Application of substance for inhibiting expression of OsPP18 gene in improvement of rice blast resistance

Abstract

The invention relates to the technical field of biology, and discloses application of a substance for inhibiting expression of an OsPP18 gene to improvement of rice blast resistance, and the OsPP18 gene is a gene for coding OsPP18 protein. An inoculation experiment shows that compared with receptor rice, the resistance of an OsPP18 knockout rice strain to rice blast is enhanced, and the resistance of an OsPP18 overexpression rice strain to rice blast is weakened, so that the OsPP18 is a gene related to plant disease resistance. The method disclosed by the invention is simple to operate and low in cost, greatly accelerates the breeding process, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to application of a substance for inhibiting the expression of an OsPP18 gene in the field of biotechnology in improving the resistance of rice to rice blast. Background Art

[0002] "Food is the first necessity of the people, and rice is the first necessity of food." Rice is an important staple food crop in the world. Improving rice yield and quality is a major issue related to national food security. Rice blast is an important fungal disease in rice production, which seriously affects rice yield and quality. It is urgent to improve the main varieties and cultivate and promote new rice varieties with stable yield and good resistance quality. Discovering new genes related to rice disease resistance, conducting in-depth research on the regulatory network of rice disease resistance-related genes, and applying them to production will lay the foundation for promoting the cultivation and promotion of excellent varieties.

[0003] The CRISPR / Cas system is a natural immune system in bacteria that helps to remove invading viruses and foreign nucleic acids. It consists of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeat, CRISPR) sequence elements and Cas proteins. Through modification, the CRISPR / Cas9 system can use a short RNA (single-guide RNA, sgRNA) to guide the endonuclease Cas9 to cut the target sequence and achieve mutation of the target gene. The CRISPR / Cas9 system has the advantages of simple operation, low cost and high efficiency. It was rated as one of the top ten scientific and technological advances in 2013 by Science and one of the most noteworthy technologies in 2014 by Nature Methods. At present, the system has been successfully applied to crops such as Arabidopsis, rice, wheat, sorghum, corn, and tomatoes, providing new opportunities for crop improvement and the creation of non-GMO products.

[0004] In the process of plant disease resistance, the resistance conferred by resistance genes (R genes) is generally narrow in spectrum and easily overcome by rapidly mutating physiological subspecies, so it is necessary to find genes with broad-spectrum resistance. In the process of plant-pathogen interaction, pathogens use a type of gene in plants to promote infection, which is called susceptibility gene (S gene). In recent years, with the development of CRISPR / Cas9 gene editing technology, plants can acquire resistance by mutating S genes, which has also become a new method for breeding disease-resistant varieties. At present, multiple susceptibility genes have been reported, such as ROD1, which is a susceptibility gene in rice. The loss of this gene can improve the resistance of rice to multiple diseases such as rice blast, white leaf blight and sheath blight; MLO is a susceptibility gene in wheat, and the MLO knockout has broad-spectrum and long-lasting resistance to wheat powdery mildew. Exploring more new susceptibility genes can provide candidate gene resources for obtaining disease-resistant plants through gene editing technology. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to improve the resistance of rice to rice blast.

[0006] In order to solve the above technical problems, the present invention provides the use of a substance that inhibits the expression of the OsPP18 gene in improving the resistance of rice to rice blast, wherein the OsPP18 gene is a gene encoding an OsPP18 protein; the OsPP18 protein is a protein of A1, A2 or A3 as follows:

[0007] A1, the amino acid sequence is the protein shown in SEQ ID No.2 in the sequence list;

[0008] A2, a protein related to rice blast resistance obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence list, having an identity of more than 80% with the protein shown in A1;

[0009] A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1 or A2.

[0010] In the above application, the protein tag refers to a polypeptide or protein that is fused and expressed with the target protein using DNA in vitro recombination technology to facilitate the expression, detection, tracing and / or purification of the target protein. The protein tag can be a Flag tag, a His tag, an MBP tag, an HA tag, a myc tag, a GST tag and / or a SUMO tag, etc. The amino acid sequences of some of the available tags are shown in Table 1.

[0011] Table 1 Tag sequences

[0012] Label Residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHQ c-myc 10 EQKLISEEDL

[0013] In the above application, SEQ ID No. 2 consists of 348 amino acid residues.

[0014] In the above application, identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST webpage on the NCBI homepage website. For example, in Advanced BLAST2.1, by using blastp as a program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as a Matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be obtained.

[0015] In the above applications, the above 80% identity may be at least 81%, 85%, 90%, 91%, 92%, 95%, 96%, 98%, 99% or 100% identity.

[0016] In the above application, the OsPP18 gene may specifically be the gene shown in E1 or E2 below:

[0017] E1, the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0018] E2. The nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No.3.

