Asymmetric RPA (recombinase polymerase amplification) and MNAzyme combined rapid detection method

Abstract

The invention belongs to the field of biological detection, and in particular relates to an RPA-MNAzyme detection method, namely, an asymmetric RPA (aRPA) and MNAzyme combined rapid detection method (OAR-MNA). The OAR-MNA rapid detection method is used for DNA detection. A reaction system is composed of an RPA component A, an RPA component B and an MNAzyme component. The method can be used for plant detection and can also be used for bacterial detection. The method disclosed by the invention is high in specificity, and the target sequence is identified through RPA amplification and MNAzyme dual identification.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and specifically relates to an RPA-MNAzyme detection method, that is, a rapid detection method (OAR-MNA) combining asymmetric RPA (asymmetric RPA, aRPA) and MNAzyme. Background Art

[0002] As an important part of the life science field, nucleic acid detection is widely used in the detection of plant, animal and microbial DNA. Among them, polymerase chain reaction (PCR) has become a promising strategy for effective, quantitative and simultaneous detection of bacteria due to its high sensitivity and specificity (Garrido & Prado, 2022). However, PCR-based protocols usually require professional operation, expensive high-precision temperature cycling equipment, and a long reaction time (about 2 hours), which makes the diagnosis process more cumbersome (Hu et al., 2020). Due to these limitations, PCR is not suitable for the development of simple, rapid and portable on-site diagnostic technologies.

[0003] In response to these needs, isothermal amplification technologies have emerged, such as loop-mediated isothermal amplification (LAMP) and recombinant polymerase amplification (RPA). These technologies have gradually attracted attention due to their simple operation, rapidity, and cost-effectiveness. Among these methods, RPA has become a very suitable tool for point-of-care testing (POC) because it reacts in a relatively low and wide temperature range (25-42°C) and can usually complete the reaction within 20 minutes. However, the RPA technology itself has the problem of insufficient specificity, and the probes used in RPA usually require complex base modifications, which increases the cost of detection.

[0004] In recent years, another emerging amplification technology worthy of attention is multi-component nucleic acid enzyme (MNAzyme). This technology is derived from DNA enzyme and is widely used as an enzyme-free signal amplification tool for high-sensitivity nucleic acid detection. The typical MNAzyme structure relies on metal ions and consists of two partial enzymes (Partzyme A and Partzyme B). Each partial enzyme contains a substrate arm, a partial catalytic core, and an effector binding arm. The target nucleic acid acts as an assembly promoter to guide the two partial enzymes to bind to form an MNAzyme with a complete catalytic core. The enzyme achieves signal amplification by cutting nucleic acid substrate fragments. Therefore, MNAzyme is essentially a universal amplification tool with the advantages of high catalytic efficiency, simple operation, isothermal reaction and low cost (no catalytic enzyme required). By adjusting the substrate arm base pairing of Partzyme A and Partzyme B, MNAzyme can be customized according to different target sequences, so as to achieve the purpose of identifying different target sequences with the same probe. Since the MNAzyme probe is only one-third of the price of the RPA probe, the combination of RPA and MNAzyme methods can effectively reduce the high cost of RPA reactions. In addition, the combination of RPA and MNAzyme system can significantly improve the detection sensitivity and solve the problem of insufficient specificity.

[0005] However, the application of MNAzyme technology still faces certain challenges, mainly because it can only recognize specific single-stranded DNA / RNA targets, but cannot directly recognize double-stranded DNA. This makes the coupling of RPA and MNAzyme complicated. At present, MNAzyme technology is mainly used for the recognition of miRNA. In pathogen detection, MNAzyme detection of pathogens is often achieved through specific DNA aptamers that can recognize target pathogens. However, the process of screening aptamers from SELEX (systematic evolution of ligands by exponential enrichment) is complicated and time-consuming, which limits the widespread application of multi-component nucleases. In addition, some studies in the past obtained single-stranded sequences through denaturation reactions (such as thermal denaturation or chemical denaturation), avoiding the use of aptamers, but such methods increase the complexity of operations, improve instrument requirements, and increase the risk of aerosol contamination.

[0006] The following are examples and shortcomings of current MNAzyme and RPA detection alone or in combination:

[0007] 1. Abdou Mohamed, Hu et al. first used RPA to amplify the target fragment, then opened the lid to take out the nucleic acid and used alkali treatment to denature the double-stranded nucleic acid, and partially hybridized with the blocking strand, and used the exposed single strand to bind to the MNAzyme to amplify the signal. The disadvantage is that the opening operation increases the number of operation steps and is prone to aerosol contamination.

[0008] 2. After Fang uses aptamers to identify pathogens, it releases short chains to activate the RCA reaction, and the resulting repeated single chains combine with MNAzyme to amplify the signal. The disadvantage is that this method relies on specific aptamers, and the screening of aptamers is difficult, which limits the scope of application.

[0009] 3. Double-stranded DNA in various plants, animals and microorganisms can also be identified using only RPA reactions, but RPA technology requires the design of specific probes for each sample, and the probes are expensive. In contrast, MNAzyme can achieve universal probe detection by simply adjusting the base sequence of the substrate arm, greatly reducing costs.

[0010] 4. There are many methods to combine RPA with CRISPR / Cas system. However, compared with CRISPR / Cas system, MNAzyme does not need to purchase or synthesize Cas protein and gRNA guide chain, but only needs to synthesize DNA chain to achieve signal amplification, which significantly reduces the cost. Summary of the invention

[0011] The technical problem to be solved by the present invention is to provide an asymmetric RPA-MNAzyme (OAR-MNA) detection method without opening the cover.

[0012] In order to solve the above problems, the present invention provides a rapid detection method combining asymmetric RPA and MNAzyme (OAR-MNA):

[0013] Used for DNA testing, that is, for rapid testing of organisms such as microorganisms, animals and plants whose genetic material is DNA;

[0014] The reaction system consists of RPA component A, RPA component B and MNAzyme component;

[0015] RPA component A consisted of 6 μL rehydration A buffer containing dry powder of recombinase and polymerase, 0.4 μL forward primer RPA-SP (10 μM), 0.4 μL reverse primer RPA-AP (3.12×10 -2 μM) and 1.7 μL of double distilled water;

[0016] RPA component B consisted of 1 μL of template (sample to be tested) and 0.5 μL of B-buffer containing MgOAc;

[0017] The MNAzyme component is a 40 μL system, including 4 μL of 10x MNAzyme buffer, 250 nM partzyme A, 250 nM partzyme B, 500 nM MNAFQ-probe, and the balance is double distilled water.

