D-psicose invertase mutant and application thereof

Abstract

The invention discloses a D-psicose invertase mutant and application thereof. The mutant is obtained by performing single mutation or multiple mutation on the 13th site, the 49th site, the 54th site, the 100th site, the 235th site and the 242th site of an amino acid sequence shown in SEQ ID NO.2. The invention further discloses a preparation method of the D-psicose invertase mutant. The D-psicose invertase mutant can tolerate the high temperature of 40-80 DEG C, the half-life period of the mutant enzyme is prolonged, the substrate affinity and conversion efficiency of the enzyme to D-fructose used as a substrate for synthesizing D-psicose are improved, a relatively rare enzyme library is expanded, and the D-fructose is green, environment-friendly, low in toxicity and high in yield when being used for synthesizing the D-psicose invertase. The method overcomes the problem that three wastes are easily generated in a chemical synthesis method, and has important industrial application prospects.

Description

(I) Technical field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a D-psicose converting enzyme mutant and application thereof in the preparation of D-psicose. (II) Background technology

[0002] D-psicose is the C-3 diastereomer of D-fructose. In stereochemistry, stereoisomers containing multiple chiral carbon atoms, except for one chiral carbon atom with different configurations, are called diastereomers, also known as diastereoisomers. As a new functional rare sugar, recent studies have shown that D-psicose also has many physiological functions and has important application potential in the fields of diet, medicine, and health care, attracting more and more attention from scientists at home and abroad. Therefore, the development of natural and healthy rare sugars to replace existing sweeteners has become a research hotspot. The Ministry of Health, Labor and Welfare of Japan has approved the application of D-psicose in food production, registered the trademark of D-psicose in 2011, and formally applied for specific health foods. The U.S. Food and Drug Administration (FDA) has also recognized D-psicose as food safety grade GRAS.

[0003] Among the methods for producing D-psicose, biological preparation of D-psicose is currently considered to be the most effective method. The key is to find an enzyme that can convert D-fructose into D-psicose. However, the current D-psicose 3-epimerase has problems such as low catalytic activity for fructose and poor temperature stability, making it unsuitable for industrial production of D-psicose. With the increasing market demand for D-psicose, the development of efficient biocatalysts is crucial for its industrial application.

[0004] In order to meet the needs of industrial applications, research has been conducted on the thermostability modification of enzyme molecules based on protein engineering technology for D-psicose 3-epimerase with different properties. Computer-assisted molecular modification of enzyme thermostability is also of great significance in meeting the people's growing demand for sugar intake.

[0005] Therefore, the development of D-psicose 3-epimerase with high catalytic activity and high thermal stability is of great significance for the production of D-psicose. (III) Summary of the invention

[0006] The present invention aims to provide a D-psicose converting enzyme mutant and its application in the preparation of D-psicose, so as to solve the technical problems of low activity and poor thermal stability of D-psicose-3-epimerase in industrial production.

[0007] The technical solution adopted by the present invention is:

[0008] The present invention provides a D-psicose converting enzyme mutant, wherein the mutant is obtained by performing single mutation or multiple mutation at the 13th, 49th, 54th, 100th, 235th and 242nd positions of the amino acid sequence shown in SEQ ID NO.2.

[0009] Furthermore, the mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.2 is mutated into one of the following: (1) the alanine at position 13 is mutated into serine; (2) the valine at position 235 is mutated into isoleucine; (3) the alanine at position 13 is mutated into serine, and the valine at position 235 is mutated into isoleucine; (4) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, and the aspartic acid at position 100 is mutated into asparagine; (5) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, and the isoleucine at position 242 is mutated into valine; (6) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, the aspartic acid at position 100 is mutated into asparagine, and the isoleucine at position 242 is mutated into valine. The nucleotide sequence is SEQ ID NO.3 and the amino acid sequence is SEQ ID NO.4.

[0010] Due to the particularity of the amino acid sequence, any variant of the polypeptide of the amino acid sequence shown in SEQ ID NO.4, such as its conservative variant, biologically active fragment or derivative, as long as the fragment or polypeptide variant of the polypeptide has a homology of more than 95% with the aforementioned amino acid sequence, belongs to the scope of protection of the present invention. The change may include the deletion, insertion or substitution of amino acids in the amino acid sequence; for conservative changes of the variant, the replaced amino acid has a similar structure or chemical property to the original amino acid, such as replacing isoleucine with leucine, and the variant may also have non-conservative changes, such as replacing glycine with tryptophan.

[0011] The present invention also provides a gene encoding the D-psicose converting enzyme mutant, preferably as shown in SEQ ID NO.3.

