Schizochytrium limacinum genetic engineering strain for efficiently producing EPA (Eicosapentaenoic Acid), method and application

Abstract

The invention belongs to the technical field of gene engineering, and discloses a schizochytrium limacinum gene engineering strain capable of efficiently producing EPA (Eicosapentaenoic Acid). The gene engineering strain is obtained by replacing key catalytic structural domains orfA, orfB-KSB / CLF in a schizochytrium limacinum PKS pathway with corresponding functional domains in a heterologous EPA type PKS pathway. The gene engineering strain can improve the proportion of polyunsaturated fatty acid in the gene engineering strain, especially eicosapentaenoic acid. EPA generated after fermentation of the obtained schizochytrium limacinum genetic engineering strain orfA:: PfaA and KSB / CLF:: PfaC reaches 4.24% and 10.19% of the total grease content respectively, the EPA content is increased by 2.52 and 7.47 times respectively, and compared with an existing schizochytrium limacinum wild type strain, the EPA yield is greatly increased, which shows that the method provided by the invention has extremely high application potential.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular to a genetic engineering strain of Schizochytrium for efficiently producing EPA, a method and an application thereof. Background Art

[0002] Eicosapentaenoic acid (EPA) is an ω-3 long-chain polyunsaturated fatty acid (LC-PUFA), an important nutrient in human and animal nutrition, and is closely related to health. Studies have shown that the intake of ω-3 LC-PUFA has a variety of beneficial effects on inflammation, improved plasma lipids and cognitive function, and the ratio of EPA and docosahexaenoic acid (DHA) in the intake of polyunsaturated fatty acids has a great influence on their functions. At present, the products rich in ω-3 LC-PUFA on the market are generally fish oil extracted from deep-sea fish, which are sold as health products or dietary supplements, but the shortage and unsustainability of fish oil resources limit the production and sales of ω-3 LC-PUFA products, which cannot meet the growing market demand, indicating the need to find new sustainable resources.

[0003] Schizochytrium is a lipid-rich heterotrophic marine protist with a strong ability to synthesize and store polyunsaturated fatty acids. It is rich in DHA and accounts for 35-40% of the total lipids. It is widely used in the industrial production of DHA-containing oils. Compared with fish oil purification, the fermentation and production of lipids by Schizochytrium reduces dependence on marine resources. Through breeding, gene editing, fermentation, and optimization of purification processes, production costs can be reduced, and high-quality functional fatty acids can be produced in a green and sustainable manner. As a potential oil-producing microorganism, Schizochytrium has been used to mass produce DHA, but the proportion of natural EPA in the total fatty acids (TFAs) content in Schizochytrium is even less than 1%, and conventional fermentation engineering methods cannot fundamentally make up for the lack of EPA synthesis capacity of Schizochytrium. Therefore, the key to the fermentation and production of EPA by Schizochytrium lies in genetic engineering modification to obtain an engineered strain that efficiently produces EPA.

[0004] In Schizochytrium HX-308, the synthesis of LC-PUFA mainly depends on the PKS pathway. The PKS pathways from different host sources have different proportions of final products due to subtle differences in each similar domain. PKS in some marine prokaryotic bacteria have been identified as having the ability to specifically produce eicosapentaenoic acid, which is mainly determined by the ketoacyl synthase (KS) and dehydratase (DH) functional domains in their PKS pathways. The effective identification of these key catalytic domains and the modification of the corresponding functional domains in Schizochytrium will help change the lipid composition in Schizochytrium and increase the production of high-value polyunsaturated fatty acid eicosapentaenoic acid. Summary of the invention

[0005] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a Schizochytrium genetic engineering strain, method and application for efficiently producing EPA.

[0006] The technical solution adopted by the present invention to solve its technical problem is:

[0007] A Schizochytrium genetic engineering strain for efficiently producing EPA, wherein the genetic engineering strain is synthesized by converting the key catalytic domains orfA and orfB-KS in the Schizochytrium PKS pathway into B / CLF is replaced with the corresponding functional domain in the heterologous EPA-type PKS pathway. The genetically engineered strain can improve the proportion of polyunsaturated fatty acids, especially eicosapentaenoic acid, in the genetically engineered strain.

[0008] Furthermore, the genetically engineered strain is used to replace the key gene ketoacyl synthase KS in PKS. A The orfA subunit is KS in Photobacterium profundum A A genetically engineered strain of Schizochytrium sp. HX-308 containing a PfaA subunit of the functional domain, wherein the strain is constructed using the oil-producing Schizochytrium sp. HX-308 as a starting strain, and the strain contains a PfaA functional domain derived from Photobacterium profundum, which is used to replace the orfA functional domain endogenously present in Schizochytrium sp. HX-308, so as to increase the percentage of EPA in Schizochytrium sp. HX-308;

[0009] The nucleotide sequence of the PfaA gene is shown in SEQ ID No.1.

[0010] Furthermore, the genetically engineered strain is a ketoacyl synthase KS that replaces the key gene on the orfB subunit of PKS. B / CLF for Photobacteriumprofundum KS C / CLF and dehydratase DH FabA The PfaC subunit of Schizochytrium sp. HX-308 is a genetically engineered strain of Schizochytrium sp. HX-308, which is constructed based on the oil-producing Schizochytrium sp. HX-308 as the starting strain. The strain contains the PfaC functional domain derived from Photobacterium profundum, which is used to replace the KS on the orfB functional domain endogenously present in Schizochytrium sp. HX-308. B / CLF gene to increase the percentage of EPA in Schizochytrium HX-308;

[0011] The nucleotide sequence of the PfaC gene is shown in SEQ ID No.2.

[0012] Furthermore, the EPA produced by the Schizochytrium genetically engineered strain after fermentation reached 4.24% and 10.19% of the total oil content, respectively, and the EPA content was increased by 2.52 and 7.47 times, respectively.

[0013] The method for constructing the genetically engineered strain as described above is characterized by comprising the following steps:

[0014] (1) Clone the upstream and downstream fragments of the orfA subunit gene from Schizochytrium sp. HX-308 and the PfaA subunit gene from Photobacterium profundum, insert the above genes into the pBS-Zeo plasmid by one-step cloning technology, and construct the replacement vector pBS-Zeo-orfA::PfaA;

[0015] (2) linearizing the replacement vector pBS-Zeo-orfA::PfaA and then electro-transfecting it into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaces the PfaA subunit gene in Photobacterium profundum;

[0016] Alternatively, the steps include:

[0017] (1) Cloning of the ketoacyl synthase KS on the orfB subunit from Schizochytrium sp. HX-308 B Upstream and downstream fragments of the CLF gene and ketoacyl synthase KS in Photobacterium profundum C / CLF gene and dehydratase DH FabA The PfaC subunit gene where the gene is located was inserted into the pBS-Zeo plasmid by one-step cloning technology to construct the replacement vector pBS-Zeo-KS B / CLF::PfaC;

[0018] (2) The above replacement vector pBS-Zeo-KS B After linearization, / CLF::PfaC was electroporated into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaced the PfaC subunit gene in Photobacterium profundum.

[0019] The use of the genetically engineered strain as described above in the production of EPA.

[0020] A method for directed production of EPA using the genetically engineered strain as described above, wherein the genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain; the fermentation seed strain is inoculated into a fermentation culture medium for fermentation culture, the bacterial cells are collected, and lipids are extracted to obtain EPA.