[0018] The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube, and continue to incubate at 41°C for 15 minutes; then choose any of the following methods:

[0019] Method 1: After adding the MNAzyme components, the fluorescence value was recorded by quantitative PCR instrument during the incubation process at 41°C for 15 minutes;

[0020] Method 2: After the incubation process at 41°C for 15 minutes after the addition of the MNAzyme components, the endpoint signal is detected by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel.

[0021] Specifically, the following operations are performed:

[0022] Method 1: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, and then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, and then manually shake the tube to add the MNAzyme component to the bottom of the tube. At the same time, the fluorescence value is recorded by the quantitative PCR instrument every 37 seconds, and a total of 24 tests are performed. Since the machine needs extra time for each reading, it takes about 15 minutes to complete the reading;

[0023] Method 2: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, and then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. After the reaction is completed, place the reaction tube on ice and detect the endpoint signal by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel.

[0024] 10x MNAzyme buffer contains 50 mM HEPES, 200 mM MgCl2, 20 mM KCl, 120 mM NaCl, 1% v / v DMSO, and the balance is double distilled water.

[0025] The existing MNAzyme technology can only recognize single-stranded nucleic acids, and is currently mainly used for miRNA detection or relies on aptamer selection. However, the present invention uses asymmetric RPA (aRPA) technology to generate a large amount of single-stranded DNA using DNA or RNA as a template, and then activates the recognition and signal amplification of multi-component nucleases through single-stranded DNA, which greatly expands the application range of nucleases. This method does not require screening of target aptamers, does not require opening the cover, is easy to operate, has low cost, and can achieve dual-mode detection. This method has been verified in the detection of bacteria and genetically modified crops, indicating its potential for wide application in the detection of animals, plants, microorganisms and viruses.

[0026] The present invention also provides the following specific applications:

[0027] Specific application 1:

[0028] This method is used for bacterial detection (bacterial disease - bacterial fruit spot):

[0029] Forward primer RPA-SP-2: TCACCGGCGGCACGGTGCAGTTTCCTGCTT;

[0030] Reverse primer RPA-AP-1: CGCTCTGCGGTAGGGCGAAGAAACCAACAC

[0031] AC-P A(partzyme A):AAATTCATAGAGTCGAAACAACGAGATGAATACTT

[0032] AC-P B(partzyme B):ATCTGACGGAGGCTAGCTTCAGCGTTGCCGGCGG

[0033] MNA FQ-probe:

[0034] 6-FAM-CCACCACGAGTATTCATC / rG / / rU / CCGTCAGACGTGGTGG-BHQ1

[0035] The template was changed to double distilled water, and the volume remained unchanged at 1 μL, which served as a negative control.

[0036] Method 1: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and record the fluorescence value by a quantitative PCR instrument every 37 seconds, for a total of 24 times (a total of 15 minutes);

[0037] The 95% confidence interval (mean+3SD) of the mean fluorescence value of 60 randomly selected negative controls at the endpoint was named the positive judgment line;

[0038] When the fluorescence values ​​on the real-time curve of the fluorescence reaction all exceed the positive judgment line, the sample to be tested is judged to be positive (that is, the sample to be tested contains Acidophilus melonensis); otherwise, the sample to be tested is judged to be negative.

[0039] Method 2: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, and then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. After the reaction is completed, place the reaction tube on ice, and detect the endpoint signal by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel. If the fluorescence of the sample to be tested can be observed and distinguished from the negative control, it is judged to be positive.

[0040] MNAzyme only recognizes single-stranded nucleic acids. Therefore, the present invention is based on the principle of asymmetric RPA, that is, changing the ratio of forward and reverse primer concentrations to produce a large amount of single-stranded DNA. It is a promising method to use single-stranded DNA to activate MNAzyme recognition and signal amplification. This method does not require opening the lid for detection, is easy to operate, has low cost, and can achieve dual-mode detection ( Figure 1 ).

[0041] The method of the present invention can detect 20 copies / μL of watermelon acidophilic bacteria DNA within 45 minutes. In addition, the present invention was verified by testing 22 watermelon seed samples and obtained consistent results with the qPCR method. The specificity of the detection method of the present invention was confirmed by testing five common pathogens in watermelon seeds.

[0042] The specific contents of the present invention are as follows:

[0043] 1.1) Preparation of pathogen culture and DNA extraction

[0044] The present invention uses the standard strain of watermelon acidophilus Acidovorax citrulli (ATCC 29625) and four other common melon pathogens, including two common bacteria, Pseudomonas lachrymans and Xanthomonascucurbita, and two common fungi, Fusarium solani and Fusarium oxysporum. Watermelon acidophilus was cultured on nutrient agar Nutrient Broth, while P. lachrymans and X. cucurbita were cultured on LB agar. F. solani and F. oxysporum were cultured on potato dextrose agar. The genomic DNA of the bacteria was extracted using the TIANamp bacterial DNA kit (Tiangen, Beijing, China), while the fungal genome was extracted using the SIMGEN plant DNA reagent box (SIMGEN, Hangzhou, China).

[0045] 1.2) Design of species-specific primers for Acidophilus citrinum

[0046] Using the Acidophilus citrullus genome as a template, a 344 bp PCR product was amplified using SEQ ID 1 and SEQ ID 5 (as described in Table 1), and the 344 bp amplified fragment was purified and cloned into the pBM23 vector (TransGen, Shanghai, China), and named Plasmid-T as a template plasmid for subsequent use. RPA primers were designed using Primer Premier 5 software. The design principle of RPA primers is that the length is between 30-35 nt and the expected amplification size is less than 500 bp. The specificity of the primers was evaluated using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). At the same time, partzyme A and partzyme B were designed according to the RPA primer positions. The individual specificity of the designed partzyme A and partzyme B was tested using local BLASTn. All synthetic nucleic acids used in the present invention were synthesized by Sangon (Shanghai, China), as shown in Table 1.

[0047] Table 1. Primer sequences, probe sequences and target sequence information designed in the present invention

[0048]

[0049] 1.3) Feasibility analysis of polyacrylamide gel electrophoresis detection

[0050] In order to verify the cleavage ability of MNAzyme, the total volume loaded into each well was 10 μL, and the components and concentrations loaded into each lane were shown in Table 2.

[0051] Table 2 Figure 2 The components and concentrations of each lane in

[0052]

[0053]

[0054] Description: 500nMAC-ssDNA, the single-stranded product of aRPA was synthesized by ourselves for testing and feasibility analysis.