[0019] In the above application, the inhibition of OsPP18 gene expression is achieved by chemical mutagenesis, physical mutagenesis, RNAi, genome site-directed editing or homologous recombination of the OsPP18 gene in rice.

[0020] In the above applications, the gene editing can be achieved by zinc finger nuclease technology (ZFN), transcription activator-like effector nuclease technology (TALEN), clustered regularly interspaced short palindromic repeats / CRISPR associated, CRISPR / Cas9 system, and other technologies that can achieve site-specific editing of the genome.

[0021] In the above application, the genome editing can be specifically achieved with the help of CRISPR / Cas9 system. The target sequence of the CRISPR / Cas9 system is the XXX sequence located on any nucleotide sequence including XXXNGG in the OsPP18 gene; wherein XXX is any 19-20 bp nucleic acid sequence in the DNA molecule sequence, and N is any nucleotide of A, T, G, and C.

[0022] The specific target sequences are the sequences shown in SEQ ID No. 3, positions 3273-3292 and SEQ ID No. 3, positions 4129-4148 in the sequence listing.

[0023] In a specific embodiment of the present invention, the recombinant vector of the CRISPR / Cas9 system includes the recombinant vector pYL-HU-U3-OsPP18; the recombinant vector pYL-HU-U3-OsPP18 contains an sgRNA expression cassette and a Cas9 protein encoding gene, and can express sgRNA and Cas9.

[0024] In the above application, the substance that inhibits the expression of the OsPP18 gene includes the following F1 or F2:

[0025] F1, sgRNA; the target of the sgRNA is the sequence shown in SEQ ID No.3, positions 3273-3292 and SEQ ID No.3, positions 4129-4148;

[0026] F2, CRISPR / Cas9 vector expressing the sgRNA described in F1.

[0027] The present invention also provides a method for improving rice blast resistance, comprising the following steps: inhibiting the expression of OsPP18 gene in receptor rice to obtain target rice with higher rice blast resistance than the receptor rice.

[0028] In the above method, the improvement of rice blast resistance can be specifically manifested in that the lesion length (lesion area) on the target rice leaves after infection with the rice blast pathogen is shorter (smaller) than that of the recipient rice, and the biomass of the rice blast pathogen on the target rice leaves is less than that of the recipient rice.

[0029] In order to solve the above technical problems, the present invention also provides a plant agent for resisting rice blast, wherein the active ingredient of the agent is a substance that inhibits the expression of the gene encoding the OsPP18 protein, reduces the abundance of the OsPP18 protein, and / or knocks out the gene encoding the OsPP18 protein.

[0030] In the above-mentioned agent for resisting rice blast, the substance contains the following F1, F2 or F3:

[0031] F1, sgRNA, siRNA, shRNA, miRNA or antisense RNA targeting the gene;

[0032] F2, a DNA molecule that produces an sgRNA targeting the gene, a DNA molecule that produces an siRNA targeting the gene, a DNA molecule that produces an shRNA targeting the gene, a DNA molecule that produces an miRNA targeting the gene, or a DNA molecule that produces an antisense RNA targeting the gene;

[0033] F3. an expression vector that produces an sgRNA targeting the gene, an expression vector that produces an siRNA targeting the gene, an expression vector that produces an shRNA targeting the gene, an expression vector that produces an miRNA targeting the gene, or an expression vector that produces an antisense RNA targeting the gene.

[0034] The active ingredients of the above-mentioned anti-rice blast agent may also contain other biological components and / or non-biological components. Those skilled in the art may determine the other active ingredients of the above-mentioned agent according to the disease resistance effect of plants.

[0035] The present invention also provides an OsPP18 protein, wherein the OsPP18 protein is the following protein A1, A2 or A3:

[0036] A1, the amino acid sequence is the protein shown in SEQ ID No.2 in the sequence list;

[0037] A2, a protein related to rice blast resistance obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence list, having an identity of more than 80% with the protein shown in A1;

[0038] A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1 or A2.

[0039] The present invention also provides a biological material related to the OsPP18 protein, which is any one of the following B1 to B5:

[0040] B1. a nucleic acid molecule encoding the protein OsPP18;

[0041] B2, an expression cassette containing the nucleic acid molecule described in B1;

[0042] B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2;

[0043] B4, a recombinant microorganism containing the nucleic acid molecule described in B1, or a recombinant microorganism containing the expression cassette described in B2, or a recombinant microorganism containing the recombinant vector described in B3;

[0044] B5. A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1, or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2.

[0045] The nucleic acid molecule may be a DNA molecule, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be an RNA molecule, such as mRNA or hnRNA.

[0046] In the above biological material, the nucleic acid molecule described in B1 is the gene shown in E1 or E2 below:

[0047] E1, the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1;

[0048] E2. The nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No.3.