[0021] Furthermore, the specific steps are as follows:

[0022] First, the genetically engineered strain is inoculated from a plate culture medium to a seed culture medium, and is transferred and cultured twice in succession to obtain a first-level seed solution and a second-level and a third-level seed solution, respectively. The third-level seed solution obtained at last is used as the seed strain for the above fermentation; wherein the seed solution is cultured at 25-30° C. and shaken at 160-200 r / min in an incubator for 20-30 hours;

[0023] Secondly, the method of collecting bacteria and extracting lipids includes:

[0024] 1) After the fermentation is completed, NaOH solution is added to the fermentation liquid to adjust the pH to 10-12, and then an appropriate amount of 0.1-0.5% (w / v) wall-breaking enzyme is added, and the reaction is carried out at 50-60° C. and 100-200 rpm for 6-12 hours;

[0025] 2) Add an equal volume of anhydrous ethanol and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme;

[0026] 3) Add the same volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids in the fermentation broth. After shaking, let it stand at room temperature until stratification, and collect the upper organic phase;

[0027] 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

[0028] Furthermore, the specific steps are as follows:

[0029] (1) Fermentation seed culture: The genetically engineered strain is inoculated into a plate culture medium and cultured on a resistance plate. After the genetically engineered strain is inoculated, a single colony is picked out and inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the first-level seed is obtained. 1 mL of the first-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the second-level seed is obtained. 1 mL of the second-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the third-level seed is obtained as a fermentation strain.

[0030] (2) Shake flask fermentation: 10 mL of the third-grade seed culture solution was inoculated into 90 mL of fermentation medium and cultured in a shaker at 28°C and 180 rpm for 120 h.

[0031] (3) collecting the cells to extract lipids, comprising the following steps:

[0032] 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added to the fermentation broth at a final concentration of 0.1-0.5%, and the mixture is shaken at 50-60° C. and 100-200 r / min for 6-12 hours;

[0033] 2) Cool to room temperature, add anhydrous ethanol of the same volume as the fermentation broth after adding the cell wall-breaking enzyme, and shake for 1 hour to inactivate the cell wall-breaking enzyme;

[0034] 3) adding n-hexane with the same volume as anhydrous ethanol to extract, and collecting the upper organic phase;

[0035] 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

[0036] Furthermore, the plate culture medium has a pH value of 6.4, contains zeocin resistance for screening, and the concentration is 80-100 μg / mL. Other ingredients include: agar 20 g / L, glucose 40 g / L, yeast extract 15 g / L, sodium sulfate 10 g / L, magnesium sulfate 3 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.8 g / L, potassium dihydrogen phosphate 0.8 g / L, sodium glutamate 8 g / L, zinc sulfate heptahydrate 5 mg / L, cobalt dichloride hexahydrate 0.05 mg / L, copper sulfate pentahydrate 4 mg / L, nickel sulfate hexahydrate 1 mg / L, ferrous sulfate heptahydrate 8 mg / L, calcium pantothenate 3 mg / L, manganese chloride tetrahydrate 5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 7 mg / L, vitamin B 12 1 mg / L, solvent is water;

[0037] The pH value of the seed culture medium is 6.4, and the culture medium comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, and the solvent is water.

[0038] The fermentation medium has a pH value of 6.0 and includes: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 10 mg / L vitamin B6. 12 2 mg / L, the solvent is water.

[0039] The advantages and positive effects achieved by the present invention are:

[0040] 1. The present invention uses Schizochytrium sp. HX-308 as the original strain, which has been deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC No. M 209059. A replacement vector is constructed in Escherichia coli by genetic engineering, zeocin is selected as a screening resistance gene, and the linearized gene replacement fragment is electrotransferred into Schizochytrium to obtain a genetically engineered strain that effectively increases EPA production, laying a theoretical foundation for product industrialization.

[0041] 2. Based on the existing transformation system of Schizochytrium, the present invention uses the method of electroporation to transform the ketoacyl synthase / chain length factor (KS) on the endogenous orfA subunit and orfB subunit of Schizochytrium through homologous recombination. B The engineered strain of Schizochytrium was constructed by replacing the PfaA subunit and PfaC subunit genes from Photobacterium profundum, which maintained genetic stability after multiple subcultures.

[0042] 3. In the PKS lipid synthesis pathway naturally existing in Schizochytrium sp. HX-308, the present invention converts the ketoacyl synthase / chain length factor (KS) on the endogenous orfA subunit and orfB subunit of Schizochytrium sp. B / CLF) gene was replaced with the PfaA and PfaC subunit genes of Photobacterium profundum, thereby changing the key gene that determines the product chain length, ketoacyl synthase (KS A and KS B / CLF) is an EPA-producing ketoacyl synthase (KS) from Photobacterium profundum. A and KSC / CLF), and at the same time introduced the dehydratase (DH FabA ) gene, the obtained genetically engineered strain has the ability to efficiently synthesize EPA, effectively increasing the production of EPA and laying the foundation for large-scale industrial production of EPA.

[0043] 4. The genetically engineered Schizochytrium strains orfA::PfaA and KS obtained in the present invention B The EPA produced by / CLF::PfaC after fermentation reached 4.24% and 10.19% of the total oil content, respectively, and the EPA content increased by 2.52 and 7.47 times, respectively. Compared with the current wild-type strain of Schizochytrium, the EPA production was greatly improved, indicating that the method provided by the present invention has extremely high application potential.

[0044] 5. The present invention aims to identify the role of key functional domains in the PKS pathway of endogenous Schizochytrium and other marine prokaryotic host sources, determine the key genes that affect the chain length and unsaturated bond position of the final product, and find the key factors that affect the synthesis of eicosapentaenoic acid, so as to achieve the goal of simply, quickly, effectively and accurately constructing the strain, so as to achieve the goal of increasing the production of eicosapentaenoic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 This is a schematic diagram of the PfaA gene replacement vector derived from Escherichia coli Photobacterium profundum constructed in the present invention;

[0046] Figure 2 This is a schematic diagram of the PfaC gene replacement vector derived from Escherichia coli Photobacterium profundum constructed in the present invention;

[0047] Figure 3 The recombinant plasmids pBS-Zeo-orfA::PfaA and pBS-Zeo-KS in the present invention are B / Gel image of the gene size verification of PfaA and PfaC in CLF::PfaC;

[0048] Figure 4 The orfA::PfaA and KS of the Schizochytrium genetic engineering strains of the present invention B / CLF::PfaC's EPA and DHA content ratio. DETAILED DESCRIPTION

[0049] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0050] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0051] A Schizochytrium genetic engineering strain for efficiently producing EPA, wherein the genetic engineering strain is synthesized by converting the key catalytic domains orfA and orfB-KS in the Schizochytrium PKS pathway into B / CLF is replaced with the corresponding functional domain in the heterologous EPA-type PKS pathway. The genetically engineered strain can improve the proportion of polyunsaturated fatty acids, especially eicosapentaenoic acid, in the genetically engineered strain.

[0052] Furthermore, the genetically engineered strain is used to replace the key gene ketoacyl synthase KS in PKS. A The orfA subunit is KS in Photobacterium profundum A A genetically engineered strain of Schizochytrium sp. HX-308 containing a PfaA subunit of the functional domain, wherein the strain is constructed using the oil-producing Schizochytrium sp. HX-308 as a starting strain, and the strain contains a PfaA functional domain derived from Photobacterium profundum, which is used to replace the orfA functional domain endogenously present in Schizochytrium sp. HX-308, so as to increase the percentage of EPA in Schizochytrium sp. HX-308;

[0053] The nucleotide sequence of the PfaA gene is shown in SEQ ID No.1.

