 has a CDS sequence as shown in SEQ ID NO:2.

[0011] Preferably, transient expression of the immune-inducing gene Pst09944 can improve the resistance of Solanaceae plants to stripe rust.

[0012] In a third aspect, an expression vector is provided, wherein the expression vector contains the immune-inducing gene Pst09944 described in the present invention.

[0013] In a fourth aspect, a method for breeding stripe rust-resistant varieties of Solanaceae plants is provided, comprising the step of transferring the specific fragment of the immune-inducing gene Pst09944 described in the present invention into Solanaceae plants.

[0014] In a fifth aspect, a method for breeding stripe rust-resistant varieties of Solanaceae plants is provided, comprising the step of transferring the expression vector of the present invention into Solanaceae plants.

[0015] In a sixth aspect, the invention provides the use of the immune-inducing protein Pst09944 in the breeding of stripe rust-resistant varieties of Solanaceae plants.

[0016] In a seventh aspect, there is provided the use of the immune-inducing gene Pst09944 described in the present invention in the breeding of stripe rust-resistant varieties of Solanaceae plants.

[0017] In an eighth aspect, there is provided application of the expression vector of the present invention in breeding stripe rust resistant varieties of Solanaceae plants.

[0018] Those skilled in the art can easily mutate the nucleotide sequence encoding the immune-inducing protein Pst09944 of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the immune-inducing gene Pst09944 isolated from the present invention are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the immune-inducing protein Pst09944 and have the same function.

[0019] In the present invention, the term "identity" refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, 85% or more, 90% or more, 95% or more identity with the nucleotide sequence of the protein composed of the amino acid sequence shown in the coding sequence 2 of the present invention. Identity can be evaluated by the naked eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0020] The above-mentioned 75% or more identity may be 80%, 85%, 90% or 95% or more identity.

[0021] The expression cassette containing the nucleic acid molecule encoding the immune-inducing protein Pst09944 (immune-inducing gene Pst09944 expression cassette) mentioned above refers to a DNA capable of expressing Pst09944 in a host cell, and the DNA may include not only a promoter for initiating transcription of Pst09944, but also a terminator for terminating transcription of Pst09944. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters; tissue, organ and development-specific promoters and inducible promoters.

[0022] In the present invention, the term "nucleotide sequence" or "polynucleotide" refers to a linear polymer of natural or synthetic nucleotide residues connected by phosphodiester bonds or their analogs. It can be single-stranded or double-stranded, and includes RNA, DNA (e.g., genomic, cDNA or synthetic), analogs thereof, or combinations thereof. It should be understood by those skilled in the art that the order of representation of nucleotide sequences is usually 5'-3' order from left to right, and, unless otherwise indicated, "A" refers to deoxyadenosine, "C" refers to deoxycytidine, "G" refers to deoxyguanosine, "T" refers to deoxythymidine, and "U" refers to the ribonucleoside, uridine. Typically, nucleotide sequences contain four natural deoxynucleotides or four natural ribonucleotides; however, they can also contain non-natural nucleotide analogs.

[0023] In the present invention, the term "amino acid sequence" refers to the order in which amino acids are arranged in a protein. This sequence is determined by genetic information, specifically, by genes in DNA or RNA through the process of transcription and translation. Amino acid sequences are usually represented by a string of letters, each letter representing a specific amino acid. These sequences are arranged in the direction from the N-terminus (amino terminus) to the C-terminus (carboxyl terminus). In biology, there are 20 different standard amino acids, each of which has a specific single-letter or three-letter abbreviation. For example, the three-letter and single-letter abbreviations for methionine (Lysine) are Lys and K, respectively.

[0024] In the present invention, the term "gene" is the main substance of genetic variation. It is the basic unit for controlling traits, and is composed of many different base pair arrangements on deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) molecules that determine biological traits. Genes express the genetic information they carry by guiding the synthesis of proteins, thereby controlling the expression of traits of biological individuals. Specifically, genes are located on chromosomes and are arranged linearly. They are genetic units that occupy a certain position on chromosomes. Genes have duality, that is, they can faithfully replicate themselves to maintain the basic characteristics of organisms; at the same time, they may mutate during reproduction. Mutated genes can also continue to replicate and pass on to offspring. Genes can not only pass genetic information to the next generation through replication, but also express genetic information on the molecular structure of proteins. Therefore, genes are the basic units for controlling traits. A gene has only one DNA molecule, but a DNA molecule contains multiple genes. Genes are fragments on DNA molecules that have genetic effects, and they determine the expression of traits.