[0012] Due to the particularity of the nucleotide sequence, any variant of the polynucleotide shown in SEQ ID NO.3, as long as it has more than 95% homology with the polynucleotide, belongs to the scope of protection of the present invention. The variant of the polynucleotide refers to a polynucleotide sequence with one or more nucleotide changes. The variant of this polynucleotide can be an allelic variant or an abiotic variant, including a substitution variant, a deletion variant and an insertion variant. As known in the art, an allelic variant is a replacement form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change the function of encoding amino acids.

[0013] The present invention also relates to a recombinant vector containing a gene encoding a mutant of the D-psicose converting enzyme, and a recombinant bacterium constructed by the recombinant vector. The recombinant vector uses pET-28a as a basic vector, and the recombinant bacterium uses E. coli BL21 (DE3) as a host bacterium. A recombinant vector containing the D-psicose converting enzyme gene is constructed, and the recombinant vector is transformed into Escherichia coli. The obtained recombinant genetically engineered bacteria are subjected to induction culture, and the culture fluid is separated to obtain bacterial cells containing the D-psicose converting enzyme, which can be used as an enzyme source for microbial catalytic D-fructose isomerization to prepare D-psicose.

[0014] The present invention also relates to an application of the D-psicose converting enzyme mutant in preparing D-psicose by microbial catalytic D-fructose isomerization. The application comprises: using wet bacteria obtained by fermentation culture of recombinant bacteria containing a gene encoding the D-psicose converting enzyme mutant or pure enzyme solution obtained by ultrasonic crushing of wet bacteria as an enzyme source, using D-fructose as a substrate, using cobalt ions as a catalyst, and using a pH 6.0-8.0 buffer (preferably a 50 mM pB (pH 6.5) buffer) as a reaction medium to form a reaction system, reacting at 50-80° C. and 100-200 r / min, and obtaining D-psicose after the reaction is complete.

[0015] Furthermore, in the reaction system, the amount of wet bacteria is 10-70 g / L, preferably 25 g / L, the amount of pure enzyme solution based on protein content is 0.01-0.5 mg / mL, preferably 0.03 mg / mL; the final concentration of cobalt ions is 0.1-10 mM, preferably 1 mM; the initial concentration of substrate is 50-500 g / L, preferably 100 g / L. The cobalt ions are added in the form of CoCl2.

[0016] Furthermore, the wet cells were prepared as follows: the recombinant bacteria containing the D-psicose converting enzyme mutant encoding gene were inoculated into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37°C and 200 r / min until the OD 600 =0.8~1.0, obtain seed solution; the seed solution is transferred into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL at a volume concentration of 1~5%, and cultured at 37°C and 180r / min until OD 600 =0.6-0.8, add IPTG with a final concentration of 0.1 mM, induce culture at 28°C, 180 r / min for 12-14 h, centrifuge and collect wet cells.

[0017] Further, the pure enzyme solution was prepared as follows: 1 g of wet bacteria was suspended in 10 mL of 50 mM Tris-Hcl (pH 9.0) buffer, ultrasonically disrupted at 120 W for 20 min, ultrasonicated for 1 s, paused for 2 s, centrifuged at 4 ° C, 8000 r / min for 10 min, and the supernatant was collected to obtain a crude enzyme solution; the crude enzyme solution was purified using a nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC prepacked column, 40 mm length × 12.6 mm inner diameter), first equilibrated with an equilibrium buffer (50 mM PB buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0) The column was equilibrated, and the crude enzyme solution was loaded at a speed of 1 mL / min for 4 column volumes, and then an eluent (50 mM PB buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) was used. 8.0) eluting at a rate of 2 mL / min, using a UV detector and a conductivity detector for monitoring, collecting the corresponding effluent when the UV detector signal and the conductivity detector signal rise simultaneously, and stopping collecting when the conductivity detector signal remains unchanged and the UV detector signal decreases to obtain a pure enzyme solution.