[0055] Next, the feasibility of OAR-MNA was further studied. The present invention performed gel electrophoresis analysis on various samples, and the components and concentrations of each lane are shown in Table 3. The RPA reaction was performed according to the instructions provided by the Universal Isothermal Amplification Kit Specification (Anpu Future, Shandong, China). Rehydration A buffer containing recombinase and polymerase and 2.5 μL of B-buffer containing MgOAc were purchased from Anpu Future (Shandong, China). Each reaction contained 29.4 μL of rehydration A buffer containing dry powder of recombinase and polymerase, 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 2 μL of 0.9 μM Plasmid-T, 2.5 μL of B-buffer containing MgOAc and 12.1 μL of DEPC water. For asymmetric RPA, except for the RPA forward and reverse primers (forward primer AC-SP-2: reverse primer AC-AP-1) concentrations set to 10,000nM:31.25nM, the other concentrations remained the same. The reaction temperature was 40°C and the reaction time was 30 minutes. In lanes 5-8 of Table 3, 10μL of RPA or aRPA amplified fragments were added to 40μL of reaction solution containing MNAzyme components and incubated at 40°C for 15 minutes. In 1×TBE running buffer (89mM triborate, 2mM ethylenediaminetetraacetic acid, pH 8.3), the products of MNAzyme and aRPA-MNAzyme systems were analyzed by 15% PAGE at a constant voltage of 120V for 40 minutes. Subsequently, the gel was stained with GelRed for 20 minutes and imaged using a gel imaging system.

[0056] Table 3 Figure 3 The components and concentrations of each lane in B

[0057] 1 2 3 4 5 6 7 8 500nMAC-PA / B + + + + + 1250nM MNA FQ-probe + + + RPA Products + + + aRPA products + + + <![CDATA[200nM MgCl2]]> + + + +

[0058] Figure 2The first four lanes mainly show the depth and position of the bands of the four single components AC-PA, AC-PB, MNAFQ-probe, and AC-ssDNA. Lanes 5, 6, and 7 are all reaction systems lacking single components. The analysis results show that in the presence of all components (lane 8), compared with lane 6, the AC-ssDNA band is reduced, and a new band appears below Ac-PB, indicating that the MNAzyme has undergone conformational rearrangement and the probe has been cleaved ( Figure 2 ). In addition, comparison between lanes 7 and 8 also confirms the importance of the magnesium cofactor in facilitating MNAzyme detection.

[0059] To elucidate the mechanism of action between RPA products and MNAzyme, AC-ssDNA was replaced by RPA amplicon and aRPA amplicon. Figure 3 A shows that in theory, the ssDNA amplicon, rather than the dsDNA amplicon, is essential for the reconfiguration of the MNAzyme catalytic core, allowing the MNAzyme to continuously cleave the MNAFQ-probe. Next, we experimentally confirmed the intrinsic mechanism of RPA and MNAzyme. Figure 3 The first four lanes of B mainly show the band depth and band position of the four components of AC-P A / B, MNA FQ-probe, RPA product, and aRPA product. By comparing lanes 5 and 6, it was found that the addition of RPA amplicon could not lead to the cleavage of the probe because the brightness of the RPA amplicon band remained unchanged. By comparing lanes 7 and 8, it was found that the reaction of aRPA product with MNAzyme caused the aRPA band to weaken and generate new bands, indicating that aRPA caused MNAzyme conformational rearrangement and probe cleavage, confirming the ability of aRPA to catalyze MNAzyme activity ( Figure 3 B). At the same time, the results of fluorescence kinetic analysis showed that only the aRPA amplicon showed a positive signal ( Figure 3 C). Therefore, the above results demonstrate the feasibility of combined detection of aRPA and MNAzyme and show the potential of the developed biosensor as a tool for application detection.

[0060] 1.4) Optimization of OAR-MNA reaction system

[0061] The reaction system consists of RPA component A, RPA component B and MNAzyme component;

[0062] RPA component A consisted of 6 μL rehydration A buffer containing dry powder of recombinase and polymerase, 0.4 μL forward primer RPA-SP (10 μM), 0.4 μL reverse primer RPA-AP (3.12×10 -2μM) and 1.7 μL of double distilled water; RPA component B consists of 1 μL of template (sample to be tested) and 0.5 μL of B-buffer containing MgOAc;

[0063] The MNAzyme component is a 40 μL system, including 10x MNAzyme buffer, 250 nM partzyme A (AC-PA), 250 nM partzyme B (AC-PB), 500 nM MNA FQ-probe; the remainder is double distilled water.

[0064] The reaction system is to add RPA component A to the bottom of the reaction tube, add MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. MNAzyme buffer contains 50mM HEPES, 200mM MgCl2, 20mM KCl, 120mM NaCl, 1% v / v DMSO (DMSO). The detection was performed on the Bio-Rad CFX96 real-time PCR detection system, and the fluorescence value was recorded every 37 seconds for a total of 24 times to make a fluorescence curve. Each experiment was repeated three times, and the endpoint fluorescence values ​​of the three repetitions were used to make a bar graph. At the same time, the reaction tube was imaged using the Bio-Rad ChemiDoc MP imaging system with a built-in UV channel.

[0065] The present invention optimizes the reaction temperature, MNA FQ-probe concentration, AC-P A / B concentration, magnesium ion concentration, RPA forward and reverse primer ratio, and aRPA / MNAzyme volume ratio. And the optimal conditions are determined according to the final fluorescence intensity and the F / F0 ratio. First, the MNAzyme reaction experiment was carried out at different temperatures of 37 to 42°C to determine the appropriate temperature. Since the ion concentration is very important for the ribozyme reaction, the magnesium ion concentration was optimized. The optimal concentration of magnesium ions was determined by testing six concentration gradients of 0, 50, 100, 200, 400 and 800 nM. Next, the ratio of the aRPA / MNAzyme system was optimized, and the aRPA / MNAzyme ratio was set to 1:4, 1:2 and 1:1. Then, the ratio of RPA forward and reverse primers was optimized, and the ratio of RPA forward and reverse primers was set to 10,000:250, 10,000:125, 10,000:62.5, and 10,000:31.25, respectively. Finally, the concentrations of AC-P A / B and MNA FQ-probe were optimized, and the concentration optimization of AC-P A / B and MNA FQ-probe was evaluated using four concentration gradients: 125, 250, 500, and 1000 nM.