[0054] Preferably, the genetically engineered strain is a ketoacyl synthase KS that replaces the key gene on the orfB subunit in PKS. B / CLF for Photobacteriumprofundum KS C / CLF and dehydratase DH FabA The PfaC subunit of Schizochytrium sp. HX-308 is a genetically engineered strain of Schizochytrium sp. HX-308, which is constructed based on the oil-producing Schizochytrium sp. HX-308 as the starting strain. The strain contains the PfaC functional domain derived from Photobacterium profundum, which is used to replace the KS on the orfB functional domain endogenously present in Schizochytrium sp. HX-308. B / CLF gene to increase the percentage of EPA in Schizochytrium HX-308;

[0055] The nucleotide sequence of the PfaC gene is shown in SEQ ID No.2.

[0056] Preferably, the EPA produced by the Schizochytrium genetically engineered strain after fermentation reaches 4.24% and 10.19% of the total oil content, respectively, and the EPA content is increased by 2.52 and 7.47 times, respectively.

[0057] The method for constructing the genetically engineered strain as described above is characterized by comprising the following steps:

[0058] (1) Clone the upstream and downstream fragments of the orfA subunit gene from Schizochytrium sp. HX-308 and the PfaA subunit gene from Photobacterium profundum, insert the above genes into the pBS-Zeo plasmid by one-step cloning technology, and construct the replacement vector pBS-Zeo-orfA::PfaA;

[0059] (2) linearizing the replacement vector pBS-Zeo-orfA::PfaA and then electro-transfecting it into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaces the PfaA subunit gene in Photobacterium profundum;

[0060] Alternatively, the steps include:

[0061] (1) Cloning of the ketoacyl synthase KS on the orfB subunit from Schizochytrium sp. HX-308 B Upstream and downstream fragments of the CLF gene and ketoacyl synthase KS in Photobacterium profundum C / CLF gene and dehydratase DH FabA The PfaC subunit gene where the gene is located was inserted into the pBS-Zeo plasmid by one-step cloning technology to construct the replacement vector pBS-Zeo-KS B / CLF::PfaC;

[0062] (2) The above replacement vector pBS-Zeo-KS B After linearization, / CLF::PfaC was electroporated into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaced the PfaC subunit gene in Photobacterium profundum.

[0063] The use of the genetically engineered strain as described above in the production of EPA.

[0064] A method for directed production of EPA using the genetically engineered strain as described above, wherein the genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain; the fermentation seed strain is inoculated into a fermentation culture medium for fermentation culture, the bacterial cells are collected, and lipids are extracted to obtain EPA.

[0065] Preferably, the specific steps are as follows:

[0066] First, the genetically engineered strain is inoculated from a plate culture medium to a seed culture medium, and is transferred and cultured twice in succession to obtain a first-level seed solution and a second-level and a third-level seed solution, respectively. The third-level seed solution obtained at last is used as the seed strain for the above fermentation; wherein the seed solution is cultured at 25-30° C. and shaken at 160-200 r / min in an incubator for 20-30 hours;

[0067] Secondly, the method of collecting bacteria and extracting lipids includes:

[0068] 1) After the fermentation is completed, NaOH solution is added to the fermentation liquid to adjust the pH to 10-12, and then an appropriate amount of 0.1-0.5% (w / v) wall-breaking enzyme is added, and the reaction is carried out at 50-60° C. and 100-200 rpm for 6-12 hours;

[0069] 2) Add an equal volume of anhydrous ethanol and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme;

[0070] 3) Add the same volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids in the fermentation broth. After shaking, let it stand at room temperature until stratification, and collect the upper organic phase;

[0071] 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

[0072] Preferably, the specific steps are as follows:

[0073] (1) Fermentation seed culture: The genetically engineered strain is inoculated into a plate culture medium and cultured on a resistance plate. After the genetically engineered strain is inoculated, a single colony is picked out and inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the first-level seed is obtained. 1 mL of the first-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the second-level seed is obtained. 1 mL of the second-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the third-level seed is obtained as a fermentation strain.

[0074] (2) Shake flask fermentation: 10 mL of the third-grade seed culture solution was inoculated into 90 mL of fermentation medium and cultured in a shaker at 28°C and 180 rpm for 120 h.

[0075] (3) collecting the cells to extract lipids, comprising the following steps:

[0076] 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added to the fermentation broth at a final concentration of 0.1-0.5%, and the mixture is shaken at 50-60° C. and 100-200 r / min for 6-12 hours;

[0077] 2) Cool to room temperature, add anhydrous ethanol of the same volume as the fermentation broth after adding the cell wall-breaking enzyme, and shake for 1 hour to inactivate the cell wall-breaking enzyme;

[0078] 3) adding n-hexane with the same volume as anhydrous ethanol to extract, and collecting the upper organic phase;

[0079] 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

[0080] Preferably, the plate medium has a pH value of 6.4, contains zeocin resistance for screening, and the concentration is 80-100 μg / mL. Other ingredients include: agar 20 g / L, glucose 40 g / L, yeast extract 15 g / L, sodium sulfate 10 g / L, magnesium sulfate 3 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.8 g / L, potassium dihydrogen phosphate 0.8 g / L, sodium glutamate 8 g / L, zinc sulfate heptahydrate 5 mg / L, cobalt dichloride hexahydrate 0.05 mg / L, copper sulfate pentahydrate 4 mg / L, nickel sulfate hexahydrate 1 mg / L, ferrous sulfate heptahydrate 8 mg / L, calcium pantothenate 3 mg / L, manganese chloride tetrahydrate 5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 7 mg / L, vitamin B 12 1 mg / L, solvent is water;

[0081] The pH value of the seed culture medium is 6.4, and the culture medium comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, and the solvent is water.

[0082] The fermentation medium has a pH value of 6.0 and includes: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 10 mg / L vitamin B6. 12 2 mg / L, the solvent is water.

[0083] Specifically, the relevant preparation and detection are as follows:

[0084] A genetically engineered strain of Schizochytrium for replacing a PKS synthase gene derived from Photobacterium profundum, wherein the PKS synthase gene contains a PfaA gene and a PfaC gene.

[0085] The nucleotide sequence of the PfaA gene is shown in SEQ ID No.1, and the nucleotide sequence of the PfaC gene is shown in SEQ ID No.2.

[0086] SEQ ID No.1 PfaA:

[0087]

[0088] SEQ ID No.2 PfaC:

[0089]

[0090] The genetically engineered original strain is Schizochytrium sp. HX-308 strain, which has been deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC No. M 209059.

[0091] The culture medium used in the following examples is as follows:

[0092] The solid plate medium has a pH value of 6.4 and contains Zeocin resistance (concentration of 80-100 μg / mL) for screening. Other ingredients include: agar 20 g / L, glucose 40 g / L, yeast extract 15 g / L, sodium sulfate 10 g / L, magnesium sulfate 3 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.8 g / L, potassium dihydrogen phosphate 0.8 g / L, sodium glutamate 8 g / L, zinc sulfate heptahydrate 5 mg / L, cobalt dichloride hexahydrate 0.05 mg / L, copper sulfate pentahydrate 4 mg / L, nickel sulfate hexahydrate 1 mg / L, ferrous sulfate heptahydrate 8 mg / L, calcium pantothenate 3 mg / L, manganese chloride tetrahydrate 5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 7 mg / L, vitamin B 12 1 mg / L, the solvent is water.