[0018] Furthermore, the reaction uses D-glucose as a substrate and is carried out according to the following steps: using wet bacteria obtained by fermentation and culture of a recombinant bacterium containing a gene encoding a D-psicose converting enzyme mutant or a pure enzyme solution obtained by ultrasonic crushing of wet bacteria as an enzyme source, using a pure enzyme solution obtained by fermentation and culture of a glucose isomerase recombinant bacterium as a coenzyme, using D-glucose as a substrate, using cobalt ions as a catalyst, and using a pH 6.0-8.0 buffer (preferably a 50 mM pB (pH 6.5) buffer) as a reaction medium to form a conversion system, reacting at 50-80° C. and 100-200 r / min, and obtaining D-psicose after the reaction is complete. The amino acid sequence of the glucose isomerase is shown in SEQ ID NO.5. The pure enzyme solution of the recombinant bacteria of the glucose isomerase is prepared by a pure enzyme solution method of a recombinant bacteria containing a D-psicose converting enzyme mutant encoding gene. In the conversion system, the amount of coenzyme added is 0.01-0.5 mg / mL based on protein content, preferably 0.03 mg / mL; the amount of enzyme source added is 10-70 g / L based on wet bacterial weight, preferably 25 g / L; the amount of enzyme source used is 0.01-0.5 mg / mL based on protein content, preferably 0.03 mg / mL; the final concentration of cobalt ions is 0.1-10 mM, preferably 1 mM; and the initial concentration of substrate is 50-500 g / L, preferably 100 g / L.

[0019] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:

[0020] (1) The present invention screened a D-psicose converting enzyme mutant with improved thermal stability, which can withstand high temperatures of 40 to 80°C and enhance the half-life of the mutant enzyme. The superimposed mutant A13SD / 100N / V235I / I242V was incubated at 70°C for 24 hours, and the residual enzyme activity still reached more than 75%, T m The values ​​increased from 55.1℃ of the wild enzyme to 74.1℃, and the optimum temperature of the mutant enzyme increased to 80℃, which was 20℃ higher than that of the wild enzyme.

[0021] (2) The substrate affinity and conversion efficiency of the enzyme for D-fructose, the substrate used to synthesize D-psicose, were improved. When the substrate concentration was 100 g / L and the reaction temperature was 70°C, the enzyme activity of the wild-type D-psicose converting enzyme reached 223.5 U / (g·wetcell weight) and the conversion rate reached 29.2%. The enzyme activity of the D-psicose converting enzyme mutant reached 557.1 / (g·wetcell weight) and the conversion rate reached 31.7%.

[0022] (3) The present invention improves the problem of the short half-life of the wild enzyme at high temperature by mutation. The mutant enzyme has a relatively long action time, which expands the relatively scarce enzyme library. It demonstrates the technical advantages of D-fructose in the synthesis of D-psicose converting enzyme, which is green and environmentally friendly, low in toxicity, and has few by-products. It overcomes the problem of chemical synthesis method that is prone to produce three wastes, and has important industrial application prospects. (IV) Description of the drawings

[0023] Figure 1 It is the SDS-PAGE electrophoresis diagram in Example 5; Lane M: Marker, Lane 1: CbDAE crude enzyme solution, Lane 2: CbDAE pure enzyme solution, Lane 3: CbDAE / A13S / D100N / V235I / I242V crude enzyme solution, Lane 4: CbDAE / A13S / D100N / V235I / I242V pure enzyme solution.

[0024] Figure 2 This is a comparison chart of the thermal stability of mutant enzymes at 70°C.

[0025] Figure 3 It is the optimal reaction temperature of the mutant enzyme CbDAE / A13S / V235I / D100N / I242V.

[0026] Figure 4 The mutant enzyme CbDAE / A13S / V235I / D100N / I242V is pure m picture.

[0027] Figure 5is the conversion rate of the mutant enzyme CbDAE / A13S / V235I / D100N / I242V at different substrate concentrations.

[0028] Figure 6 This is the result of the production of D-psicose by the mutant enzyme CbDAE / A13S / V235I / D100N / I242V and GI double enzyme catalysis. (V) Specific implementation methods

[0029] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0030] Example 1: Construction of a single-site mutant library of D-psicose converting enzyme

[0031] (1) Construction of wild-type CbDAE recombinant bacteria

[0032] The gene sequence of the wild-type enzyme CbDAE from Christensenellaceae bacterium (GenBank No.: MBQ9941839.1) in Genbank was artificially synthesized (the nucleotide sequence is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2), ligated between the NcoI and XhoI sites of the vector pET28a, and transformed into E. coli BL21 (DE3), and the wild-type recombinant bacteria E. coli BL21 (DE3) / pET-28a-CbDAE were constructed using the method of step (2).

[0033] SEQ ID NO.2

[0034] MKHGIYYAYWEQAWA AD YLYYVDKVAKLGFDILE IG ATPLPEYDQKTIAQLRDCAKG NGIELTAGYGPAPQHN VG STDPAVQKGALEWYTRLFKVM DQLDIRWIGGALYLYW PV DYSVPVNKEADFASAVAGMKK LGAI AA DY GID LGMEIL NR FENYLLNTAKEGVEFVEQVGL PNVKVMLDTFHMNIEE ES IGGAIRTAGKHLGHLHTGECN RMVPGKGRTPWKEIGE AL KEVGYDGRVIMEPFVRMGGQV GQDVKVWRDLSCGADE AK LDQDAKEALIFQRYMLG.