[0049] The present invention also protects a CRISPR / Cas9 system, which includes a vector expressing Cas9 and sgRNA, wherein the target sequence of the sgRNA is positions 3273-3292 of SEQ ID No. 3 and positions 4129-4148 of SEQ ID No. 3 in the sequence list.

[0050] Inoculation experiments showed that compared with recipient rice, OsPP18 knockout rice lines had enhanced resistance to rice blast, while OsPP18 overexpression rice lines had weakened resistance to rice blast, indicating that OsPP18 is a gene related to plant disease resistance. The method of the present invention is simple to operate, low in cost, greatly accelerates the breeding process, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is the gene-edited form of OsPP18 in the wild-type Nipponbare (NPB) and OsPP18 knockout plants (OsPP18-8 and OsPP18-10) in Example 1 of the present invention.

[0052] Figure 2 The relative expression levels of the OsPP18 gene in the wild-type Nipponbare (NPB) and the OsPP18 overexpressing plants (OsPP18-OE20 and OsPP18-OE30) in Example 2 of the present invention, where ** represents the result of the significant difference analysis of P<0.01.

[0053] Figure 3These are the resistance test results of the wild-type Nipponbare (NPB), two knockout strains (OsPP18-8 and OsPP18-10) and two overexpression strains (OsPP18-OE20 and OsPP18-OE30) after inoculation with rice blast fungus in Example 3 of the present invention. Figure 3 Figure A shows the phenotypes of wild-type Nipponbare (NPB), two knockout strains (OsPP18-8 and OsPP18-10), and two overexpression strains (OsPP18-OE20 and OsPP18-OE30) after inoculation with the P131 strain. Figure 3 Figure B is Figure 3 Statistical results of the lesion area in Figure A. Figure 3 The C diagram is Figure 3 The detection results of rice blast fungus biomass in Figure A. In the figure, ** represents the result of significant difference analysis with P < 0.01.

[0054] Figure 4 The ROS burst levels in the wild-type Nipponbare (NPB), knockout strain (OsPP18-8) and overexpression strain (OsPP18-OE20) at different time points after chitin treatment in Example 4 of the present invention.

[0055] Figure 5 The MAPKs activation levels in the wild-type Nipponbare (NPB), knockout strain (OsPP18-8) and overexpression strain (OsPP18-OE20) at different time points after chitin treatment in Example 5 of the present invention.

[0056] Figure 6 The relative expression levels of the genes related to the course of disease in the wild-type Nipponbare (NPB), the knockout strain (OsPP18-8) and the overexpression strain (OsPP18-OE20) after chitin treatment in Example 6 of the present invention. In the figure, * represents the result of the significant difference analysis as P<0.05, and ** represents the result of the significant difference analysis as P<0.01. The genes related to the course of disease are OsPR1b and OsAOS2. DETAILED DESCRIPTION

[0057] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0058] The quantitative tests in the following examples were all repeated three times, and the results were averaged.

[0059] The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are commercially available unless otherwise specified.

[0060] The components and concentrations of MS medium used in the following examples are shown in Table 2.

[0061] Table 2 MS medium composition and concentration used

[0062]

[0063] The vector pYL-HU-U3-CCDB in the following examples is a product of Wuhan Boyuan Biotechnology Co., Ltd., which is recorded in the document "Zhao W, Zheng S, Ling H Q. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice cultivar Handao 297. Plant Cell Tissue & Organ Culture. 2011, 106 (3): 475." The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiments of this application.

[0064] The vector pUbi1305 in the following example is recorded in the non-patent document "Liu Y, Zhang X, Yuan G, Wang D, Zheng Y, Ma M, Guo L, Bhadauria V, Peng YL, Liu JA designer rice NLR immune receptor confers resistance to the rice blast fungus carrying noncorresponding avirulence effectors. Proc Natl Acad Sci US A. 2021Nov;118(44):e2110751118.doi:10.1073 / pnas.2110751118.", which can be obtained by the public from China Agricultural University (i.e., the applicant) to repeat the experiments of this application.

[0065] The rice variety Nipponbare in the following examples is a hybrid variety obtained by crossing "Yamabiko" and "Xingfeng" at the Aichi Prefecture Agricultural Experiment Station in Japan in 1957, and was introduced to China from Japan by the Chinese Academy of Agricultural Sciences in 1967. It was approved by Shandong in 1985 and numbered: Jingyin 153. The public can obtain it from China Agricultural University (i.e., the applicant) to repeat the experiment of this application.

[0066] The Magnaporthe oryzae P131 strain in the following examples is a rice blast pathogen, which is recorded in the non-patent literature "Liu H, Lu X, Li M, Lun Z, Yan X, Yin C, Yuan G, Wang X, Liu N, Liu D, Wu M, Luo Z, Zhang Y, Bhadauria V, Yang J, Talbot NJ, Peng YL. Plant immunity suppression by an exo-β-1,3-glucanase and an elongation factor 1α of the rice blast fungus. Nat Commun. 2023 Sep 7; 14 (1): 5491. doi:

[0067] 10.1038 / s41467-023-41175-z.”, the public can obtain it from China Agricultural University (i.e. the applicant) to repeat the experiments of this application.