[0093] The pH value of the seed culture medium is 6.4, and its ingredients include: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, and the solvent is water.

[0094] The pH value of the fermentation medium is 6.0, and its ingredients include: glucose 90g / L, yeast extract 15g / L, sodium sulfate 10g / L, magnesium sulfate 3g / L, ammonium sulfate 8g / L, potassium chloride 2g / L, calcium chloride 0.1g / L, potassium sulfate 0.8g / L, potassium dihydrogen phosphate 1g / L, sodium glutamate 15g / L, zinc sulfate heptahydrate 3mg / L, cobalt dichloride hexahydrate 0.08mg / L, copper sulfate pentahydrate 5mg / L, nickel sulfate hexahydrate 1mg / L, ferrous sulfate heptahydrate 10mg / L, calcium pantothenate 2mg / L, manganese chloride tetrahydrate 4mg / L, sodium molybdate dihydrate 0.04mg / L, vitamin B68 mg / L, vitamin B 12 2 mg / L, the solvent is water.

[0095] Example 1. Cloning of upstream and downstream homology arms of orfA subunit gene in Schizochytrium PKS pathway

[0096] According to the sequence information of the orfA gene in Schizochytrium sp. HX-308, primers orfA-Up-F, orfA-Up-R, orfA-Down-F and orfA-Down-R as shown in SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 6 were designed, respectively. Using the HX-308 genome as a template, primers orfA-Up-F, orfA-Up-R and orfA-Down-F, orfA-Down-R were used to configure the PCR reaction system using PrimerStar high-fidelity DNA polymerase (the reaction system was: PrimeStar high-fidelity DNA polymerase 12.5 μL, Primer F 1 μL, Primer R 1 μL, Template 1 μL, ddH2O 10 μL), and the upstream (SEQ ID No. 7) and downstream fragments (SEQ ID No.8), and the upstream and downstream fragments of orfA gene were obtained as the upstream and downstream homologous arms of homologous recombination. The PCR reaction program was: 95℃5min, 95℃30s, 58℃30s, 72℃30s, and 33 cycles were set from the second step. After the PCR product was obtained and verified by agarose gel electrophoresis, it was cut and recovered and purified.

[0097] SEQ ID No.3orfA-Up-F:CCCGTCTGCAGGAGCAAAAG

[0098] SEQ ID No.4orfA-Up-R: CGCGCACGCTGGGGTCCGTG

[0099] SEQ ID No.5orfA-Down-F: GCCGCCGCGTGCTGCCCATG

[0100] SEQ ID No.6orfA-Down-R: AAGGCAAGGCTTGTCCGTGGC

[0101] SEQ ID No.7orfA-Up:

[0102] CCCGTCTGCAGGAGCAAAAGGGAGGCGAGATGGATACCCGCATTGCCATCATCGGCATG

[0103] TCGGCCATCCTCCCCTGCGGCACGACCGTGCGCGAGTCGTGGGAGACCATCCGCGCCG

[0104] GCATCGACTGCCTGTCGGATCTCCCCGAGGACCGCGTCGACGTGACGGCGTACTTTGAC

[0105] CCCGTCAAGACCACCAAGGACAAGATCTACTGCAAGCGCGGTGGCTTCATTCCCGAGTA

[0106] CGACTTTGACGCCCGCGAGTTCGGACTCAACATGTTCCAGATGGAGGACTCGGACGCA

[0107] AACCAGACCATCTCGCTTCTCAAGGTCAAGGAGGCCCTCCAGGACGCCGGCATCGACG

[0108] CCCTCGGCAAGGAAAAGAAGAACATCGGCTGCGTGCTCGGCATTGGCGGCGGCCAAAA

[0109] GTCCAGCCACGAGTTCTACTCGCGCCTTAATTATGTTGTCGTGGAGAAGGTCCTCCGCAA

[0110] GATGGGCATGCCCGAGGAGGACGTCAAGGTCGCCGTCGAAAAGTACAAGGCCAACTTC

[0111] CCCGAGTGGCGCCTCGACTCCTTCCCTGGCTTCCTCGGCAACGTCACCGCCGGTCGCTG

[0112] CACCAACACCTTCAACCTCGACGGCATGAACTGCGTTGTCGACGCCGCATGCGCCTCGT

[0113] CCCTCATCGCCGTCAAGGTCGCCATCGACGAGCTGCTCTACGGTGACTGCGACATGATG

[0114] GTCACCGGTGCCACCTGCACGGATAACTCCATCGGCATGTACATGGCCTTCTCCAAGAC

[0115] CCCCGTGTTCTCCACGGACCCCAGCGTGCGCG

[0116] SEQ ID No.8orfA-Down:

[0117] GCCGCCGCGTGCTGCCCATGACGCTGGCCATTGGCTCGCTCGCGGAGACCTGCCTCGGC

[0118] CTCTTCCCCGGCTACTCGCTCTGGGCCATTGACGACGCCCAGCTCTTCAAGGGTGTCAC

[0119] TGTCGACGGCGACGTCAACTGCGAGGTGACCCTCACCCCGTCGACGGCGCCCTCGGGC

[0120] CGCGTCAACGTCCAGGCCACGCTCAAGACCTTTTCCAGCGGCAAGCTGGTCCCGGCCTA

[0121] CCGCGCCGTCATCGTGCTCTCCAACCAGGGCGCGCCCCCGGCCAACGCCACCATGCAGC

[0122] CGCCCTCGCTCGATGCCGATCCGGCGCTCCAGGGCTCCGTCTACGACGGCAAGACCCTC

[0123] TTCCACGGCCCGGCCTTCCGCGGCATCGATGACGTGCTCTCGTGCACCAAGAGCCAGCT

[0124] TGTGGCCAAGTGCAGCGCTGTCCCCGGCTCCGACGCCGCTCGCGGCGAGTTTGCCACG

[0125] GACACTGACGCCCATGACCCCTTCGTGAACGACCTGGCCTTTCAGGCCATGCTCGTCTG

[0126] GGTGCGCCGCACGCTCGGCCAGGCTGCGCTCCCCAACTCGATCCAGCGCATCGTCCAGC

[0127] ACCGCCCGGTCCCGCAGGACAAGCCCTTCTACATTACCCTCCGCTCCAACCAGTCGGGC

[0128] GGTCACTCCCAGCACAAGCACGCCCTTCAGTTCCACAACGAGCAGGGCGATCTCTTCAT

[0129] TGATGTCCAGGCTTCGGTCATCGCCACGGACAGCCTTGCCTT

[0130] Example 2. Ketoacyl synthase / chain length factor (KS) in the orfB subunit of the Schizochytrium PKS pathway B Cloning of homology arms of upstream and downstream fragments of CLF gene

[0131] According to the sequence information of orfB gene in Schizochytrium sp.HX-308, primers KS as shown in SEQ ID No.9, SEQ ID No.10, SEQ ID No.11 and SEQ ID No.12 were designed. B / CLF-Up-F, KS B / CLF-Up-R, KS B / CLF-Down-F and KS B / CLF-Down-R, using HX-308 genome as template and primers KS B / CLF-Up-F, KS B / CLF-Up-R and KS B / CLF-Down-F, KS B / CLF-Down-R, use PrimerStar high-fidelity DNA polymerase to prepare the PCR reaction system (reaction system: PrimeStar high-fidelity DNA polymerase 12.5μL, Primer F 1μL, Primer R 1μL, Template 1μL, ddH2O 10μL), amplify KS B / CLF gene upstream (SEQ ID No.13) and downstream (SEQ ID No.14) fragments, and KS B The upstream and downstream fragments of the / CLF gene were used as the upstream and downstream homologous arms of homologous recombination. The PCR reaction program was: 95°C for 5 min, 95°C for 30 s, 58°C for 30 s, and 72°C for 30 s. 33 cycles were set from the second step. After the PCR product was obtained, it was verified by agarose gel electrophoresis and then cut and recovered and purified.