[0035] (2) Construction of single-site mutation library

[0036] Primers for site-directed mutagenesis were designed based on the gene sequence of the wild-type enzyme CbDAE (nucleotide sequence is SEQ ID NO.1). Rapid PCR technology was used to introduce single mutations into the 13th and 235th amino acids using the recombinant vector pET28a / CbDAE as a template.

[0037] Forward primer A13S: CCTACTGGGAACAG AGC TGGGCCGCCGACTA (underlined bases are mutated)

[0038] Reverse primer A13S: ACAGGTAGTCGGCGGCCCA GCT CTGTTCC (underlined mutated bases)

[0039] Forward primer V235I:GAAAGAA ATT GGTTACGATGGCCGTGTGATCA (the underlined base is the mutant base),

[0040] Reverse primer V235I:GGCCATCGTAACCA ATT TCTTTCAGTGCTTCACCAAT (the mutated base is underlined).

[0041] The PCR reaction system (50 μL) was: 2×Phanta Max Buffer 25 μL, dNTPs 1 μL, forward primer 2 μL (5 pmol / μL), reverse primer 2 μL (5 pmol / μL), template DNA 1 μL (20 ng / μL), Phanta Max Super-Fidelity DNA Polymerase 1 μL, and ddH2O was added to 50 μL.

[0042] The PCR reaction program is: pre-denaturation at 95°C for 5 minutes; 30 cycles (denaturation at 95°C for 10 seconds, annealing at 55-60°C for 15 seconds, extension at 72°C for 5.5 minutes); extension at 72°C for 10 minutes, and finally insulation at 16°C. The PCR product was verified by 0.9% agarose gel electrophoresis. The result showed that the gene fragment consistent with the size of the target vector was amplified, and the next step of the experiment could be carried out.

[0043] After the PCR product was digested by DpnI at 37℃ for 3h, 3μL of the PCR product was taken and added to 100μL of E.coliBL21 (DE3) competent cell suspension in an ice bath, and then placed on ice for 30min. The transformation product was heat-shocked at 42℃ for 90s, and then quickly placed on ice for 5min. 600μL of LB liquid culture medium was added to the tube, and cultured at 37℃ and 150r / min for 50min, centrifuged at 12000r / min for 1min, 400μL of supernatant was discarded, and then the bacterial pellet was resuspended. 100μL of the above resuspension was applied to an LB solid culture medium plate containing a final concentration of 50μg / mL kanamycin resistance. After the bacterial solution was completely absorbed by the culture medium, it was inverted and cultured at 37℃ for 12h. The colony was picked and inoculated in 10mL LB liquid culture medium containing a final concentration of 50μg / mL kanamycin resistance, and cultured at 37℃ for 12h to obtain the respective bacterial solutions.

[0044] (3) Screening of single-site mutants

[0045] The bacterial solution in step (2) was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing and the sequencing results were aligned correctly, obtaining single-site mutant recombinant bacteria E. coli BL21 (DE3) / pET28a / CbDAE / A13S and E. coli BL21 (DE3) / pET28a / CbDAE / V235I, and the corresponding enzymes were recorded as mutant enzymes CbDAE / A13S and CbDAE / V235I.

[0046] The wet cells were prepared by the method of Example 5, and the enzyme activity was measured by the method of Example 6. The results are shown in Table 1.

[0047] Example 2: Construction of a double-site mutant of D-psicose converting enzyme

[0048] The recombinant vector pET28a / CbDAE / A13S in Example 1 was used as a template, and the primers in Example 1 (forward and reverse V235I) were used to introduce a single mutation at position 235. The other operations were the same as in Example 1 to obtain a double-site mutant recombinant bacterium E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I, and the corresponding enzyme was recorded as mutant enzyme CbDAE / A13S / V235I.

[0049] Example 3: Construction of three-site mutants of D-psicose converting enzyme

[0050] Using the recombinant vector pET28a / CbDAE / A13S / V235I in Example 2 as a template, single mutations were introduced at positions 49, 54, 100, and 242, and other operations were the same as in Example 1 to obtain the following three-point mutant recombinant bacteria:

[0051] E.coli BL21(DE3) / pET28a / CbDAE / A13S / V235I / A49M (the corresponding enzyme is recorded as CbDAE / A13S / V235I / A49M),

[0052] E.coli BL21(DE3) / pET28a / CbDAE / A13S / V235I / C54M (the corresponding enzyme is CbDAE / A13S / V235I / C54M),

[0053] E.coli BL21(DE3) / pET28a / CbDAE / A13S / V235I / D100N (the corresponding enzyme is CbDAE / A13S / V235I / D100N),

[0054] E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I / I242V (the corresponding enzyme is CbDAE / A13S / V235I / I242V).