[0025] In the present invention, the term "protein" refers to protein, which is the material basis of life, an organic macromolecule, the basic organic matter constituting cells, and the main bearer of life activities. Without protein, there is no life. Amino acids are the basic building blocks of protein. It is a substance closely associated with life and various forms of life activities.

[0026] The CDS (Coding sequence) sequence is a sequence that encodes a protein product. It refers to a DNA sequence that corresponds one-to-one with the protein sequence, and the sequence does not contain other sequences that do not correspond to the protein. CDS is the coding region in mRNA (messenger RNA), starting from the start codon (AUG) and ending with the stop codon (UAG, UGA, UAA), which completely corresponds to the codon of the protein. The CDS sequence is a single-stranded DNA sequence that is located in the gene and guides the transcription of mRNA and the subsequent translation of protein. The promoter sequence is a specific DNA sequence located upstream of the CDS, which participates in the transcription and regulation of specific genes. The range of the promoter is very large, which can include 2000bp upstream of the transcription start site. There are also binding sites for transcription factors in the transcription region of some specific genes, so they also belong to the promoter range. For example, prokaryotes have a conserved sequence of TATAAT at -10 upstream of the transcription start site, which helps local unwinding, and a TTGACA sequence at -35 to provide RNA polymerase recognition signals.

[0027] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0028] In order to screen the secretory protein of stripe rust with immune elicitor activity, the present invention systematically analyzed the protein with secretory signal peptide of stripe rust physiological race CYR32, and cloned the secretory protein immune inducing protein Pst09944 that can cause cell death on Nicotiana benthamiana. Using Agrobacterium-mediated transient expression technology, immune inducing protein Pst09944, immune inducing protein Pst09944△SP (signal peptide removed version), negative control GFP and positive control gene INF1 that can cause death were injected into Nicotiana benthamiana, and the expression of corresponding proteins was also detected using western blot technology. The results can confirm that immune inducing protein Pst09944 can cause cell death and depends on its secretory activity. In addition, the cell death caused by immune inducing protein Pst09944 depends on the classic co-receptor BAK1 rather than SOBIR1, which also provides an entry point for the subsequent identification of recognition receptors and signal transduction research.

[0029] After discovering that the immune-inducing protein Pst09944 has the activity of inducing the elicitor of plant cell death, the present invention wants to further clarify whether the activity can induce plant immunity, thereby improving resistance to pathogens. To this end, the present invention expresses and purifies the immune-inducing protein Pst09944 in vitro. Studies have found that compared with the classic PAMP molecule flg22, the exogenous application of the immune-inducing protein Pst09944 can also induce the activation of MAPK and the burst of extracellular reactive oxygen species in Nicotiana benthamiana, while the control GFP protein cannot induce the corresponding immune response; in addition, compared with the leaves transiently expressing GFP, the transient expression of the immune-inducing gene Pst09944 on the leaves of Nicotiana benthamiana can induce the significant upregulation of the marker gene NbCYP71D20 of the PTI signal, and effectively inhibit the infection of parasitic Phytophthora in Nicotiana benthamiana. Therefore, the present invention believes that the immune-inducing protein Pst09944 is a new pathogen-related molecular pattern derived from stripe rust that can play an immune-inducing function in the heterologous host Nicotiana benthamiana.

[0030] Nicotiana benthamiana is different from wheat, and the two are completely different plant types of genera and species. Therefore, the present invention intends to further explore whether the immune-inducing activity of the immune-inducing protein Pst09944 can induce resistance in wheat, and whether it has the same function in other plants. The results showed that the immune-inducing protein Pst09944 can cause different degrees of cell death in Arabidopsis and tomatoes, but does not have the ability to cause cell death in corn and rice. Similarly, it cannot cause cell death in wheat, and wheat leaves treated with the immune-inducing protein Pst09944 have not been found to improve resistance to the physiological race CYR31 of stripe rust.