[0066] In order to evaluate the optimal reaction temperature range, the reaction tubes were first incubated at different temperatures. When the reaction temperature was set to 41°C, the present invention observed a higher fluorescence signal and the F / F0 ratio was also the highest ( Figure 4 A). Therefore, 41°C was selected as the optimal temperature. Next, the present invention optimized the concentration of magnesium ions. The present invention tested the effect of magnesium ion concentration on the fluorescence signal by testing six different concentrations from 0 to 800 nM. Among these concentrations, 200 nM produced the highest detectable fluorescence signal and the highest F / F0 ratio ( Figure 4 B). Therefore, the present invention selected a magnesium concentration of 200 nM for further experiments. Next, the present invention optimized the ratio of the aRPA / MNAzyme system. When the ratio of the aRPA / MNAzyme system was 1:4, the fluorescence signal was the strongest and the F / F0 ratio was the highest. Therefore, the ratio of the aRPA / MNAzyme system was selected to be 1:4 ( Figure 4 C). Then, the present invention optimizes the ratio of RPA forward and reverse primers. When the ratio of RPA forward and reverse primers is 10,000:31.25, the fluorescence signal is the strongest and the F / F0 ratio is the highest. Therefore, the ratio of aRPA bidirectional primers is selected to be 1:320 ( Figure 4 D). Finally, the present invention optimizes the concentration of AC-P A / B and the concentration of MNA FQ-probe. The results show that when the concentration of AC-P A / B is set to 250 nM, the fluorescence signal is the strongest ( Figure 4 E). The concentration of MNA FQ-probe is positively correlated with the accumulation of fluorescence signals. However, as the probe concentration increases, the background fluorescence signal also increases, resulting in a decrease in the F / F0 ratio. Since the F / F0 ratio is the highest at a concentration of 500 nM, 500 nM MNAFQ-probe was finally selected for further experiments ( Figure 4 F).

[0067] In summary, the optimized OAR-MNA reaction system was 10 μL aRPA (including 6 μL rehydration A buffer containing recombinase and polymerase dry powder, 0.4 μL primer AC-SP-2 (10 μM), 0.4 μL reverse primer AC-AP-1 (3.12×10 -2 μM), 1 μL of template (test sample), 0.5 μL of B-buffer containing MgOAc and 1.7 μL of DEPC water), 40 μL of MNAzyme (4 μL of 10x MNAzyme buffer, 250 nM A-PA, 250 nM A-PB, 500 nM MNA FQ-probe and double distilled water as the balance).

[0068] The present invention also provides a method for plant detection (transgenic soybean DBN9004):

[0069] (Forward primer RPA-SP) 9004-F4: ATGGCCGTATCCGCAATGTGTTATTAAGTT

[0070] (Reverse primer RPA-AP) 9004-R3: AGAGCGTTGCATTTACGCTCCATAAACGTG

[0071] 9004-PA(partzyme A):TCATTACGGGGTCAACAACGAGATGAATACTT

[0072] 9004-PB(partzyme B):ATCTGACGGAGGCTAGCTAGAGTTGTAAAC

[0073] MNA FQ-probe:

[0074] 6-FAM-CCACCACGAGTATTCATC / rG / / rU / CCGTCAGACGTGGTGG-BHQ1;

[0075] The template was changed to DEPC water, and the volume remained unchanged at 1 μL, which served as a negative control.

[0076] Method 1: First, the aRPA reaction was performed for 30 minutes, and then the MNAzyme components were added by centrifugation. The fluorescence signal was recorded every 37 seconds using a quantitative PCR instrument for a total of 12 times (a total of 15 minutes);

[0077] The 95% confidence interval (mean+3SD) of the mean fluorescence value of 60 randomly selected negative controls at the endpoint was named the positive judgment line;

[0078] When the fluorescence values ​​on the real-time curve of the fluorescence reaction all exceed the positive judgment line, the sample to be tested is judged to be positive (ie, the sample to be tested contains DBN9004); otherwise, the sample to be tested is judged to be negative.

[0079] Method 2: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, and then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. After the reaction is completed, place the reaction tube on ice and detect the endpoint signal by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel. If the fluorescence of the sample to be tested can be observed and distinguished from the negative control, it is judged to be positive.

[0080] This method was used for method specificity analysis. Non-GM soybean and 6 other GM soybean materials were selected for specificity analysis. Only GM soybean DBN9004 was tested positive, indicating that the method has good specificity.

[0081] In addition, the present invention verified 13 transgenic soybean samples and obtained consistent results with the qPCR method.

[0082] The technical points of the present invention are mainly as follows:

[0083] First, the present invention sets out the concept of asymmetric RPA and a method for combining asymmetric RPA and MNAzyme.

[0084] Secondly, the present invention optimizes the aRPA / MNAzyme solution volume ratio, aRPA forward and reverse primer ratio, partzyme A / partzyme B concentration, probe concentration, reaction temperature, and magnesium ion concentration.

[0085] The beneficial effects of the present invention are mainly reflected in:

[0086] 1. The present invention combines the concept of asymmetric RPA with the MNAzyme method for the first time. The method of the present invention exhibits ultra-high sensitivity and specificity.

[0087] 2. The introduction of ribozymes can amplify the reaction for a second time, and only one universal probe needs to be designed, which greatly reduces the difficulty of probe design and reduces costs.

[0088] 3. The application scope of MNAzyme has been expanded, and the resulting method is suitable for DNA and RNA nucleic acid detection, and the one-tube reaction reduces contamination.

[0089] The technical advantages of the present invention are specifically as follows:

[0090] 1) Apply MNAzyme to double-stranded nucleic acid detection.

[0091] 2) After starting the reaction, there is no need to open the lid to add samples, which reduces aerosol pollution and reduces the number of operation steps.

[0092] 3) High sensitivity: the method can detect 20 copies / μL DNA.

[0093] 4) High specificity: the target sequence is amplified by RPA and identified by MNAzyme. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Figure 1 This is the principle diagram of the OAR-MNA detection method;

[0095] First, the target nucleic acid template is mixed with the RPA components and incubated at 41°C for 30 minutes. During this period, the RPA reaction occurs first, and the recombinase-primer complex binds to the homologous region of the target double-stranded DNA. This binding allows the extension of the forward and reverse primers, resulting in exponential amplification of the DNA amplicon. After the reverse primer is exhausted, the aRPA reaction begins, and the recombinase-forward primer complex triggers the synthesis of single-stranded DNA products.

[0096] Then, the MNAzyme components on the tube cap were added to the reaction system by shaking the tube, and the reaction was continued to be incubated at 41°C for 15 minutes. The MNAzyme recognized the aRPA amplification product, and the single-stranded DNA amplicon was recognized by the MNAzyme complex, resulting in a change in the MNAzyme configuration, thereby cutting the specific probe MNA FQ-probe, resulting in the generation of a fluorescent signal. The fluorescence curve of the reaction was monitored by the Bio-Rad CFX96 Real-Time PCR detection system, or the end point signal was visually observed by an LED blue light illuminator, or the result was determined by a small DNA analyzer.

[0097] Figure 2 The results are obtained by analyzing the feasibility of the MNAzyme method using 12% PAGE.