[0055] Mutation Primers:

[0056] Forward primer A49M:CGCAGCTGCATA ATG GTTTTCTGATCA (underlined is the mutant base),

[0057] Reverse primer A49M:AAACCATT ATGCAGCTGCGTGATTGTG (the mutated base is underlined).

[0058] Forward primer C54M:TGCGTGAT ATG GCAAAAGGCA ATG GGATTG (underlined is the mutant base),

[0059] Reverse primer C54M: CTTTTGCCATATCACGCAGCTGCGCAAT (the mutant base is underlined).

[0060] Forward primer D100N:CCAGCTG AAT ATTCGTTGGATTGGGGG (the underlined base is the mutant base),

[0061] Reverse primer D100N: GTTATGGACCAGCTG AAT ATTCGTTGG (the mutated base is underlined).

[0062] Forward primer I242V:GCCGTGTG GTG ATGGAACCGTTTGTTCGTA (underlined is the mutant base),

[0063] Reverse primer I242V:TGGTTACGATGGCCGTGTG GTG ATGGAACC (the mutated base is underlined).

[0064] The wet cells were prepared by the method of Example 5, and the enzyme activity was measured by the method of Example 6. The results are shown in Table 1. E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I / D100N was selected as the dominant mutant.

[0065] Example 4: Construction of a four-site mutant of D-psicose converting enzyme

[0066] The recombinant vector pET28a / CbDAE / A13S / V235I / D100N in Example 3 was used as a template, single mutations were introduced into positions 49 and 242, and other operations were the same as in Example 1 to obtain a four-site mutant recombinant bacterium E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I / D100N / A49M (the corresponding enzyme was recorded as mutant enzyme CbDAE / A13S / V235I / D100N / A49M).

[0067] E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I / D100N / I242V (the corresponding enzyme is recorded as mutant enzyme CbDAE / A13S / V235I / D100N / I242V).

[0068] Mutation Primers:

[0069] Forward primer A49M:CGCAGCTGCATA ATG GTTTTCTGATCA (underlined is the mutant base),

[0070] Reverse primer A49M:AAACCATT ATG CAGCTGCGTGATTGTG (the mutated base is underlined).

[0071] Forward primer I242V:GCCGTGTG GTG ATGGAACCGTTTGTTCGTA (underlined is the mutant base),

[0072] Reverse primer I242V:TGGTTACGATGGCCGTGTG GTG ATGGAACC (underlined mutated bases). The wet cells were prepared by the method of Example 5, and the enzyme activity was measured by the method of Example 6. The results are shown in Table 1. E. coli BL21 (DE3) / pET28a / CbDAE / A13S / V235I / D100N / I242V was selected as the dominant mutant.

[0073] Example 5: Expression of recombinant Escherichia coli

[0074] (1) The recombinant bacteria selected in Examples 1-4 were inoculated into 10 mL of LB liquid culture medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37°C and 200 r / min until OD 600 =0.8-1.0, to obtain seed solution; the seed solution was transferred into a fresh 100 mL LB liquid medium containing a final concentration of 50 μg / mL kanamycin at a volume concentration of 1%, and cultured at 37°C and 180 r / min until the bacterial concentration OD 600 =0.6-0.8, add IPTG at a final concentration of 0.1 mM, then induce and culture at 28°C and 180 r / min for 12 h, centrifuge at 4°C and 8000 r / min for 10 min, and collect the wet cells.

[0075] (2) Suspend 1 g of wet bacterial cells in 10 mL of 50 mM Tris-HCl (pH 9.0) buffer, ultrasonically disrupt the cells at 120 W for 20 min, sonicate for 1 second, pause for 2 seconds, and centrifuge at 4°C and 8000 r / min for 10 min. Collect the supernatant to obtain the crude enzyme solution.

[0076] (3) The crude enzyme solution was purified using a nickel-NTA affinity chromatography column (Bio-Scale MiniProfinity IMAC prepacked column, 40 mm length × 12.6 mm inner diameter). The column was first equilibrated with an equilibration buffer (50 mM PB buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0). The crude enzyme solution was loaded at a rate of 1 mL / min for 4 column volumes, and then eluted with an eluent (50 mM PB buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a rate of 2 mL / min. The solution was monitored using an ultraviolet detector and a conductivity detector. When the signals of the ultraviolet detector and the conductivity detector increased simultaneously, the corresponding effluent was collected. When the conductivity detector signal remained unchanged and the ultraviolet detector signal decreased, the collection was stopped. The pure enzyme solution was collected and the protein concentration of the pure enzyme solution was tested using a BCA kit.