[0132] SEQ ID No.9KS B / CLF-Up-F:ATGGCCGCTCGGAATGTGAG

[0133] SEQ ID No.10KS B / CLF-Up-R:CATCATCGAGACGCTTGAGG

[0134] SEQ ID No.11KS B / CLF-Down-F:TCTCGTCGCAGTGGGGCTTC

[0135] SEQ ID No.12KS B / CLF-Down-R:CGAGCGCGTCTCGGAGACGC

[0136] SEQ ID No.13KS B / CLF-Up:

[0137] ATGGCCGCTCGGAATGTGAGCGCCGCGCATGAGATGCACGATGAAAAGCGCATCGCCGT

[0138] CGTCGGCATGGCCGTCCAGTACGCCGGATGCAAAACCAAGGACGAGTTCTGGGAGGTG

[0139] CTCATGAACGGCAAGGTCGAGTCCAAGGTGATCAGCGACAAACGACTCGGCTCCAACT

[0140] ACCGCGCCGAGCACTACAAAGCAGAGCGCAGCAAGTATGCCGACACCTTTTGCAACGA

[0141] AACGTACGGCACCCTTGACGAGAACGAGATCGACAACGAGCACGAACTCCTCCTCAAC

[0142] CTCGCCAAGCAGGCACTCGCAGAGACATCCGTCAAAGACTCGACACGCTGCGGCATCG

[0143] TCAGCGGCTGCCTCTCGTTCCCCATGGACAACCTCCAGGGTGAACTCCTCAACGTGTAC

[0144] CAAAACCATGTCGAGAAAAAGCTCGGGGCCCGCGTCTTCAAGGACGCCTCCCATTGGT

[0145] CCGAACGCGAGCAGTCCAACAAACCCGAGGCCGGTGACCGCCGCATCTTCATGGACCC

[0146] GGCCTCCTTCGTCGCCGAAGAACTCAACCTCGGCGCCCTTCACTACTCCGTCGACGCAG

[0147] CATGCGCCACGGCGCTCTACGTGCTCCGCCTCGCGCAGGATCATCTCGTCTCCGGCGCC

[0148] GCCGACGTCATGCTCTGCGGTGCCACCTGCCTGCCGGAGCCCTTTTTCATCCTTTCGGGC

[0149] TTTTCCACCTTCCAGGCCATGCCCGTCGGCACGGGCCAGAACGTGTCCATGCCGCTGCA

[0150] CAAGGACAGCCAGGGCCTCACCCCGGGTGAGGGCGGCTCCATCATGGTCCTCAAGCGT

[0151] CTCGATGATG

[0152] SEQ ID No.14KS B / CLF-Down:

[0153] TCTCGTCGCAGTGGGGCTTCACGGGCCCCTCCTTTACGATCACCGAGGGCAACAACTCC

[0154] GTCTACCGCTGCGCCGAGCTCGGCAAGTACCTCCTCGAGACCGGCGAGGTCGATGGCGT

[0155] CGTCGTTGCGGGTGTCGATCTCTGCGGCAGTGCCGAAAACCTTTACGTCAAGTCTCGCC

[0156] GCTTCAAGGTGTCCACCTCCGATACCCCGCGCGCCAGCTTTGACGCCGCCGCCGATGGC

[0157] TACTTTGTCGGCGAGGGCTGCGGTGCCTTTGTGCTCAAGCGTGAGACTAGCTGCACCAA

[0158] GGACGACCGTATCTACGCTTGCATGGATGCCATCGTCCCTGGCAACGTCCCTAGCGCCTG

[0159] CTTGCGCGAGGCCCTCGACCAGGCGCGCGTCAAGCCGGGCGATATCGAGATGCTCGAG

[0160] CTCAGCGCCGACTCCGCCCGCCACCTCAAGGACCCGTCCGTCCTGCCCAAGGAGCTCA

[0161] CTGCCGAGGAGGAAATCGGCGGCCTTCAGACGATCCTTCGTGACGATGACAAGCTCCC

[0162] GCGCAACGTCGCAACGGGCAGTGTCAAGGCCACCGTCGGTGACACCGGTTATGCCTCT

[0163] GGTGCTGCCAGCCTCATCAAGGCTGCGCTTTGCATCTACAACCGCTACCTGCCCAGCAA

[0164] CGGCGACGACTGGGATGAACCCGCCCCTGAGGCGCCCTGGGACAGCACCCTCTTTGCG

[0165] TGCCAGACCTCGCGCGCTTGGCTCAAGAACCCTGGCGAGCGTCGCTATGCGGCCGTCTC

[0166] GGGCGTCTCCGAGACGCGCTCG

[0167] Example 3. Construction of the homologous arm vector pBS-Zeo-orfA

[0168] 1. Use restriction endonuclease KpnI to digest the vector plasmid pBS-Zeo (disclosed in patent publication CN114456957A), verify by agarose gel electrophoresis and gel recovery. Enzyme digestion system (50 μL): vector plasmid 4000 μg, KpnI enzyme 2 μL, 10×QuickCut Buffer 5 μL, ddH2O up to 50 μL.

[0169] 2. Connect the pBS-Zeo fragment after restriction digestion and the orfA upstream homology arm fragment (SEQ ID No.7) amplified using SEQ ID No.3 and 4 to obtain the upstream homology arm vector pBS-Zeo-orfA-Up by one-step cloning. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector fragment after restriction digestion, 5 μL 2×ClonExpressMix, 50°C for 50 min.

[0170] 3. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0171] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0172] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0173] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0174] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL Kan resistance. Invert and culture at 37°C overnight.

[0175] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and the upstream homology arm vector pBS-Zeo-orfA-Up was obtained.

[0176] 4. Digest the vector plasmid pBS-Zeo-orfA-Up with restriction endonuclease PacI, verify by agarose gel electrophoresis and recover from gel. Enzyme digestion system (50μL): vector plasmid 4000μg, PacI enzyme 2μL, 10×QuickCut Buffer 5μL, ddH2Oup to 50μL.

[0177] 5. Connect the pBS-Zeo-orfA-Up fragment after restriction digestion with the orfA downstream homology arm fragment (SEQ ID No. 8) amplified using SEQ ID No. 5 and 6 by one-step cloning to obtain the homology arm vector pBS-Zeo-orfA. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector fragment after restriction digestion, 5 μL 2×ClonExpressMix, 50°C for 50 min.

[0178] 6. Repeat step 3 to obtain the homology arm vector pBS-Zeo-orfA.