[0031] Starting from the principle of reaction genetics, the present invention uses biochemical tests, pathogen inoculation and other means to identify and clarify that the immune-inducing protein Pst09944 secreted by stripe rust is a new type of pathogen-related molecular pattern. The immune-inducing protein Pst09944 can trigger cell death in Solanaceae plants such as tomatoes and Nicotiana benthamiana, but this activity has not been found in monocotyledonous crops such as wheat, corn and rice. This discovery provides a new material basis and theoretical basis for the development of natural immune-inducing resources for Solanaceae crops; at the same time, it provides a new direction for the prevention and control of stripe rust and the improvement of wheat disease resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solution of the present invention, the drawings involved in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the description are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0033] Figure 1 The immune-inducing protein Pst09944 (abbreviated as Pst09944) caused cell death in Nicotiana benthamiana leaves;

[0034] Figure 2 A series of typical immune responses of Nicotiana benthamiana triggered by the immune-inducing protein Pst09944 (abbreviated as Pst09944);

[0035] Figure 3 These are the test results of the ability of the immune-inducing protein Pst09944 (abbreviated as Pst09944) to induce cell death. DETAILED DESCRIPTION

[0036] The technical scheme of the present invention is described below in conjunction with the examples, but the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials are available on the market unless otherwise specified, and the % in the following examples are all mass percentages unless otherwise specified.

[0037] Reference Figure 1 The results show that the immune-inducing protein Pst09944 (abbreviated as Pst09944) causes cell death in Nicotiana benthamiana leaves; Figure 1 A in the figure is the injection of the corresponding protein into Nicotiana benthamiana leaves using Agrobacterium transient expression technology, in which INF1 is an immune elicitor of the reported oomycete that can cause cell death and is used as a positive control; GFP is used as a negative control; Pst09944 can cause cell death, but Pst09944△sp, which has no secretory activity, cannot cause cell death; Figure 1B in the figure is immunoblotting detection Figure 1 The proteins in A were all successfully expressed; α-HA represents immunoblotting using HA-specific antibodies, and Ponceau S is Ponceau red staining to illustrate consistent protein loading; Figure 1 C in the figure indicates cell death caused by Pst09944; it depends on receptor protein kinase bak1 Rather than relying on sobir1 ; bak1 It is a Nicotiana benthamiana plant with a BAK1 gene mutation. sobir1 N. benthamiana plants with the SOBIR1 gene, in which INF1-induced cell death depends on both, were used as controls; Figure 1 D in the figure is immunoblotting detection Figure 1 The proteins in C are all expressed normally; α-HA represents immunoblotting using HA-specific antibodies, and Ponceau S is Ponceau red staining to illustrate consistent protein loading.

[0038] Reference Figure 2 A series of typical immune responses of Nicotiana benthamiana triggered by treatment with immune-inducing protein Pst09944 (abbreviated as Pst09944) are shown; Figure 2 A in the figure shows that Pst09944 treatment of Nicotiana benthamiana can cause MAPK activation, where flg22 is used as a positive control and GFP is used as a negative control; Figure 2 B in the figure shows that Pst09944 treatment can induce a burst of extracellular reactive oxygen species in Nicotiana benthamiana, where flg22 is used as a positive control and GFP is used as a negative control; Figure 2 C in the figure indicates that Pst09944 treatment of Nicotiana benthamiana can induce defense-related genes NbCYP71D20 The expression of GFP was significantly upregulated, with GFP treatment as a control; Figure 2 D in the figure means that Pst09944 treatment of N. benthamiana can improve the resistance of N. benthamiana to Phytophthora parasiticus, with GFP treatment as the control. The left figure directly reflects the length of lesions produced on leaves after different treatments, and the right figure is a statistical analysis of the final lesion length (cm) produced on all leaves after treatment and inoculation with Phytophthora parasiticus.