[0068] The data in the following examples were processed using GraphPad Prism 9 statistical software, and the experimental results were expressed as mean ± standard deviation. The t-test was used for the analysis, and P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated a very significant difference.

[0069] Example 1. Establishment and identification of OsPP18 gene knockout strains

[0070] The genomic sequence of the OsPP18 gene is shown in SEQ ID No. 3, wherein positions 1-3000 are its own promoter, positions 3149-3375 are the first exon, positions 4128-4255 are the second exon, positions 4347-4445 are the third exon, positions 4536-4694 are the fourth exon, positions 4919-5005 are the fifth exon, positions 5094-5185 are the sixth exon, positions 5423-5497 are the seventh exon, and positions 5599-5778 are the eighth exon. The CDS sequence of the OsPP18 gene is shown in SEQ ID No. 1, and the protein encoded by it is named OsPP18, and the amino acid sequence of the protein is shown in SEQ ID NO. 2.

[0071] SEQ ID No.1

[0072]

[0073] SEQ ID No.2

[0074] MHGRPSRPLASSSSSSSSRVFSFFLAPRVFLLVVVVVVVVFLPGRSSCWWLEGTEELEEEMGFAGDCSPVSGGGLSENGKFSYGYASAPGKRASMEDFYETRIDGVDGETIGLFGVFDGHGGARAAEYVKQHLFSNLIKHPKFISDIKSAIAETYNHTDSEFLKAESSHTRDAGSTASTAILVGDRLLVANVGDSRAVVCRGGDAIAVSRDHKPDQSDERQRIEDAGGFVMWAGTWRVGGVLAVSRAFGDKLLKQYVVADPEIKEEIVDSSLEFLILASDGLDVVSNKEAVDMVRPIQDPEQAAKRLLQEAYQRGSADNITVVIVRFLEGTTTGGGPSREAASDQNS

[0075] SEQ ID No.3

[0076]

[0077] 1. A short sequence on the OsPP18 gene was artificially synthesized as a guide RNA (SgRNA), and the target sequences of the SgRNA were TGCCGGGTCGGTCGTCTTGC (SEQ ID No. 3, positions 3273-3292, referred to as target 1) and GAAAACGGCAAGTTCAGTTA (SEQ ID No. 3, positions 4129-4148, referred to as target 2).

[0078] 2. Use restriction endonuclease BsaI to digest vector pYL-HU-U3-CCDB and recover the vector backbone. Connect the coding sequence of SgRNA to the vector backbone of vector pYL-HU-U3-CCDB by T4 ligase to obtain recombinant vector pYL-HU-U3-OsPP18. The structure of recombinant vector pYL-HU-U3-OsPP18 is described as follows: insert the coding sequence of SgRNA into the restriction endonuclease BsaI cleavage site of vector pYL-HU-U3-CCDB, keep the other sequences of vector pYL-HU-U3-CCDB unchanged, and obtain the recombinant vector. Recombinant vector pYL-HU-U3-OsPP18 expresses SgRNA and Cas9.

[0079] 3. The recombinant vector pYL-HU-U3-OsPP18 was used for Agrobacterium-mediated rice transformation. When the callus of the rice variety Nipponbare was infected, the SgRNA guided the nuclease Cas9 to the target sequence in the transgenic rice cells to complete the gene editing of the target sequence. The T was obtained by hygromycin screening. 0 Generation of transformants.

[0080] 4. Add 60 μL M5 Hiper ultra-fast mix to a 2 mL centrifuge tube containing a 5 mm diameter steel bead to directly amplify the best partner, cut a 1 cm T 0 The leaves of the transformants were placed in a 2 mL tube and crushed using a grinder.

[0081] 5. Heat at 65°C for 10 min to extract rice DNA, centrifuge at 12000 rpm for 1 min, take 0.5 μL of supernatant for PCR amplification, and the primers used are as follows:

[0082] OsPP18-ba1-F:TCTTCCTCCTCCTCTCTCTC;

[0083] OsPP18-ba1-R:AGAGGGGTCAAGTCAAGAAAGCCC.

[0084] OsPP18-ba2-F: TGCAAACAAGTTCTTTTTTTGTCC;

[0085] OsPP18-ba2-R:AGTACCGTCGAATACGCCAAA.