[0179] Example 4. Homologous arm vector pBS-Zeo-KS B / CLF Construction

[0180] 1. Digest the vector plasmid pBS-Zeo with restriction endonuclease KpnI, verify by agarose gel electrophoresis and recover from gel. Enzyme digestion system (50μL): vector plasmid 4000μg, KpnI enzyme 2μL, 10×QuickCut Buffer 5μL, ddH2O upto 50μL.

[0181] 2. The vector pBS-Zeo fragment after enzyme digestion and the KS fragment amplified using SEQ ID No. 9 and 10 were cloned by one-step cloning. B / CLF upstream homology arm fragment (SEQ ID No.13) to obtain the upstream homology arm vector pBS-Zeo-KS B / CLF-Up. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme-digested fragment, 5 μL 2×ClonExpressMix, 50°C ligation for 50 min.

[0182] 3. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0183] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0184] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0185] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0186] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL Kan resistance. Invert and culture at 37°C overnight.

[0187] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and the upstream homology arm vector pBS-Zeo-KS was obtained. B / CLF-Up.

[0188] 4. Cut the vector plasmid pBS-Zeo-KS with restriction endonuclease PacI B / CLF-Up, verified by agarose gel electrophoresis and recovered. Enzyme digestion system (50μL): vector plasmid 4000μg, PacI enzyme 2μL, 10×QuickCut Buffer 5μL, ddH2Oup to 50μL.

[0189] 5. Use one-step cloning to clone the digested vector pBS-Zeo-KS B / CLF-Up fragment and the KS obtained by amplification using SEQ ID No. 11 and 12 B / CLF downstream homology arm fragment (SEQ ID No.14) to obtain the homology arm vector pBS-Zeo-KS B / CLF. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme digested fragment, 5 μL 2×ClonExpressMix, 50℃ ligation for 50 min.

[0190] 6. Repeat step 3 to obtain the homology arm vector pBS-Zeo-KS B / CLF.

[0191] Example 5. Construction of replacement vector pBS-Zeo-orfA::PfaA

[0192] 1. According to the sequence information of the PfaA gene in Photobacterium profundum, the primers P15 and P16 shown in SEQ ID No. 15 and SEQ ID No. 16 were synthesized and designed by Bioengineering. The synthesized DNA was used as a template, and the primers P15 and P16 were used to configure the PCR reaction system using PrimerStar high-fidelity DNA polymerase (the reaction system was: PrimeStar high-fidelity DNA polymerase 12.5 μL, Primer F 1 μL, Primer R 1 μL, Template 1 μL, ddH2O10 μL). The primers had sequences homologous to the homology arm vector pBS-Zeo-orfA, as shown in the underlined part. The PCR reaction program was: 95°C 5 min, 95°C 30 s, 58°C 30 s, 72°C 200 s, and 33 cycles were set from the second step. After the PCR product was obtained, it was verified by agarose gel electrophoresis and then cut and recovered and purified.

[0193] SEQ ID No.15P15(PfaA-F):

[0194] TGACATAACTAATTACATGA CTATGACAGAAGCTCCTTCT

[0195] SEQ ID No.16P16(PfaA-R):

[0196] AGCCGAGCGCGGGAGGGAAG ATGGGTGTTAAGCGGAGACT

[0197] 2. Digest the vector plasmid pBS-Zeo-orfA with restriction endonuclease HindⅢ, verify by agarose gel electrophoresis and recover from gel. Enzyme digestion system (50μL): vector plasmid 4000μg, HindⅢ enzyme 2μL, 10×QuickCut Buffer 5μL, ddH2O up to 50μL.

[0198] 3. Connect the pBS-Zeo-orfA fragment after restriction digestion with the PfaA gene fragment (SEQ ID No. 1) from Photobacterium profundum obtained by amplification using SEQ ID No. 15 and 16 to obtain the replacement vector pBS-Zeo-orfA::PfaA. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector fragment after restriction digestion, 5 μL 2×ClonExpressMix, 50°C for 50 min.

[0199] 4. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0200] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0201] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0202] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0203] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL Kan resistance. Invert and culture at 37°C overnight.

[0204] Positive transformants were selected, plasmids were extracted, and sequencing results confirmed successful connection, obtaining the upstream homology arm vector pBS-Zeo-orfA::PfaA. The plasmid map of the vector is shown in Figure 1 shown.

[0205] Example 6. Replacement of vector pBS-Zeo-KS B / CLF::PfaC Construction

[0206] 1. According to the sequence information of the PfaC gene in Photobacterium profundum, the primers P17 and P18 shown in SEQ ID No. 17 and SEQ ID No. 18 were synthesized and designed by Bioengineering. The synthesized DNA was used as a template, and the primers P17 and P18 were used to configure the PCR reaction system using PrimerStar high-fidelity DNA polymerase (the reaction system was: PrimeStar high-fidelity DNA polymerase 12.5 μL, Primer F 1 μL, Primer R 1 μL, Template 1 μL, ddH2O10 μL). The primers had homology arm vector pBS-Zeo-KS B / CLF homologous sequence, as shown in the underlined part. The PCR reaction program was: 95℃5min, 95℃30s, 58℃30s, 72℃200s, and 33 cycles were set from the second step. After the PCR product was obtained, it was verified by agarose gel electrophoresis and then excised and purified.

[0207] SEQ ID No.17P17(PfaC-F): TGACATAACTAATTACATGA

[0208] TCAGGCTTCTTCAATACAGA

[0209] SEQ ID No.18P18(PfaC-R): AGCCGAGCGCGGGAGGGAAG

[0210] ATGCATTGCCCAGTTAATTA

[0211] 2. Cut the vector plasmid pBS-Zeo-KS with restriction endonuclease HindⅢ B / CLF, verified by agarose gel electrophoresis and recovered. Enzyme digestion system (50μL): vector plasmid 4000μg, HindⅢ enzyme 2μL, 10×QuickCut Buffer 5μL, ddH2O up to 50μL.

[0212] 3. Use one-step cloning to clone the digested vector pBS-Zeo-KS B The / CLF fragment was ligated with the PfaC gene fragment (SEQ ID No. 2) from Photobacterium profundum obtained by amplification using SEQ ID No. 17 and 18 to obtain the replacement vector pBS-Zeo-KS B / CLF::PfaC. One-step cloning system (10 μL): 4 μL target gene fragment, 1 μL vector enzyme digested fragment, 5 μL 2×ClonExpressMix, 50°C ligation for 50 min.

[0213] 4. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0214] (1) Aseptically take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0215] (2) Heat shock at 42°C for 90 seconds and immediately place on ice for 3 minutes.

[0216] (3) Add 1000 μL LB medium and incubate at 37°C, 220 rpm for 40 min.

[0217] (4) Take 200 μL and spread it on an LB plate containing 50 μg / mL Kan resistance. Invert and culture at 37°C overnight.

[0218] Positive transformants were selected, plasmids were extracted, and sequencing verification results showed that the connection was successful, and the upstream homology arm vector pBS-Zeo-KS was obtained. B / CLF::PfaC, the plasmid map of this vector is as follows Figure 2 shown.

[0219] The amplification results of the above PfaA and PfaC genes are as follows Figure 3 As shown, the gene band sizes analyzed by agarose gel electrophoresis were consistent with the map (PfaA 7746 bp, PfaC 6021 bp).