[0039] Reference Figure 3 It was shown that the treatment with the immune-inducing protein Pst09944 (abbreviated as Pst09944) can specifically cause cell death in Arabidopsis and tomatoes, but not in monocots such as corn and rice, and cannot enhance wheat resistance to stripe rust. Figure 3 A in the figure shows the cell death caused by treating the corresponding plant leaves with GFP (GFP protein) with HIS tag and Pst09944 with HIS tag. Arabidopsis thaliana(Arabidopsis thaliana), Solanum lycopersicum (tomato), Zea mays (corn) and Oryza sativa (Rice) can specifically induce cell death in Arabidopsis and tomato, but not in corn and rice; GFP-HIS treatment was used as a control; Figure 3 Figure B shows wheat treated with water (Mock), GFP with HIS tag (GFP protein), and Pst09944 with HIS tag, and then inoculated with stripe rust physiological race CYR31 and without treatment; Pst09944 treatment had no effect on the control GFP treatment. Triticum aestivum L. (Wheat) Resistance to stripe rust race CYR31.

[0040] Example 1

[0041] This example provides Agrobacterium-mediated transient expression

[0042] (1) Take out the Agrobacterium tumefaciens glycerol culture from the -80℃ refrigerator, and apply 30-50 μL of the culture solution on the LB plate containing the corresponding antibiotics. After the LB plate is dried, place it in an incubator at 28℃ and incubate it upside down for 36-48 h.

[0043] (2) The preparation system of the washing buffer for transient expression is shown in Table 1 below:

[0044] Table 1 Preparation system of washing buffer for transient expression

[0045]

[0046] Note: The washing buffer should be prepared and used immediately. After Acetosyringone is dissolved in DMSO to a 100 mM stock solution, it should be divided and wrapped in tin foil and stored in a -20°C refrigerator to avoid repeated freezing and thawing.

[0047] (3) Scrape the Agrobacterium grown on the LB plate into 1 mL of washing buffer and use a pipette to mix the bacteria completely. Take 20 μL of the bacterial suspension into 480 μL of washing buffer and dilute it 25 times for measuring OD 600 ;

[0048] (4) According to OD 600 The measurement results are calculated, and the bacterial suspension is diluted with washing buffer to adjust to OD 600 = 0.5, placed in a 28°C constant temperature incubator incubated in the dark for 2-4 h;

[0049] (5) Select 5-week-old Nicotiana benthamiana seedlings with consistent growth. The top fully expanded leaf is the first leaf, and the first, second, and third leaves are selected for transient expression. Use a disposable 1 mL needleless syringe to avoid the leaf veins and inject the incubated Agrobacterium suspension onto the back of the tobacco leaf. Use absorbent paper to absorb the excess liquid in time and mark it;

[0050] (6) After the injection is completed, put the tobacco back in place.

[0051] The experimental results are as follows Figure 1 As shown by Figure 1 It can be seen that Pst09944 successfully expressed by Agrobacterium can induce cell death in Nicotiana benthamiana leaves, and the cell death depends on the receptor kinase BAK1 but not SOBIR1. The immune inducing protein Pst09944 has an amino acid sequence as shown in SEQ ID NO:1, the immune inducing gene Pst09944 includes a nucleotide sequence encoding the immune inducing protein Pst09944, and the immune inducing gene Pst09944 has a CDS sequence as shown in SEQ ID NO:2.

[0052] Example 2

[0053] This example provides inoculation of Phytophthora parasiticus

[0054] (1) Transfer the mycelium block from the original Phytophthora plate to a new 10% V8 medium and incubate it upside down in a 28°C constant temperature incubator for 3-4 days;

[0055] (2) Prepare a clean inoculation plate, place three layers of absorbent paper on the bottom of the plate, and add 80 mL of sterile water to fully wet the absorbent paper;

[0056] (3) Use scissors to cut off the leaves of Nicotiana benthamiana after transient expression of Agrobacterium for 2 days and keep the petiole of about 3 cm in length, wrap the petiole with moistened absorbent cotton, and place the leaves with the reverse side facing up in the inoculation plate;

[0057] (4) Use a yellow gun tip to pick up a mycelium block of the same size from the edge of the activated Phytophthora plate. You can use the needle of a 1 mL syringe to pick up the mycelium block and place it with the reverse side facing up at the injection site on the back of the tobacco leaf (the mycelium block should avoid the site and leaf veins that are injured during injection);

[0058] (5) Pipette 18 μL of sterile water and add it to the contact surface between the mycelium block and the leaf to ensure full contact between the two.

[0059] (6) Seal the inoculated plate with plastic wrap to keep it moist, and place it in a constant temperature incubation room at 22°C in the dark for 36-60 h.