[0086] 6. Compare the sequence of the PCR product with the wild type to identify the gene editing form of the OsPP18 knockout rice material. Select several knockout homozygous strains, of which two homozygous strains are numbered OsPP18-8 and OsPP18-10. The results are shown in Figure 1 :

[0087] OsPP18-8: Compared with the wild-type Nipponbare (NPB), the OsPP18 gene in the genome of the OsPP18-8 mutant plant mutated. At target site 2, the two homologous chromosomes lacked the G at position 4145 (located in the second exon) of SEQ ID No.3, a total of 1bp was missing, resulting in a frameshift mutation in the OsPP18 gene, which was unable to encode the protein OsPP18 with the amino acid sequence of SEQ ID No.2, ultimately causing the loss of OsPP18 function, thereby knocking out the OsPP18 gene.

[0088] OsPP18-10: Compared with the wild-type Nipponbare (NPB), the OsPP18 gene mutated in the genome of the OsPP18-10 mutant plant. At target site 2, the two homologous chromosomes lacked AG at positions 4144-4145 (located in the second exon) of SEQ ID No.3, a total of 2bp was missing, resulting in a frameshift mutation in the OsPP18 gene, which was unable to encode the protein OsPP18 with the amino acid sequence of SEQ ID No.2, ultimately causing the loss of OsPP18 function, thereby knocking out the OsPP18 gene.

[0089] Example 2: Establishment and identification of OsPP18 overexpression strains

[0090] 1. Using the cDNA of the rice variety Nipponbare as a template, the open reading frame sequence of the OsPP18 gene was obtained by PCR amplification, and the PCR product was recovered. The primers used are as follows:

[0091] HA-OsPP18-Flag-F:5'-GTTCCAGATTACGCTTCT AAGCTT ATGCATGGGAGGCCGTCG-3' (positions 25-42 are identical to positions 1-18 of SEQ ID No. 1, and the underlined sequence is the Hind III enzyme recognition site sequence);

[0092] HA-OsPP18-Flag-R:5'-ATGGTCTTTGTAGTCAGA AAGCTTTGAGTTTTGGTCGCTGGCG-3' (positions 25-43 thereof are reverse complementary to the sequence of positions 1026-1044 of SEQ ID No. 1, and the underlined sequence is the Hind III enzyme recognition site sequence).

[0093] The PCR product was recovered to obtain the OsPP18 gene fragment.

[0094] 2. The vector pUbi1305 was digested with Hind III to obtain the digested vector pUbi1305, and the OsPP18 gene fragment was connected to the digested vector pUbi1305 to obtain the recombinant expression vector pUbi1305-OsPP18. After verification by bacterial liquid PCR and sequencing, the structure of the recombinant expression vector pUbi1305-OsPP18 is described as follows: the DNA molecule shown in positions 1-1044 of SEQ ID NO.1 was inserted into the restriction endonuclease Hind III digestion site of the vector pUbi1305, and the other sequences of the vector pUbi1305 were kept unchanged to obtain the recombinant expression vector. In the recombinant expression vector pUbi1305-OsPP18, the Ubi promoter drives the expression of the OsPP18 gene.

[0095] 3. The recombinant expression vector pUbi1305-OsPP18 obtained in step 2 was introduced into the Agrobacterium strain EHA105 to prepare the recombinant Agrobacterium EHA105-OsPP18 and infect the callus of the rice variety Nipponbare. 0 Generation of transformants.

[0096] 4. Cut wild-type Nipponbare and T 0 DNA was extracted from leaves of the transformants. 0 The DNA of the transformants was used as a template for amplification. The specific sequences of Hyg-F and Hyg-R are as follows:

[0097] Hyg-F: 5'-TTGGCGACCTCGTATTGGGAA-3';

[0098] Hyg-R: 5'-CAAAGATCGTTATGTTTATCGGCACT-3'.

[0099] The obtained PCR fragments were detected by electrophoresis, and the plant that amplified a hygromycin fragment of about 500 bp was T 0 The OsPP18 transgenic positive plants (i.e., OsPP18 overexpressing plants) of the first generation were selected.

[0100] 5. Transplant the OsPP18 transgenic positive plants of the T0 generation into the soil, self-pollinate to obtain T1 generation seeds, and then self-pollinate to obtain T2 generation seeds after further planting, and analyze the segregation of hygromycin resistance in the T2 generation. Select several overexpression homozygous strains, of which two homozygous strains are numbered OsPP18-OE20 and OsPP18-OE30.

[0101] 6. Total RNA was extracted from rice, reverse transcribed to obtain cDNA, and qRT-PCR was performed. Using the OsUBQ10 gene as an internal reference, the expression level of the OsPP18 gene in the wild-type Nipponbare (NPB) and each overexpression homozygous strain (OsPP18-OE20 and OsPP18-OE30) was detected by fluorescence quantitative PCR instrument (ABI 7500, USA).

[0102] The primer sequences used are shown in Table 3, and the experiment was repeated three times.