[0098] Figure 3 Feasibility analysis of the OAR-MNA method; (A) Schematic diagram of the reaction between MNAzyme and RPA amplicon and aRPA amplicon, (B) 12% PAGE and (C) fluorescence curve analysis of the feasibility of the OAR-MNA method.

[0099] Figure 4 To optimize the reaction conditions of OAR-MNA;

[0100] (A) Temperature optimization. (B) Magnesium ion concentration optimization. (C) aRPA / MNAzyme system volume ratio optimization. (D) aRPA forward and reverse primer ratio optimization. (E) Partzyme concentration optimization. (F) Probe concentration optimization. The reaction was detected on the Bio-Rad CFX96 real-time PCR detection system at a constant temperature of 41°C (except for the temperature gradient experiment). Each experiment was repeated three times, and the endpoint fluorescence values ​​of the three replicates were used as a bar graph, and F / F0 was used as a line graph.

[0101] Figure 5 To analyze the sensitivity and specificity of OAR-MNA detection method for bacterial fruit spot detection;

[0102] The reaction was detected on the Bio-Rad CFX96 real-time PCR detection system at a constant temperature of 41°C, and the fluorescence value was recorded every 37 seconds for a total of 24 times. Each experiment was repeated three times, and the data were expressed as the mean ± standard deviation (SD) of three biological replicates. At the same time, the reaction tube was imaged using the Bio-Rad ChemiDoc MP imaging system with a built-in UV channel.

[0103] (A) Fluorescence curve of OAR-MNA detecting different concentrations of A. citrullus genome. The A. citrullus genome was used as a template for detection at concentrations of 2, 20, and 2 x 10 2 , 2x 10 3 , 2x 10 4 , 2x 10 5 , 2x 10 6 Copies / μL, and the reaction system without template was used as a control. The fluorescence imaging of the endpoint at each concentration is also attached.

[0104] (B) Bar graph of OAR-MNA detection of A. citrullus genome at different concentrations. Data are presented as mean ± standard deviation (SD) of three biological replicates. Standard curve graph generated based on OAR-MNA assay results, showing slope, Y intercept, and R 2 value.

[0105] (C) Specificity analysis of the OAR-MNA detection method for watermelon acidophilic bacteria. The OAR-MNA detection method detects five common melon pathogens. The reaction was detected on the Bio-Rad CFX96 real-time PCR detection system at a constant temperature of 41°C. The fluorescence value was recorded every 37 seconds for a total of 24 times. In the figure: Ac represents A. citrulli, Pl represents P. lachrymans, Xc represents X. cucurbita, Fs represents F. solani, Fo represents F. oxysporum, and NC represents the reaction system without adding template. The end point fluorescence imaging of different pathogens is attached.

[0106] Figure 6 The OAR-MNA assay and qPCR assay were used to detect whether the actual samples were contaminated by A. citrullus;

[0107] (A) The reaction was performed on a Bio-Rad CFX96 real-time PCR detection system. OAR-MNA detection and qPCR detection were performed on 22 field watermelon seed samples. Each experiment was repeated three times, and the data are presented as the mean ± standard deviation (SD) of three biological replicates. At the same time, the reaction tubes were imaged using a Bio-Rad ChemiDoc MP imaging system with a built-in UV channel.

[0108] (B) Correlation analysis between the fluorescence value detected by OAR-MNA detection method and the Ct value detected by qPCR detection method.

[0109] (C) Comparison of sensitivity, specificity, and accuracy between OAR-MNA and qPCR detection methods.

[0110] Figure 7 Analysis of the application of OAR-MNA detection method and specific detection of transgenic soybean DBN9004;

[0111] The OAR-MNA detection method was used to detect non-transgenic soybean (CK) and six other transgenic soybean materials (named GTS40-3-2, ZH10-6, SHZD-32-1, Jack, TT12BY and 5547-127). The reactions were detected on a Bio-Rad CFX96 real-time PCR detection system at a constant temperature of 41°C. The fluorescence values ​​were recorded every 37 seconds for a total of 24 times. Each experiment was repeated three times. The data are expressed as the mean ± standard deviation (SD) of three biological replicates.

[0112] Figure 8 To detect whether 13 actual samples of genetically modified soybeans contain genetically modified soybean DBN9004 components using the OAR-MNA detection method, the detection should be carried out on the Bio-Rad CFX96 real-time PCR detection system at a constant temperature of 41°C, and the fluorescence value should be recorded every 37 seconds for a total of 24 times. Each experiment was repeated three times, and the data were expressed as the mean ± standard deviation (SD) of three biological replicates.

[0113] Fig. 9To detect whether 13 actual samples of genetically modified soybeans contain genetically modified soybean DBN9004 components by qPCR detection method. The reaction was carried out on the Bio-Rad CFX96 real-time PCR detection system, and each experiment was repeated three times. The reaction program was 95℃ denaturation for 5min (first stage); 95℃ denaturation for 15s, 60℃ annealing and extension for 60s, and the number of cycles was ≥40 (second stage); after annealing and extension (60℃, 60s), the fluorescence signal was collected in each cycle. DETAILED DESCRIPTION

[0114] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0115] RPA reagents were purchased from Amp Future (Shandong, China), for example, a DNA Constant Temperature Rapid Amplification Kit (Basic Type) may be used.

[0116] In MNAzyme solution:

[0117] MNAzyme buffer contains 50 mM HEPES, 200 mM MgCl2, 20 mM KCl, 120 mM NaCl, 1% v / v DMSO, and the balance is double distilled water.

[0118] Example 1: A method for detecting acidophilic bacteria in watermelon using asymmetric RPA combined with MNAzyme, comprising the following steps:

[0119] 1) Using the constructed plasmid Plasmid-T containing the 344bp sequence information of Acidophilus citrullus as a template; the concentration of DNA in the template to be tested needs to be at least 20 copies / μL;

[0120] illustrate:

[0121] Using the A. citrullus genome as a template, a PCR product of 344 bp (NO1 in the sequence list) was amplified using SEQ ID 1 and SEQ ID 5 in Table 1. The 344 bp amplified fragment was purified and cloned into the pBM23 vector (TransGen, Shanghai, China), and named Plasmid-T as a template plasmid for subsequent use.

[0122] 2) Detection:

[0123] Each reaction system consists of RPA component A, RPA component B and MNAzyme component.

[0124] RPA component A consisted of 6 μL rehydration A buffer containing recombinase and polymerase powder, 0.4 μL forward primer RPA-SP-2 (10 μM), 0.4 μL reverse primer RPA-AP-1 (3.12×10 -2 μM) and 1.7 μL of double distilled water;

[0125] RPA component B consists of 1 μL of template (including the Acidovorax citrullus genome template or the genome template extracted from the watermelon seeds to be tested) and 0.5 μL of B-buffer containing MgOAc.