[0077] (4) The collected pure enzyme solution was dialyzed in ultrapure water (pH 7.0) at 4°C overnight. The molecular weight cutoff of the dialysis bag was 10 kDa. 15 μL of the dialyzed pure enzyme solution was added with 5 μL of 4X SDS buffer and mixed. The mixture was heated in a boiling water bath for 15 min. 8 μL was taken for SDS-PAGE electrophoresis analysis. Figure 1 ), and a protein band with a molecular weight of about 33 kDa was obtained, indicating that the target protein was successfully expressed.

[0078] Example 6: Determination of enzyme activity of D-psicose converting enzyme mutants

[0079] The wild-type enzyme CbDAE and mutant enzyme constructed in Examples 1-4 were prepared into wet cells according to the method in Example 5, and the enzyme activities were measured.

[0080] The enzyme activity determination method is as follows: 0.25 g of wet bacteria is added to 10 mL of 50 mM sodium phosphate buffer solution (pH 6.5), the suspended bacteria are fully mixed, a final concentration of 1 mM CoCl2 and a final concentration of 100 g / L of D-fructose are added, the reaction is carried out at 70°C and 1000 rpm for 10 min, 1 mL of the sample is taken, the reaction is terminated by placing on ice for 10 min, and the supernatant is taken and diluted 10 times with ultrapure water. After filtering through a 0.22 μm water membrane, the concentrations of D-fructose and D-psicose are detected by HPLC liquid chromatograph.

[0081] HPLC detection conditions: Agilent 1260HPLC chromatograph, Agilent autosampler, sugar-park chromatographic column, Agilent differential detector, ultrapure water as mobile phase, column temperature set to 80°C, flow rate of 0.4 mL / min, external standard method, the yield of D-psicose was determined according to the retention time and peak area of ​​the peak, the retention time of D-fructose was 13.4 min, and the retention time of D-psicose was 20.18 min.

[0082] Definition of enzyme activity unit: At 70°C and pH 6.5, the amount of enzyme required to isomerize D-fructose to produce 1 μmol D-psicose per minute is defined as one enzyme activity unit (U). The specific enzyme activity of D-psicose converting enzyme is expressed as enzyme activity units per gram of wet cell weight (U / g·wet cell weight). The results are shown in Table 1. The enzyme activity of the recombinant D-psicose converting enzyme four-site mutant CbDAE / A13S / D100N / V235I / I242V is 2.50 times that of the wild-type D-psicose converting enzyme, reaching 557.1U / (g·wet cell weight).

[0083] Table 1: Enzyme activities of D-psicose converting enzyme and its mutants

[0084]

[0085] Example 7: Determination of thermal stability of D-psicose converting enzyme and its mutants

[0086] The mutant enzymes CbDAE / A13S / V235I, CbDAE / A13S / V235I / A49M, CbDAE / A13S / V235I / D100N, CbDAE / A13S / V235I / I242V, CbDAE / A13S / V235I / D100N / A49M, and CbDAE / A13S / V235I / D100N / I242V constructed in Examples 1-4 were used as conversion enzymes in the form of pure enzyme solutions prepared according to the method of Example 5.

[0087] Reaction system: 50mM PB buffer (pH6.5), final concentration 1mM CoCl2, final concentration 100g / L D-fructose and final concentration 0.03mg / mL (based on protein content) pure enzyme solution, a total of 1mL system. Reaction conditions: 70℃ metal bath at 1000r / min for 24h, during which samples were taken at 1h, 2h, 4h, 6h, 8h, 10h, 12h, 16h, 20h and 24h, respectively, the reaction was terminated in an ice bath, centrifuged at 12000r / min, the supernatant was diluted 10 times with ultrapure water, filtered through a 0.22μm water membrane, and the filtrate was tested for the concentrations of D-fructose and D-psicose by the method in Example 6 and the residual enzyme activity was calculated. The results are shown in Figure 2 .

[0088] The results showed that the residual enzyme activity of the mutant CbDAE / A13S / V235 / D100N / I242V was still above 75% after incubation at 70°C for 24 hours. It can be found that the thermal stability of the mutant CbDAE / A13S / V235 / D100N / I242V was significantly improved.