[0103] Table 3 Primer sequences

[0104] Gene name Forward primer 5'-3' Reverse primer 5'-3' OsPP18 CTCAACTGCCTCAACAGCTATTC GGGTTTGTGATCCCTTGAAACTG OsUBQ10 TGGTCAGTAATCAGCCAGTTTGG GCACCACAAATACTTGACGAACAG

[0105] Results Figure 2 It can be seen that the expression of OsPP18 gene in transgenic rice lines OsPP18-OE20 and OsPP18-OE30 was significantly upregulated.

[0106] Example 3: Analysis of the resistance phenotype of rice lines to rice blast in knockout and overexpression of OsPP18

[0107] In order to detect the resistance of OsPP18 knockout and overexpression rice lines to rice blast fungus, the phenotype was observed by scratch inoculation. The specific steps are as follows:

[0108] 1. The seeds of wild-type Nipponbare, two knockout strains (OsPP18-8 and OsPP18-10) and two overexpression strains (OsPP18-OE20 and OsPP18-OE30) were placed in a 37°C incubator and soaked in water for two days for germination. The germinated seeds were then transferred into small pots with a diameter of 9 cm and cultured in a 30°C culture room for about 20 days until the four-leaf one-heart stage. The greenhouse maintained a relative humidity of 70%, 14 hours of light per day, and 10 hours of darkness per day.

[0109] 2. Activate the Magnaporthe oryzae P131 strain and grow it in an incubator at 28°C for about 7 days.

[0110] 3. Take the penultimate leaf of the rice plant at the four-leaf, one-heart stage in step 1. Take at least 5 leaves from each strain. Cut into 6 to 7 cm lengths and use an insect pin to lightly scratch about 1 mm. 2Three wounds were made on the main vein of each leaf. The scratched leaves were placed in a 10 cm × 10 cm culture dish, and moist filter paper was placed in the culture dish in advance to maintain humidity.

[0111] 4. Rinse the culture dish in step 2 with 0.025% Tween water by volume to collect the spores of strain P131 and adjust the spore solution to 1.5×10 5 A P131 spore suspension was prepared at a concentration of spores / mL.

[0112] 5. Before inoculation, spray the surface of the leaves treated in step 3 evenly with 0.025% Tween water by volume to form a mist to increase the adhesion of the spore suspension. Inoculate 10 μL of P131 spore suspension (see step 4) at each wound on the leaves. Keep the inoculated leaves moisturized in a petri dish and place them in a dark environment for 24 to 36 hours.

[0113] 6. After the dark treatment, move the culture dish to the light condition, observe the lesions and take pictures after 3 to 4 days. The phenotypes of the wild-type Nipponbare, two knockout strains (OsPP18-8 and OsPP18-10) and two overexpression strains (OsPP18-OE20 and OsPP18-OE30) after inoculation with the P131 strain are shown in Figure 3 Figure A.

[0114] 7. Statistical analysis of the length of the lesions is as follows:

[0115] The 12 lesion areas of the wild-type Nipponbare, two knockout lines (OsPP18-8 and OsPP18-10) and two overexpression lines (OsPP18-OE20 and OsPP18-OE30) infected with the P131 strain were measured, and the average values ​​were calculated and the significant differences were calculated using the Student's t test. The results are shown in Figure 3 Figure B.

[0116] 8. Quantification of bacterial biomass in rice leaves:

[0117] For specific implementation methods, please refer to "Yoji Kawano, Akira Akamatsu, Keiko Hayashi, Yusuke Housen, Jun Okuda, Ai Yao, Ayako Nakashima, Hiroki Takahashi, Hitoshi Yoshida, HannLing Wong, Tsutomu Kawasaki, Ko Shimamoto. Activation of a Rac GTPase by the NLRfamily disease resistance protein Pit plays a critical role in rice innateimmunity, Cell Host Microbe,2010,7(5):362-75" article.

[0118] After inoculation with the P131 strain, leaves with a size of 2×1 cm including lesions were taken, and DNA was extracted using the conventional CTAB method. The DNA concentration was measured and quantified to 3 μg.

[0119] Using real-time fluorescence quantitative PCR technology, according to the instructions provided by the manufacturer (Genestar), SYBR green I fluorescent dye was added to the PCR system, and the expression of the rice blast fungus MoPot2 gene was detected in a fluorescence quantitative PCR instrument (ABI 7500, USA), with the rice Ubiquitin gene as an internal reference. The primer sequences used are shown in Table 4. The experiment was repeated three times, and the results are shown in Figure 3 Figure C.