[0126] The MNAzyme component is a 40 μL system, including 4 μL of 10x MNAzyme buffer, 250 nM MNA-PA, 250 nM MNA-PB, 500 nM MNA FQ-probe, and the balance is double distilled water;

[0127] The reaction system is to add RPA component A to the bottom of the reaction tube, add MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, then manually shake the tube to add the MNAzyme component on the lid to the bottom of the tube, and continue incubating at 41°C for 15 minutes. This is used as the experimental group.

[0128] Note: The template of the above experimental group was changed to double distilled water, and the volume remained unchanged at 1μL. The rest was the same as the experimental group, which served as a negative control.

[0129] At this point, choose one of the following:

[0130] Method 1 (quantitative PCR), using a quantitative PCR instrument to detect the fluorescence signal value (Bio-Rad CFX96 real-time PCR), as follows:

[0131] After RPA component A and RPA component B were mixed, the RPA reaction was incubated at 41°C for 30 minutes, and then the MNAzyme component on the tube cap was added to the bottom of the tube by manually shaking the tube and continued to incubate at 41°C for 15 minutes. During the 15-minute incubation, the fluorescence value was detected by the Bio-Rad CFX96 real-time PCR detection system (15 minutes), and the fluorescence value was recorded every 37 seconds, for a total of 24 times, and a fluorescence curve was made; each experiment was repeated three times, and the average value of the endpoint fluorescence value of the three repetitions was used to make a bar graph, and the significance analysis was performed by the two-tailed test in the independent sample T test (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0132] Method 2: Detect endpoint signals by using LED blue light illuminator or Bio-Rad ChemiDoc MP imaging system equipped with its built-in UV channel (i.e., judging negative and positive by naked eye through fluorescent imaging). The details are as follows:

[0133] After mixing RPA component A and RPA component B, the RPA reaction was incubated at 41°C for 30 minutes, and then the MNAzyme component on the tube cap was added to the bottom of the tube by manually shaking the tube and continued to incubate at 41°C for 15 minutes. After the sample detection was completed (i.e., after the 15-minute incubation), it was taken out and placed on ice, and then immediately placed in the Bio-Rad ChemiDoc MP imaging system with a built-in UV channel to take pictures of the reaction tube.

[0134] 3) Make a judgment based on the inspection results:

[0135] Method 1:

[0136] The fluorescence value was recorded every 37 seconds using a quantitative machine, for a total of 24 tests. Since the machine required additional time for each reading, it took about 15 minutes to complete the reading.

[0137] The 95% confidence interval (mean±3SD) of the mean fluorescence value of 60 randomly selected negative controls at the end of the reaction was named the positive judgment line.

[0138] When each fluorescence value to be detected exceeds the positive judgment line, the sample to be tested is determined to be positive (ie, the sample to be tested contains bacterial fruit spot disease); otherwise, the sample to be tested is determined to be negative.

[0139] Method 2: When using an LED blue light illuminator or the Bio-Rad ChemiDoc MP imaging system with its built-in UV channel to detect the endpoint signal: If the fluorescence of the sample can be distinguished from the negative control by naked eye observation, it is judged as positive.

[0140] Experiment 1.1. The primers used in Example 1 are RPA primers specific for Acidophilus citrinum, and the sensitivity thereof is determined by the OAR-MNA detection method:

[0141] The sensitivity of the OAR-MNA detection method was evaluated by referring to the reaction system set in Example 1. In this evaluation, the template was a plasmid DNA (Plasmid-T) containing Acidophilus citrullus. Plasmid-T was diluted and 7 concentration gradients (2, 2x 10, 2x 10 2 , 2x 10 3 , 2x 10 4 , 2x 10 5 , 2x 10 6As described in Example 1, the template was changed to double distilled water as a no-template control (NTC). In the OAR-MNA detection method, the reagents were added according to the optimized conditions (ie, according to Example 1).

[0142] The results obtained by the method of the present invention are as follows Figure 5 As shown; the positive judgment line is Figure 5 Cutoff in (A), when the endpoint fluorescence value of the test exceeds the positive judgment line, the test sample is judged to be positive (that is, the test sample contains bacterial fruit spot disease). The results show that except for the negative control and the watermelon acidophilus Plasimid T plasmid with a concentration of 2 copies / μL, the endpoint fluorescence values ​​of the other six concentrations of watermelon acidophilus Plasimid T are all above the positive judgment line ( Figure 5 A).

[0143] At the same time, the fluorescence imaging graph shows that the concentration that can be detected by the naked eye is also 20 copies / μL. Therefore, the minimum detection concentration of the OAR-MNA detection method is 20 copies / μL. Linear regression analysis was performed on the fluorescence values ​​of the watermelon acidophilus genome detected by the OAR-MNA detection method at different concentrations. 2 0.9952 (greater than 0.99), indicating that the OAR-MNA detection method can be used for semi-quantitative or quantitative detection ( Figure 5 B).

[0144] Experiment 1.2: In order to evaluate the specificity of the OAR-MNA detection method for watermelon acidophilus, the present invention used the designed watermelon acidophilus-specific RPA primers to detect the genomic DNA of common watermelon-infecting pathogen strains (such as P. lachrymans, X. cucurbita, F. solani and F. oxysporum) using OAR-MNA, and the specificity was confirmed by the fluorescence curve of the reaction and the luminescence intensity of the reaction tube.

[0145] The details are as follows: the genomic DNA of Acidophilus citrinum in Experiment 1.1 was replaced with the genomic DNA of P. lachrymans, X. cucurbita, F. solani and F. oxysporum, respectively, and the concentration of the genomic DNA was set to 10 ng / μL; the rest was referred to Experiment 1.1.

[0146] The present invention uses the standard strain of watermelon acidophilus Acidovorax citrulli (ATCC 29625) and four other common melon pathogens, including two common bacteria, Pseudomonas lachrymans and Xanthomonascucurbita, and two common fungi, Fusarium solani and Fusarium oxysporum. Watermelon acidophilus was cultured on nutrient agar Nutrient Broth, while P. lachrymans and X. cucurbita were cultured on LB agar. F. solani and F. oxysporum were cultured on potato dextrose agar. The genomic DNA of the bacteria was extracted using the TIANamp bacterial DNA kit (Tiangen, Beijing, China), while the fungal genome was extracted using the SIMGEN plant DNA reagent box (SIMGEN, Hangzhou, China).