[0089] Example 8: Determination of the optimal reaction temperature of the wild-type enzyme CbDAE and the mutant enzyme CbDAE / A13S / V235I / D100N / I242V

[0090] The wild-type enzyme CbDAE constructed in Examples 1-4 and the mutant enzyme CbDAE / A13S / V235I / D100N / I242V were used as pure enzymes prepared according to the method of Example 5, and the optimal reaction temperature of the enzyme was determined.

[0091] Reaction system: D-fructose with a final concentration of 100 g / L and pure enzyme solution with a final concentration of 0.03 mg / mL (based on protein content), a final concentration of 1 mM CoCl2, and then 50 mM pB (pH 6.5) buffer was added to a total system of 1 mL. The enzyme activity was detected at different temperatures (55, 60, 65, 70, 75, 80, 85°C) using the method of Example 6. The results are shown in Table 6. Figure 3 As shown in the figure, the optimal reaction temperatures of the wild-type enzyme CbDAE and the mutant enzyme CbDAE / A13S / V235 / D100N / I242V are 60°C and 80°C, respectively, which increases their optimal temperatures by 20°C and makes them more heat-resistant.

[0092] Example 9: Determination of Tm value of D-psicose converting enzyme and its mutants

[0093] The wild-type enzyme CbDAE constructed in Examples 1 and 4 and the mutant enzyme CbDAE / A13S / V235I / D100N / I242V were prepared in accordance with the method of Example 5, and the Tm values ​​were measured by circular dichroism spectrometer. The results are as follows: Figure 4 As shown, the Tm value of the mutant enzyme CbDAE / A13S / D100N / V235I / I242V increased from 55.1°C of the wild enzyme CbDAE to 74.2°C.

[0094] Example 10: Determination of Conversion Rate of D-psicose Converting Enzyme at Different Substrate Concentrations

[0095] The mutant enzyme CbDAE / A13S / D100N / V235I / I242V constructed in Example 4 was used as the pure enzyme solution prepared according to the method of Example 5 as the conversion enzyme.

[0096] Reaction system: 50mM PB buffer (pH6.5), final concentration of 100g / L D-fructose and final concentration of 0.03mg / mL (based on protein content) pure enzyme solution, final concentration of 1mM CoCl2, total 1mL system. Reaction conditions: 1000r / min reaction for 3h in a 70℃ water bath, ice bath to terminate the reaction, centrifuge at 12000r / min, dilute the supernatant 10 times with ultrapure water, filter through 0.22μm water membrane, and use the method in Example 6 to detect the concentration of D-fructose and D-allulose in the filtrate. The results are shown in Figure 5 As the substrate concentration increases, the conversion rate does not decrease, there is no substrate inhibition, and the conversion rate reaches 31%, which is suitable for production applications with high substrate concentrations.

[0097] Example 11: Application of D-psicose invertase and glucose isomerase (GI) dual enzyme coupling catalysis in the synthesis of D-psicose

[0098] The mutant enzyme CbDAE / A13S / D100N / V235I / I242V constructed in Example 4 was used as the enzyme source by preparing the pure enzyme solution according to the method of Example 5. Glucose isomerase (amino acid sequence as shown in SEQ ID NO. 5) was constructed as a recombinant bacterium according to Example 1, and the pure enzyme solution was prepared according to Example 5 as a coenzyme.

[0099] Reaction system: 50mM PB buffer (pH6.5), final concentration of 100g / L D-glucose and final concentration of 0.03mg / mL (based on protein content) enzyme source, final concentration of 0.03mg / mL (based on protein content) coenzyme, final concentration of 1mM CoCl2, a total of 10mL system. Reaction conditions: 80℃ water bath at 1000r / min for 5h, during which samples were taken at 10min, 30min, 60min, 120min, 180min, 240min and 300min, respectively, the reaction was terminated in an ice bath, centrifuged at 12000r / min, diluted 10 times with ultrapure water, filtered through a 0.22μm water membrane, and the filtrate was tested for the concentrations of D-fructose, D-glucose and D-allulose by the method in Example 6. The results are shown in Figure 6 The formation of D-psicose reached reaction equilibrium at 180 min, at which time the contents of each sugar were D-glucose (44.5%), D-fructose (35.8%), and D-psicose (19.7%). Combined glucose isomerase can use cheap D-glucose as a substrate, reduce production costs, and is more suitable for industrial applications.

Claims

1. A D-psicose converting enzyme mutant, characterized in that: The mutant is obtained by performing single mutation or multiple mutation at positions 13, 49, 54, 100, 235 and 242 of the amino acid sequence shown in SEQ ID NO.

2.