[0120] Table 4 Primer sequences

[0121] Gene name Forward primer 5'-3' Reverse primer 5'-3' MoPot2 ACGACCCGTCTTTACTTATTTGG AAGTAGCGTTGGTTTTGTTGGAT OsUbiqintin TTCTGGTCCTTCCACTTTCAG ACGATTGATTTAACCAGTCCATGA

[0122] Figure 3 The results showed that compared with the wild type, the OsPP18 knockout strain had enhanced resistance to rice blast, while the overexpression rice strain had weakened resistance to rice blast, specifically, the rice blast lesion area on the leaves of rice in the OsPP18 knockout strain became smaller and the biomass of rice blast fungus decreased, while the rice blast lesion area on the leaves of rice in the OsPP18 overexpression strain became larger and the biomass of rice blast fungus increased.

[0123] Example 4. ROS burst levels in OsPP18 knockout and overexpression rice lines during chitin treatment

[0124] To detect the ROS burst levels in OsPP18 knockout and overexpression rice lines when treated with chitin, the specific method is as follows:

[0125] 1. The seeds of wild-type Nipponbare, knockout strain OsPP18-8 and overexpression strain OsPP18-OE20 were placed in a 37°C incubator and soaked in water for two days for germination. The germinated seeds were then transferred into small pots with a diameter of 9 cm and cultured in a 30°C incubator for about 20 days until the four-leaf one-heart stage. The greenhouse maintained a relative humidity of 70%, 14 hours of light and 10 hours of darkness per day.

[0126] 2. Take rice heart slices with good growth condition, make small discs with a 4mm diameter puncher, and transfer them to sterile water to recover for 12-18 hours.

[0127] 3. Add 50 μL of sterile water to each well of the 96-well plate and use a white pipette tip to pick up a small disc and place it into the well.

[0128] 4. Prepare the reaction solution, including 0.02mM luminol, 20μg / ml horseradish peroxidase, 10μg / ml chitin or sterile water, and add it to eight rows of PCR tubes.

[0129] 5. Use a pistol to draw 50 μL of the reaction solution and quickly add it to the hole with the small disc. Place the test plate in the ELISA reader and read the readings every 1 minute for 20-40 minutes until the curve drops gently. The results are shown in the table. Figure 4 .

[0130] Figure 4 The results showed that compared with the wild type, the ROS burst level in the OsPP18 knockout rice line ospp18-8 was significantly increased, while the ROS burst level in the OsPP18 overexpression rice line OsPP18-OE20 was significantly decreased.

[0131] Example 5. MAPKs activation levels in OsPP18 knockout and overexpression rice lines during chitin treatment

[0132] To detect the MAPKs activation levels in OsPP18 knockout and overexpression rice lines under chitin treatment, the specific method is as follows:

[0133] 1. Treat the seeds of wild-type Nipponbare, knockout strain OsPP18-8 and overexpression strain OsPP18-OE20 with 70% alcohol for 3 minutes, wash with 30% laundry detergent for 45 minutes, and then rinse the seeds with plenty of sterile water in a clean bench until there is no foam and dry them.

[0134] 2. Spread the seeds on solid 1 / 2MS medium, culture at 28℃ for 5 to 7 days, and then transfer to liquid 1 / 2MS medium and culture for 2-3 days.

[0135] 3. Treat the seedlings of wild type, OsPP18 knockout and overexpression strains with ultrapure water and 10 μg / mL chitin suspension (chitin suspension is prepared with water and stored in a -20°C refrigerator after ultrasound, and the mother solution concentration is 1 mg / mL), and take samples at 0, 15, 30, and 60 minutes, respectively.

[0136] 4. To extract total protein from the sample obtained in step 3, add the phosphatase inhibitor PhosSTOP to the protein extraction buffer. TM .

[0137] 5. The protein content of MAPK3 and MAPK6 and the internal reference protein Actin in the above protein samples was detected by western blotting, using Phospho-p44 / 42 antibody (for detecting the level of phosphorylated MAPKs) and Actin antibody (both are commercial antibodies, Phospho-p44 / 42 antibody catalog number: Cell Signaling Technology 4370; Actin antibody catalog number: EASYBIO BE0027-100).

[0138] Figure 5 The results showed that compared with the wild type, the activation levels of MAPK3 and MAPK6 in the OsPP18 knockout rice line OsPP18-8 were significantly increased, while the activation levels of MAPK3 and MAPK6 in the OsPP18 overexpression rice line OsPP18-OE20 were significantly decreased.

[0139] Example 6. Expression levels of pathogenesis-related genes in OsPP18 knockout and overexpression rice lines during chitin treatment

[0140] To detect the expression levels of pathogenesis-related genes in OsPP18 knockout and overexpression rice lines under chitin treatment, the specific steps were as follows:

[0141] 1. Treat the seeds of wild-type Nipponbare, knockout strain OsPP18-8 and overexpression strain OsPP18-OE20 with 70% alcohol for 3 minutes, wash with 30% laundry detergent for 45 minutes, and then rinse the seeds with plenty of sterile water in a clean bench until there is no foam and dry them.