[0060] (7) Observe the size of the lesions after infection by Phytophthora parasitica and take photos to record;

[0061] (8) Count the size of each replicate lesion.

[0062] The experimental results are as follows Figure 2 As shown by Figure 2 As shown in D, Pst09944 effectively inhibited the colonization of Phytophthora parasiticus.

[0063] Example 3

[0064] This example provides the extraction of total RNA from plant materials

[0065] (1) Take an appropriate amount of plant leaves and place them in a 2 mL centrifuge tube without RNase, add steel balls with a diameter of 3 mm, freeze them in liquid nitrogen, and then crush them with a tissue grinder;

[0066] (2) Add 1 mL of Trizol to the crushed plant material, mix quickly, and let stand at room temperature for 5 minutes to completely separate the nucleic acid-protein complex;

[0067] (3) Centrifuge at 4°C, 10,000 rpm for 5 min and transfer the supernatant to a new RNase-free centrifuge tube;

[0068] (4) Add 200 μL of chloroform to the supernatant, shake vigorously for 15 s, and leave at room temperature for 3 min;

[0069] (5) Centrifuge at 4°C, 12,000 rpm for 10 min. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase.

[0070] (6) Transfer the upper aqueous phase to a new RNase-free centrifuge tube (the volume of the aqueous phase is about 50% of the lysis solution RZ reagent used), slowly add 0.5 times the volume of anhydrous ethanol, and mix well. Transfer the resulting solution and precipitate to the adsorption column CR3, and centrifuge at 4°C, 12,000 rpm for 30 s;

[0071] (7) Discard the waste liquid in the collection tube, add 500 μL of deproteinized solution RD to the adsorption column (check whether ethanol has been added before use), and centrifuge at 4°C, 12,000 rpm for 30 s;

[0072] (8) Discard the waste liquid in the collection tube, add 500 μL of rinse solution RW to the adsorption column (check whether ethanol has been added before use), let it stand at room temperature for 2 min, and centrifuge it at 4°C, 12,000 rpm for 30 s;

[0073] (9) Discard the waste liquid and repeat step (8);

[0074] (10) Place the adsorption column in a 2 mL collection tube and centrifuge at 12,000 rpm for 2 min at 4°C to remove the residual liquid. Then, place the column on a clean bench for a while to allow it to fully dry.

[0075] (11) Transfer the adsorption column CR3 to a new 1.5 mL centrifuge tube, add 20-50 μL RNase-Free ddH2O, incubate at room temperature for 2 min, and centrifuge at 12,000 rpm for 2 min at 4°C. RNA should be stored at -80°C to prevent degradation.

[0076] The experimental results are as follows Figure 2 As shown by Figure 2 As shown in A, treatment with Pst09944 can trigger the activation of MAPK in Nicotiana benthamiana.

[0077] Example 4

[0078] This example provides the preparation of cDNA

[0079] (1) Elimination of genomic DNA

[0080] Prepare the mixed solution system in a small PCR tube without RNAse according to the system shown in Table 2 below. Use a pipette to gently pipette to mix evenly. Set the PCR program to: 42°C, 2 min.

[0081] Table 2 RNase-free small PCR tube mixed solution preparation system

[0082]

[0083] (2) Reverse transcription reaction

[0084] Add 4 μL of 5×HiScript II qRT Super Mix II to the reaction product in the previous step, gently pipette to mix, and then perform reverse transcription reaction. The PCR reaction program is shown in Table 3. The reaction product can be used for qPCR or stored in a -80℃ low-temperature refrigerator for future use.

[0085] Table 3 Reverse transcription PCR reaction procedure

[0086]

[0087] (3) Real-time fluorescence quantitative PCR

[0088] The cDNA obtained in the previous step was diluted 10 times and used as a template for the experiment. The transcription amount of the cDNA sample obtained previously was detected by real-time fluorescence quantitative PCR, and the fluorescence quantitative PCR mixture was prepared according to the system shown in Table 4. The program reaction was carried out according to Table 5, and after the reaction program was completed, the data results were analyzed.

[0089] Table 4 Fluorescence quantitative PCR mixed solution configuration system

[0090]

[0091] Remark:

[0092] NbCYP71D20 -qRT-F (SEQ ID NO:3):AAGGTCCACCGCACCATGTCCTTAGAG;

[0093] NbCYP71D20 -qRT-R (SEQ ID NO:4):AAGAATTCCTTGCCCCTTGAGTACTTGC.