[0147] Description: The standard strain of watermelon acidophilic bacteria Acidovorax citrulli (ATCC 29625) contains the 344 bp sequence described in the sequence table.

[0148] The result is:

[0149] When the present invention is used for detection, only obvious fluorescence signals are detected in the watermelon acidophilic bacteria A. citrulli sample ( Figure 5 C), while the fluorescence signals of P. lachrymans, X. cucurbita, F. solani and F. oxysporum were all below the positive judgment line. The fluorescence imaging also showed that green fluorescence was only observed in the watermelon acidophilic bacteria A. citrulli sample. This confirmed that the method has a high specificity in detecting watermelon acidophilic bacteria DNA.

[0150] Experiment 1.3: On-site sample (field sample) testing

[0151] Twenty-two field watermelon samples were used to validate the applicability of the OAR-CRISPR detection method.

[0152] 22 field watermelon samples were used as test samples to obtain corresponding DMA templates, and the detection was carried out according to the method described in the above Example 1 (including method 1 and method 2).

[0153] The results of the test were as follows: OAR-MNA results showed that only the fluorescence values ​​of S6, S8, S13, S14, S15, S17 and S19 exceeded the positive judgment line ( Figure 6 A). Meanwhile, OAR-MNA fluorescence imaging showed that only S6, S8, S13, S14, S15, S17, and S19 had green fluorescence ( Figure 6 A).

[0154] illustrate: Figure 6 In A, NC stands for negative control, PC stands for positive control, and NTC stands for no template control.

[0155] The results showed that 7 of the samples were contaminated with watermelon acidophilus.

[0156] These field samples were also tested by qPCR. The details of the qPCR test are as follows:

[0157] 25μL reaction system: fluorescent PCR premix 12.5μL, primer AC-FP (10μmol / L) 1μL, primer AC-RP (10μmol / L) 1μL, TaqMan probe AC-P (10μmol / L) 0.5μL, template 1μL, add ultrapure water to 25μL. The reaction program is the first cycle of 95℃10min; followed by 40 cycles of 94℃15s, 58℃1min. The results obtained are that only S6, S8, S13, S14, S15, S17 and S19 have Ct values ​​less than 35 ( Figure 6 A). Fluorescence imaging showed that only S6, S8, S13, S14, S15, S17, and S19 had green fluorescence ( Figure 6 A). At the same time, the correlation analysis between the two detection methods showed a strong positive correlation, with a Pearson correlation coefficient of -0.8153 ( Figure 6 B). The results were 100% consistent with those obtained by the OAR-MNA detection method ( Figure 6 C). The analysis of field samples provided convincing evidence for the practical application of the OAR-MNA detection method, demonstrating its considerable diagnostic potential.

[0158] In summary, the present invention was verified by testing 22 watermelon seed samples and obtained consistent results with the qPCR method.

[0159] Example 2: The primers used were transgenic soybean DBN9004-specific RPA primers, and the OAR-MNA detection method was used to determine their specificity and the accuracy of actual sample detection.

[0160] 1) The transgenic soybean DBN9004 genome was used as a template; the concentration of DNA in the test template was required to be at least 20 copies / μL; RPA primers were designed using Primer Premier 5 software. The specificity of the primers was evaluated using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ). At the same time, partzyme A and partzyme B were designed according to the RPA primer positions. Local BLASTn was used to test the individual specificity of the designed partzyme A and partzyme B. All synthetic nucleic acids used in this case were synthesized by Sangon (Shanghai, China), as shown in Table 4.

[0161] Table 4. Primer sequences, probe sequences and target sequence information designed in this case

[0162]

[0163] 2) Detection:

[0164] The difference from Example 1 is that the RPA primers, template, partzyme A and partzyme B are different, and the rest of the reaction system and reaction method are the same as those in Example 1.

[0165] The details are as follows:

[0166] Each reaction system consists of RPA component A, RPA component B and MNAzyme.

[0167] RPA component A consisted of 6 μL rehydration A buffer containing recombinase and polymerase powder, 0.4 μL primer 9004-F4 (10 μM), 0.4 μL reverse primer 9004-R3 (3.12×10 -2 μM) and 1.7 μL of double distilled water;

[0168] RPA component B consisted of 1 μL of template (soybean sample) and 0.5 μL of B-buffer containing MgOAc.

[0169] The MNAzyme solution is a 40 μL system, including 4 μL of 10x MNAzyme buffer, 250 nM 9004-PA, 250 nM 9004-PB, 500 nM MNA FQ-probe, and the balance is double distilled water.

[0170] The reaction system is to add RPA component A to the bottom of the reaction tube, add MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, then manually shake the tube to add the MNAzyme component on the lid to the bottom of the tube, and continue incubating at 41°C for 15 minutes. This is used as the experimental group.

[0171] Note: The template of the above experimental group was changed to double distilled water, and the volume remained unchanged at 1μL. The rest was the same as the experimental group, which served as a negative control.

[0172] The detection is performed using the method 1 and the method 2 described in Example 1, and the determination method is the same as that in Example 1.

[0173] Experiment 2.1: In order to evaluate the specificity of the OAR-MNA detection method when applied to the transgenic soybean DBN9004, the present invention used the designed transgenic soybean DBN9004 RPA primers to detect the genomic DNA of non-transgenic soybean (CK) and 6 other transgenic soybean materials (named GTS40-3-2, ZH10-6, SHZD-32-1, Jack, TT12BY and 5547-127, respectively) using OAR-MNA, and the specificity was confirmed by the fluorescence curve of the reaction and the luminescence intensity of the reaction tube.

[0174] The details are as follows: the genomic DNA of the transgenic soybean DBN9004 in Example 2 was replaced with the genomic DNA of non-transgenic soybean CK and other transgenic soybean materials (GTS40-3-2, ZH10-6, SHZD-32-1, Jack, TT12BY and 5547-127), and the concentration of the genomic DNA was set to 10 ng / μL; the rest was referred to Example 2.

[0175] The present invention used transgenic soybeans DBN9004, GTS40-3-2, ZH10-6, SHZD-32-1, Jack, TT12BY and 5547-127, and non-transgenic soybean CK. The genomes of all soybean samples were extracted using a SIMGEN plant DNA reagent kit (SIMGEN, Hangzhou, China).

[0176] The result is:

[0177] When the present invention is used for detection, only when the fluorescence signal of the transgenic soybean DBN9004 sample is above the positive judgment line ( Figure 7 ), while the fluorescence signals of transgenic soybeans GTS40-3-2, ZH10-6, SHZD-32-1, Jack, TT12BY and 5547-127, and non-transgenic soybean CK were all below the positive judgment line ( Figure 7), which confirmed that the method has high specificity in detecting watermelon acidophilic bacteria DNA.