[0142] 2. Spread the seeds on solid 1 / 2MS medium, culture at 28℃ for 5 to 7 days, and then transfer to liquid 1 / 2MS medium and culture for 2-3 days.

[0143] 3. Treat the seedlings of wild-type, OsPP18 knockout and overexpression strains with ultrapure water and 10 μg / mL chitin suspension (chitin suspension is prepared with water and stored in a -20°C refrigerator after ultrasound, and the mother liquor concentration is 1 mg / mL), respectively, and take samples after 6 hours of treatment.

[0144] 4. Extract total RNA from the sample obtained in step 3 and reverse transcribe it to obtain cDNA.

[0145] 5. The expression levels of the disease-related genes OsPR1b and OsAOS2 in the above cDNA samples were detected by fluorescent quantitative PCR instrument (ABI 7500, USA), with OsUBQ10 as the internal reference gene (the detection gene and primer sequences are shown in Table 5), and the sequences are shown in Table 5.

[0146] Table 5

[0147] Gene name Forward primer 5'-3' Reverse primer 5'-3' OsPR1b TACGCCAGCCAGAGGAGC GCCGAACCCCAGAAGAGG OsAOS2 AAGCTGCTGCAATACGTGTACTGG CGACGAGCAACAGCCTTCCG OsUBQ10 TGGTCAGTAATCAGCCAGTTTGG GCACCACAAATACTTGACGAACAG

[0148] Figure 6 The results showed that compared with the wild type, the induction of pathogenesis-related genes in the OsPP18 knockout rice line OsPP18-8 was significantly increased, while the induction of pathogenesis-related genes in the OsPP18 overexpression rice line OsPP18-OE20 was significantly decreased.

[0149] Based on the above results, knocking out the OsPP18 gene can significantly improve the rice resistance to rice blast, while overexpressing the OsPP18 gene can significantly reduce the rice resistance to rice blast.

[0150] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. Use of a substance that inhibits the expression of the OsPP18 gene in improving the resistance of rice to rice blast disease, characterized in that: The OsPP18 gene is a gene encoding an OsPP18 protein; the OsPP18 protein is a protein of A1, A2 or A3 as follows: A1, a protein having an amino acid sequence as shown in SEQ ID No. 2 in the sequence list; A2, a protein related to rice blast resistance obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 2 in the sequence list, having an identity of more than 80% with the protein shown in A1; A3: A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1 or A2.

2. The use according to claim 1, characterized in that: The OsPP18 gene is the gene shown in E1 or E2 below: E1, the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1; E2. The nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No.

3.

3. The use according to claim 1 or 2, characterized in that: The inhibition of the expression of the OsPP18 gene in rice is achieved by gene editing of the OsPP18 gene in the recipient rice; the gene editing is achieved with the aid of the CRISPR / Cas9 system.

4. The use according to claim 3, characterized in that: The CRISPR / Cas9 system includes a vector expressing Cas9 and sgRNA, wherein the target sequence of the sgRNA is SEQ ID No. 3, positions 3273-3292 and SEQ ID No. 3, positions 4129-4148 in the sequence list.

5. A method for improving rice blast resistance, characterized in that: The method comprises the following steps: inhibiting the expression of OsPP18 gene in the acceptor rice to obtain the target rice with higher resistance to rice blast than the acceptor rice.

6. An agent for resisting rice blast, characterized in that: The active ingredient of the reagent is the substance that inhibits the expression of the OsPP18 gene as described in claim 4.

7. The protein according to claim 1 or 2.

8. The protein-related biomaterial according to claim 7, characterized in that: Any one of B1 to B5 below: B1. A nucleic acid molecule encoding the protein according to claim 7; B2, an expression cassette containing the nucleic acid molecule described in B1; B3, a recombinant vector containing the nucleic acid molecule described in B1, or a recombinant vector containing the expression cassette described in B2; B4, a recombinant microorganism containing the nucleic acid molecule described in B1, or a recombinant microorganism containing the expression cassette described in B2, or a recombinant microorganism containing the recombinant vector described in B3; B5. A transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in B1, or a transgenic plant cell line, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the expression cassette described in B2.

9. The biomaterial according to claim 8, characterized in that: The nucleic acid molecule B1 is the gene shown in E1 or E2 below: E1, the coding sequence of the coding strand is a DNA molecule of SEQ ID No. 1; E2. The nucleotide sequence is the DNA molecule at positions 3001-6370 of SEQ ID No.

3.

10. CRISPR / Cas9 system, characterized in that: The CRISPR / Cas9 system includes a vector expressing Cas9 and sgRNA, wherein the target sequence of the sgRNA is positions 3273-3292 of SEQ ID No. 3 and positions 4129-4148 of SEQ ID No. 3 in the sequence list.

Images