2. The mutant according to claim 1, characterized in that The mutant is a mutant in which the amino acid sequence shown in SEQ ID NO.2 is mutated into one of the following: (1) the alanine at position 13 is mutated into serine; (2) the valine at position 235 is mutated into isoleucine; (3) the alanine at position 13 is mutated into serine, and the valine at position 235 is mutated into isoleucine; (4) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, and the aspartic acid at position 100 is mutated into asparagine; (5) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, and the isoleucine at position 242 is mutated into valine; (6) the alanine at position 13 is mutated into serine, the valine at position 235 is mutated into isoleucine, the aspartic acid at position 100 is mutated into asparagine, and the isoleucine at position 242 is mutated into valine.

3. A recombinant bacterium containing a gene encoding the D-psicose converting enzyme mutant according to claim 1.

4. Use of the D-psicose converting enzyme mutant according to claim 1 in preparing D-psicose by microbial catalytic D-fructose isomerization.

5. The use according to claim 4, characterized in that The application is: using wet bacteria obtained by fermentation culture of recombinant bacteria containing a D-psicose converting enzyme mutant encoding gene or pure enzyme liquid obtained by ultrasonic crushing of wet bacteria as an enzyme source, using D-fructose as a substrate, using cobalt ions as a catalyst, and using a buffer solution with a pH of 6.0-8.0 as a reaction medium to form a reaction system, reacting at 50-80° C. and 100-200 r / min, and obtaining D-psicose after the reaction is complete.

6. The use according to claim 5, characterized in that In the reaction system, the amount of wet bacteria is 10-70 g / L, the amount of pure enzyme solution based on protein content is 0.01-0.5 mg / mL; the final concentration of cobalt ions is 0.1-10 mM; and the initial concentration of substrate is 50-500 g / L.

7. The use according to claim 5, characterized in that The wet bacterial cells were prepared as follows: the recombinant bacteria containing the D-psicose converting enzyme mutant encoding gene were inoculated into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL, and cultured at 37°C and 200 r / min until the OD 600 =0.8~1.0, obtain seed solution; the seed solution is transferred into LB liquid medium containing kanamycin at a final concentration of 50 μg / mL at a volume concentration of 1~5%, and cultured at 37℃ and 180r / min until OD 600 =0.6-0.8, add IPTG with a final concentration of 0.1 mM, induce culture at 28°C, 180 r / min for 12-14 h, centrifuge and collect wet cells.

8. The use according to claim 5, characterized in that The pure enzyme solution is prepared as follows: 1 g of wet bacteria is suspended in 10 mL of pH 9.0, 50 mM Tris-HCl buffer, ultrasonically disrupted at 120 W for 20 min, ultrasonicated for 1 s, paused for 2 s, centrifuged at 4° C. and 8000 r / min for 10 min, and the supernatant is collected to obtain a crude enzyme solution; the crude enzyme solution is purified using a nickel-NTA affinity chromatography column, the chromatography column is first equilibrated with an equilibrium buffer, the crude enzyme solution is loaded at a speed of 1 mL / min for 4 column volumes, and then eluted with an eluent at a speed of 2 mL / min, and monitored by an ultraviolet detector and a conductivity detector, and the corresponding effluent is collected when the signal of the ultraviolet detector and the signal of the conductivity detector rise at the same time, and the collection is stopped when the signal of the conductivity detector remains unchanged and the signal of the ultraviolet detector decreases, to obtain a pure enzyme solution; the equilibrium buffer: 50 mM PB buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0; Eluent: 50 mM PB buffer, 300 mM NaCl, 500 mM imidazole, pH 8.

0.

9. The use according to claim 4, characterized in that The application is carried out according to the following steps: wet bacteria obtained by fermentation and culture of recombinant bacteria containing a D-psicose converting enzyme mutant encoding gene or pure enzyme liquid obtained by ultrasonic crushing of wet bacteria is used as an enzyme source, pure enzyme liquid obtained by fermentation and culture of glucose isomerase recombinant bacteria is used as a coenzyme, D-glucose is used as a substrate, cobalt ions are used as a catalyst, and a buffer solution with a pH of 6.0-8.0 is used as a reaction medium to form a conversion system, reacting at 50-80° C. and 100-200 r / min, and obtaining D-psicose after the reaction is complete; the amino acid sequence of the glucose isomerase is shown in SEQ ID NO.

5.

10. The use according to claim 9, characterized in that In the conversion system, the amount of coenzyme added is 0.01-0.5 mg / mL based on protein content; the enzyme source is 10-70 g / L based on wet bacterial weight; the amount of enzyme source is 0.01-0.5 mg / mL based on protein content; the final concentration of cobalt ions is 0.1-10 mM; and the initial concentration of substrate is 50-500 g / L.

Images