[0220] Example 7. Construction of a genetically engineered strain of Schizochytrium with replacement of the PfaA gene and PfaC gene from Photobacterium profundum

[0221] 1. Preparation of Schizochytrium competent cells

[0222] (1) Pick a single colony of Schizochytrium sp. HX-308 that has been activated on the plate and add it to 50 mL of seed culture medium. Incubate it in a shaking incubator at 28°C and 170 rpm for 24 h.

[0223] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture at 28°C and 170 rpm for 24 h.

[0224] (3) Repeat step (2).

[0225] (4) Take 25 mL of bacterial culture and centrifuge at 4000 rpm for 2 min at room temperature, then discard the supernatant.

[0226] (5) Resuspend the cells in 25 mL of pretreatment reagent (20 mM DTT and 0.1 M CaCl2 dissolved in pH 6.5 Tris-HCl buffer) and shake gently to loosen the cell walls.

[0227] (6) After centrifugation, wash the cells twice with 25 mL of pre-cooled sterile water. The centrifugation conditions were: 4000 rpm, 4°C, 2 min.

[0228] (7) Wash the cells twice with a 1 M sterile precooled sorbitol aqueous solution (containing 0.1 M CaCl2) and centrifuge at 4000 rpm and 4°C for 2 min.

[0229] (8) Resuspend the cells in 200 μL of 1 M sterile precooled sorbitol aqueous solution (containing 0.1 M CaCl2) and dispense into 1.5 mL sterile centrifuge tubes, 100 μL per tube, and keep on ice until ready to use.

[0230] 2. Electrotransformation of Schizochytrium

[0231] (1) Add 10 μL of linearized pBS-Zeo-orfA::PfaA or pBS-Zeo-KS B Add 100 μL of Schizochytrium competent cells to the / CLF::PfaC vector, mix well, transfer to a pre-cooled electroporation cup, and place on ice for 30 min.

[0232] (2) Electric shock, 2KV, one pulse.

[0233] (3) Immediately add 1 mL of pre-cooled seed culture medium containing 1 M sorbitol to the electroporation cup, mix well, and transfer to the seed culture medium containing 1 M sorbitol.

[0234] (4) Incubate at 28°C and 180 rpm for 2 to 3 h.

[0235] (5) Take an appropriate amount of bacterial solution and spread it on plates, and culture it at 28°C for 2 to 4 days.

[0236] 3. Screening and identification of genetically engineered Schizochytrium strains replacing the PfaA gene or PfaC gene from Photobacterium profundum

[0237] (1) Select a colony from the plate and inoculate it into a seed culture medium containing 100 mg / L bleomycin and culture it at 28°C and 180 rpm for 24 h.

[0238] (2) The overexpression vector was subcultured 5 times to ensure stable inheritance. The experiment described in step (1) was repeated in each generation.

[0239] (3) The genetically stable strain was a genetically engineered strain of Schizochytrium with the PfaA gene and PfaC gene from Photobacterium profundum replaced and stored in a -80°C freezer.

[0240] Example 8. Determination of PUFA in lipids of genetically engineered Schizochytrium strains replacing the PfaA gene and PfaC gene from Photobacterium profundum

[0241] 1. Fermentation seed culture: After the genetically engineered strain and the original strain of Schizochytrium are cultured on a plate with resistance (i.e., the above-mentioned Zeocin resistance, with a concentration of 80-100 μg / mL), a single colony is picked and inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain the first-level seed. 1 mL of the first-level seed culture solution is inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain the second-level seed. 1 mL of the second-level seed culture solution is inoculated in a 250 mL conical flask (containing 50 mL of seed culture medium), and cultured in a shaking incubator at 28°C and 180 r / min for 24 hours to obtain the third-level seed, which is used as a fermentation strain.

[0242] 2. Shake flask fermentation: Take 10 mL of the third-level seed culture solution and inoculate it into a 500 mL conical flask (containing 90 mL of fermentation medium). Incubate it in a shaker at 28°C and 180 r / min for 120 h. Take samples every 24 h to measure the ratio of OCFA and PUFA.

[0243] 3. Collecting the cells to extract lipids, comprising the following steps:

[0244] (1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall breaking enzyme is added to the fermentation broth at a final concentration of 0.1-0.5% (w / v, mass volume percentage, such as adding 0.2-1 g of cell wall breaking enzyme to 200 mL of culture medium), and the mixture is shaken at 50-60° C. and 100-200 r / min for 6-12 h;

[0245] (2) Cool to room temperature, add anhydrous ethanol equal to the volume of the fermentation broth after adding the cell wall-breaking enzyme, and shake for 1 h to inactivate the cell wall-breaking enzyme;

[0246] (3) adding n-hexane with the same volume as anhydrous ethanol for extraction and collecting the upper organic phase;

[0247] 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

[0248] (4) Gas phase detection and analysis of fatty acids.

[0249] The results are as follows Figure 4 As shown. The results show that the genetically engineered strain of Schizochytrium obtained by the method of the present invention, which replaces the PfaA gene and PfaC gene from Photobacterium profundum, has multiple generations of genetic stability. The proportion of EPA in the total oil has been greatly improved. Compared with the wild-type Schizochytrium sp. HX-308 strain, the EPA content has increased by 2.52 and 7.47 times, reaching 4.24% and 10.19% of the total oil content. The genetically engineered strain and construction method constructed by this method have laid a strong foundation for subsequent theoretical research and industrial production.

[0250] Similar products exist in the prior art, for details, see patent publication CN114480148A. Schizochytrium determines the chain length and unsaturated bond position of its final product through the ketoacyl synthase (KS) and dehydratase (DH) functional domains in its PKS pathway, that is, the modification of these two functional domains helps to increase the production of EPA. Compared with the reference patent publication, the present invention replaces the relevant functional domains in Schizochytrium (the replacement source is Photobacterium profundum), rather than simply overexpressing, which prevents the product from generating DHA while promoting the synthesis of the product into EPA.

[0251] Compared with the reference document, the EPA content of the strain with the PfaC gene replaced in the present invention reached 10.19% of the total fatty acids, which was 7.47 times higher than the wild type and higher than the relevant index of the reference document (EPA accounted for 5.5% of the total fatty acids, an increase of 5.88 times).

[0252] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain of Schizochytrium that efficiently produces EPA, characterized in that: The genetically engineered strain is synthesized by combining the key catalytic domains orfA and orfB-KS in the PKS pathway of Schizochytrium B / CLF is replaced with the corresponding functional domain in the heterologous EPA-type PKS pathway. The genetically engineered strain can improve the proportion of polyunsaturated fatty acids, especially eicosapentaenoic acid, in the genetically engineered strain.

2. The genetically engineered strain according to claim 1, characterized in that: The genetically engineered strain is used to replace the key gene ketoacyl synthase KS in PKS A The orfA subunit is KS in Photobacterium profundum A A genetically engineered strain of Schizochytrium sp. HX-308 containing a PfaA subunit of the functional domain, wherein the strain is constructed using the oil-producing Schizochytrium sp. HX-308 as a starting strain, and the strain contains a PfaA functional domain derived from Photobacterium profundum, which is used to replace the orfA functional domain endogenously present in Schizochytrium sp. HX-308, so as to increase the percentage of EPA in Schizochytrium sp. HX-308; The nucleotide sequence of the PfaA gene is shown in SEQ ID No.

1.