[0094] Table 5 Process reaction parameters

[0095]

[0096] The experimental results are as follows Figure 2 As shown by Figure 2 As can be seen from C in the figure, the data results are analyzed and confirmed. NbCYP71D20 The transcriptional expression of was affected by Pst09944 treatment.

[0097] Example 5

[0098] This example provides a test for the ability of Pst09944 to induce reactive oxygen species burst

[0099] Samples were taken from Nicotiana benthamiana leaves and floated in a 96-well plate overnight. The next day, the sterile water in the 96-well plate was replaced with a liquid containing 0.5 μg / mL peroxidase solution, 10 μM L-012 (a luminol derivative) and Pst09944. The values ​​were read in an ELISA reader to detect whether Pst09944 could directly induce the burst of reactive oxygen species in cells.

[0100] The experimental results are as follows Figure 2 As shown by Figure 2 As shown in B, it was found that Pst09944 can effectively induce the burst of active oxygen in Nicotiana benthamiana leaves.

[0101] Example 6

[0102] This example provides a test for the ability of Pst09944 to induce cell death

[0103] By measuring the concentration of Pst09944, we diluted the protein with sterile water, and injected the protein solutions of different concentrations into the leaves of the corresponding plants using a 1 mL syringe without a needle, and used GST-EV as a negative control to continuously observe the cell death of the leaves.

[0104] The experimental results are as follows Figure 3 As shown by Figure 3 It can be seen that the treatment of Pst09944 can cause different degrees of cell death in Arabidopsis and tomato leaves, but cannot cause cell death in corn, rice and wheat leaves, and thus cannot effectively inhibit the infection of stripe rust to wheat.

[0105] The above-described embodiments are part of the embodiments of the present invention, but not all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but rather represents selected embodiments of the present invention. All other embodiments obtained without creative work and related deductions and substitutions made by ordinary technicians in the field under the conditions of the concept of the present invention belong to the scope of protection of the present invention.

Claims

1. A method for breeding stripe rust resistant varieties, characterized in that: The method comprises the steps of transferring a specific fragment of the immunity inducing gene Pst09944 from wheat stripe rust into Arabidopsis thaliana and tomato; The immunity-inducing gene Pst09944 from wheat stripe rust includes a nucleotide sequence encoding the immunity-inducing protein Pst09944 from wheat stripe rust; The CDS sequence of the immunity-inducing gene Pst09944 from wheat stripe rust is shown in SEQ ID NO: 2; The amino acid sequence of the immunity-inducing protein Pst09944 from wheat stripe rust is shown in SEQ ID NO:

1.

2. A method for breeding stripe rust resistant varieties, characterized in that: The method comprises the steps of transferring the expression vector into Arabidopsis and tomato; The expression vector contains the immunity-inducing gene Pst09944 from wheat stripe rust; The CDS sequence of the immunity-inducing gene Pst09944 from wheat stripe rust is shown in SEQ ID NO: 2; The immunity-inducing gene Pst09944 from wheat stripe rust includes a nucleotide sequence encoding the immunity-inducing protein Pst09944 from wheat stripe rust; The amino acid sequence of the immunity-inducing protein Pst09944 from wheat stripe rust is shown in SEQ ID NO:

1.

3. Application of the immune-inducing protein Pst09944 from wheat stripe rust in the breeding of Arabidopsis and tomato stripe rust resistant varieties, characterized in that: The amino acid sequence of the immunity-inducing protein Pst09944 from wheat stripe rust is shown in SEQ ID NO:

1.

4. Application of the immunity-inducing gene Pst09944 from wheat stripe rust in the breeding of Arabidopsis and tomato stripe rust-resistant varieties, characterized in that: The CDS sequence of the immunity-inducing gene Pst09944 from wheat stripe rust is shown in SEQ ID NO:

2.

5. Application of the expression vector in breeding Arabidopsis and tomato varieties resistant to stripe rust, characterized in that: The expression vector contains the immunity-inducing gene Pst09944 from wheat stripe rust; The CDS sequence of the immunity-inducing gene Pst09944 from wheat stripe rust is shown in SEQ ID NO:2.

Images