[0178] Experiment 2.2: On-site sample testing

[0179] Thirteen soybean samples were used to validate the applicability of the OAR-CRISPR detection method to the genetically modified soybean DBN9004.

[0180] 13 field watermelon samples were used as test samples to obtain corresponding DNA templates, and the detection was carried out according to the method described in the above Example 1 (using method 1).

[0181] The results of the test were as follows: OAR-MNA results showed that only the fluorescence values ​​of S3, S6, S10, S12 and S13 exceeded the positive judgment line ( Figure 8 ). The results showed that the genetically modified soybean DBN9004 component was present in 5 of the samples.

[0182] These field samples were also tested by qPCR. The specific process of qPCR testing was 25 μL reaction system: 2.5 μL fluorescent PCR 10x PCR buffer, 2.5 μL 25 mmol / L magnesium chloride solution, 2.0 μL dNTPs mixed solution (2.5 mmol / L each), 1 μL primer DBN9004-qF (10 μmol / L), 1 μL primer DBN9004-qR (10 μmol / L), 0.5 μL TaqMan probe DBN9004-qP (10 μmol / L), 2 μL template, and ultrapure water was added to 25 μL. The reaction procedure was: denaturation at 95 °C for 5 min (first stage); denaturation at 95 °C for 15 s, annealing and extension at 60 °C for 60 s, and the number of cycles was ≥ 40 (second stage); after annealing and extension (60 °C, 60 s), the fluorescence signal was collected in each cycle. The results showed that only S3, S6, S10, S12 and S13 had Ct values ​​less than 35 ( Fig. 9 The results were 100% consistent with those obtained by the OAR-MNA assay. The field sample analysis provides convincing evidence for the practical application of the OAR-MNA assay, demonstrating its considerable diagnostic potential.

[0183] In summary, the present invention was verified by testing 13 soybean samples and obtained consistent results with the qPCR method.

[0184] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A rapid detection method using asymmetric RPA combined with MNAzyme, characterized in that: The reaction system consists of RPA component A, RPA component B and MNAzyme component; RPA component A consisted of 6 μL of rehydration A buffer containing recombinase and polymerase powder, 0.4 μL of forward primer RPA-SP-2, 0.4 μL of reverse primer RPA-AP-1, and 1.7 μL of DEPC water; RPA component B consisted of 1 μL of template and 0.5 μL of B-buffer containing MgOAc; The MNAzyme component is a 40 μL system, including 4 μL of 10x MNAzyme buffer, 250 nM partzyme A, 250 nM partzyme B, 500 nM MNA FQ-probe, and the balance is double distilled water.

2. The rapid detection method of asymmetric RPA combined with MNAzyme according to claim 1, characterized in that: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube, and continue to incubate at 41°C for 15 minutes; then choose any of the following methods: Method 1: After adding the MNAzyme components, the fluorescence value was recorded by quantitative PCR instrument during the incubation process at 41°C for 15 minutes; Method 2: After the incubation process at 41°C for 15 minutes after the addition of the MNAzyme components, the endpoint signal is detected by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel.

3. A rapid detection method using asymmetric RPA combined with MNAzyme according to claim 1 or 2, characterized in that: MNAzyme buffer contains 50 mM HEPES, 200 mM MgCl2, 20 mM KCl, 120 mM NaCl, and 1% v / v DMSO.

4. A method for bacterial detection, characterized in that: Using the method as claimed in any one of claims 1 to 3: Forward primer RPA-SP-2: TCACCGGCGGCACGGTGCAGTTTCCTGCTT; Reverse primer RPA-AP-1: CGCTCTGCGGTAGGGCGAAGAAACCAACAC AC-PA:AAATTCATAGAGTCGAAACAACGAGATGAATACTT AC-PB:ATCTGACGGAGGCTAGCTTCAGCGTTGCCGGCGG MNA FQ-Probe: 6-FAM-CCACCACGAGTATTCATC / rG / / rU / CCGTCAGACGTGGTGG-BHQ1; The template was changed to DEPC water, and the volume remained unchanged at 1 μL, which served as a negative control; Method 1: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, and then manually shake the tube to add the MNAzyme component to the bottom of the tube. At the same time, the fluorescence signal is recorded every 37 seconds by a quantitative PCR instrument, for a total of 24 times; The 95% confidence interval of the mean fluorescence value of 60 randomly selected negative controls at the endpoint was named the positive judgment line; When the fluorescence values ​​on the real-time curve of the fluorescence reaction all exceed the positive judgment line, the sample to be tested is judged to be positive; otherwise, the sample to be tested is judged to be negative; Method 2: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. After the reaction is completed, place the reaction tube on ice, and detect the endpoint signal by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel. If the fluorescence of the sample to be tested can be observed and distinguished from the negative control, it is judged to be positive.

5. A method for plant detection, characterized in that: Using the method as claimed in claims 1 to 3: 9004-F4:ATGGCCGTATCCGCAATGTGTTATTAAGTT 9004-R3:AGAGCGTTGCATTTACGCTCCATAAACGTG 9004-PA:TCATTACGGGGTCAACAACGAGATGAATACTT 9004-PB:ATCTGACGGAGGCTAGCTCAGAGTTGTAAAC; MNA FQ-probe: 6-FAM-CCACCACGAGTATTCATC / rG / / rU / CCGTCAGACGTGGTGG-BHQ1; The template was changed to DEPC water, and the volume remained unchanged at 1 μL, which served as a negative control; Method 1: First, the aRPA reaction was performed for 30 minutes, and then the MNAzyme components were added by centrifugation, and the fluorescence signal was recorded every 37 seconds using a quantitative PCR instrument for a total of 12 times; The 95% confidence interval of the mean fluorescence value of 60 randomly selected negative controls at the endpoint is named the positive judgment line; When the fluorescence values ​​on the real-time curve of the fluorescence reaction all exceed the positive judgment line, the sample to be tested is judged to be positive; otherwise, the sample to be tested is judged to be negative; Method 2: The reaction system is to add RPA component A to the bottom of the reaction tube, add the MNAzyme component to the lid of the reaction tube, then add RPA component B to the bottom of the reaction tube, close the lid, incubate at 41°C for 30 minutes, add the MNAzyme component to the bottom of the tube by manually shaking the tube, and continue incubating at 41°C for 15 minutes. After the reaction is completed, place the reaction tube on ice, and detect the endpoint signal by using an LED blue light illuminator or a Bio-Rad ChemiDoc MP imaging system equipped with a built-in UV channel. If the fluorescence of the sample to be tested can be observed and distinguished from the negative control, it is judged to be positive.

Images