3. The genetically engineered strain according to claim 1, characterized in that: The genetically engineered strain is used to replace the key gene ketoacyl synthase KS on the orfB subunit in PKS B / CLF for Photobacteriumprofundum KS C / CLF and dehydratase DH FabA The PfaC subunit of Schizochytrium sp. HX-308 is a genetically engineered strain of Schizochytrium sp. HX-308, wherein the strain is constructed based on the oil-producing Schizochytrium sp. HX-308 as the starting strain, and the strain contains the PfaC functional domain derived from Photobacterium profundum, which is used to replace the KS on the orfB functional domain endogenously present in Schizochytrium sp. HX-308 B / CLF gene to increase the percentage of EPA in Schizochytrium HX-308; The nucleotide sequence of the PfaC gene is shown in SEQ ID No.

2.

4. The genetically engineered strain according to claim 1 or 2, characterized in that: The EPA produced by the Schizochytrium genetic engineering strain after fermentation reaches 4.24% and 10.19% of the total oil content, respectively, and the EPA content is increased by 2.52 and 7.47 times, respectively.

5. The method for constructing a genetically engineered strain according to any one of claims 1 to 4, characterized in that: The steps include: (1) Clone the upstream and downstream fragments of the orfA subunit gene from Schizochytrium sp. HX-308 and the PfaA subunit gene from Photobacterium profundum, insert the above genes into the pBS-Zeo plasmid by one-step cloning technology, and construct the replacement vector pBS-Zeo-orfA::PfaA; (2) linearizing the replacement vector pBS-Zeo-orfA::PfaA and then electro-transfecting it into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaces the PfaA subunit gene in Photobacterium profundum; Alternatively, the steps include: (1) Cloning of the ketoacyl synthase KS on the orfB subunit from Schizochytrium sp. HX-308 B Upstream and downstream fragments of the CLF gene and ketoacyl synthase KS in Photobacterium profundum C / CLF gene and dehydratase DH FabA The PfaC subunit gene where the gene is located was inserted into the pBS-Zeo plasmid by one-step cloning technology to construct the replacement vector pBS-Zeo-KS B / CLF::PfaC; (2) The above replacement vector pBS-Zeo-KS B After linearization, / CLF::PfaC was electroporated into Schizochytrium sp.HX-308 to obtain a genetically engineered strain of Schizochytrium that replaced the PfaC subunit gene in Photobacterium profundum.

6. Use of the genetically engineered strain according to any one of claims 1 to 4 in producing EPA.

7. A method for directed production of EPA using the genetically engineered strain according to any one of claims 1 to 4, characterized in that: The genetically engineered strain is inoculated into a seed culture medium for activation culture to obtain a fermentation seed strain; the fermentation seed strain is inoculated into a fermentation culture medium for fermentation culture, the bacterial bodies are collected, and lipids are extracted to obtain EPA.

8. The method according to claim 7, characterized in that: The specific steps are as follows: First, the genetically engineered strain is inoculated from a plate culture medium to a seed culture medium, and is transferred and cultured twice in succession to obtain a first-level seed solution and a second-level and a third-level seed solution, respectively. The third-level seed solution obtained at last is used as the seed strain for the above fermentation; wherein the seed solution is cultured at 25-30° C. and shaken at 160-200 r / min in an incubator for 20-30 hours; Secondly, the method of collecting bacteria and extracting lipids includes: 1) After the fermentation is completed, NaOH solution is added to the fermentation liquid to adjust the pH to 10-12, and then an appropriate amount of 0.1-0.5% (w / v) wall-breaking enzyme is added, and the reaction is carried out at 50-60° C. and 100-200 rpm for 6-12 hours; 2) Add an equal volume of anhydrous ethanol and continue shaking for 1 hour to inactivate the cell wall-breaking enzyme; 3) Add the same volume of anhydrous ethanol and n-hexane and continue shaking for 1 hour to extract lipids in the fermentation broth. After shaking, let it stand at room temperature until stratification, and collect the upper organic phase; 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

9. The method according to claim 7 or 8, characterized in that: The specific steps are as follows: (1) Fermentation seed culture: The genetically engineered strain is inoculated into a plate culture medium and cultured on a resistance plate. After the genetically engineered strain is inoculated, a single colony is picked out and inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the first-level seed is obtained. 1 mL of the first-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the second-level seed is obtained. 1 mL of the second-level seed culture solution is inoculated into 50 mL of seed culture medium. After culturing at 28° C. and 180 r / min on a shaking incubator for 24 h, the third-level seed is obtained as a fermentation strain. (2) Shake flask fermentation: 10 mL of the third-grade seed culture solution was inoculated into 90 mL of fermentation medium and cultured in a shaker at 28°C and 180 rpm for 120 h. (3) collecting the cells to extract lipids, comprising the following steps: 1) After the fermentation culture is completed, NaOH solution is added to the fermentation broth to adjust the pH to 10-12, and then a cell wall-breaking enzyme is added to the fermentation broth at a final concentration of 0.1-0.5%, and the mixture is shaken at 50-60° C. and 100-200 r / min for 6-12 hours; 2) Cool to room temperature, add anhydrous ethanol of the same volume as the fermentation broth after adding the cell wall-breaking enzyme, and shake for 1 hour to inactivate the cell wall-breaking enzyme; 3) adding n-hexane with the same volume as anhydrous ethanol to extract, and collecting the upper organic phase; 4) Repeat step 3) several times and combine the collected organic phases, evaporate the n-hexane by rotary evaporation to obtain oil.

10. The method according to claim 9, characterized in that: The pH value of the plate culture medium is 6.4, and it contains Zeocin resistance for screening at a concentration of 80-100 μg / mL. Other ingredients include: agar 20 g / L, glucose 40 g / L, yeast extract 15 g / L, sodium sulfate 10 g / L, magnesium sulfate 3 g / L, ammonium sulfate 8 g / L, potassium chloride 2 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.8 g / L, potassium dihydrogen phosphate 0.8 g / L, sodium glutamate 8 g / L, zinc sulfate heptahydrate 5 mg / L, cobalt dichloride hexahydrate 0.05 mg / L, copper sulfate pentahydrate 4 mg / L, nickel sulfate hexahydrate 1 mg / L, ferrous sulfate heptahydrate 8 mg / L, calcium pantothenate 3 mg / L, manganese chloride tetrahydrate 5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 7 mg / L, vitamin B 12 1 mg / L, solvent is water; The pH value of the seed culture medium is 6.4, and the culture medium comprises: 60 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 4 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.5 g / L potassium sulfate, 0.5 g / L potassium dihydrogen phosphate, 8 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.03 mg / L cobalt dichloride hexahydrate, 4 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 8 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, and the solvent is water. The fermentation medium has a pH value of 6.0 and includes: 90 g / L glucose, 15 g / L yeast extract, 10 g / L sodium sulfate, 3 g / L magnesium sulfate, 8 g / L ammonium sulfate, 2 g / L potassium chloride, 0.1 g / L calcium chloride, 0.8 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 15 g / L sodium glutamate, 3 mg / L zinc sulfate heptahydrate, 0.08 mg / L cobalt dichloride hexahydrate, 5 mg / L copper sulfate pentahydrate, 1 mg / L nickel sulfate hexahydrate, 10 mg / L ferrous sulfate heptahydrate, 2 mg / L calcium pantothenate, 4 mg / L manganese chloride tetrahydrate, 0.04 mg / L sodium molybdate dihydrate, 8 mg / L vitamin B6, and 10 mg / L vitamin B6. 12 2 mg / L, the solvent is water.

Images