Nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells and application of nucleic acid aptamer

Abstract

The invention discloses a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells and application of the nucleic acid aptamer, and belongs to the technical field of biology. The nucleic acid aptamer specifically bound with the rabbit bone marrow mesenchymal stem cells is obtained through screening and comprises a DNA fragment shown in SEQ ID NO.1. The nucleic acid aptamer has high affinity and specificity, is small in immunogenicity, good in stability, small in molecular weight, capable of being chemically synthesized in vitro, capable of modifying and replacing different parts, stable in chemical property and capable of being used for preparing the rabbit bone marrow mesenchymal stem cells. The storage is easy; the marking is convenient. The nucleic acid aptamer capable of recognizing the rabbit bone marrow mesenchymal stem cells is high in binding capacity, target molecules combined with the nucleic acid aptamer are captured through the nucleic acid aptamer, the target molecules of the nucleic acid aptamer can be possibly obtained, separation and enrichment of the rabbit bone marrow mesenchymal stem cells can be greatly promoted, and the recognition efficiency of the rabbit bone marrow mesenchymal stem cells is improved. Wide application prospects are realized in the fields of tissue engineering and regenerative medicine.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells and an application thereof. Background Art

[0002] Mesenchymal stem cells (MSCs) are multifunctional stem cells that can differentiate into a variety of cells such as adipocytes, osteoblasts, and neurons after specific induction. In addition, MSCs can also secrete SDF-1 (Stromal cell-derived factor 1) and its receptor CXCR4 to facilitate their homing, and vascular endothelial growth factor (VEGF) to promote angiogenesis.

[0003] In recent years, MSCs have gradually become a research hotspot in tissue engineering. At present, the transplantation of MSCs is mainly promoted by combining biomaterials, gene modification, etc. to promote their directional differentiation, and positive results have been achieved. However, there are also some defects in the transplantation of MSCs, which to some extent limit its application in tissue engineering. For example, when relying on exogenous MSCs, the directional homing of MSCs during intravenous transplantation is the key to ensure the efficacy, but there is currently no clear means to ensure that MSCs can completely reach the target area; when relying on endogenous MSCs, it is still impossible to effectively enrich the circulating MSCs to reach the target area. Therefore, a method that can improve the limitations of these schemes is needed to provide hope for optimizing MSCs transplantation therapy.

[0004] Aptamers are small-molecule single-stranded oligonucleotides that are artificially synthesized. They are tightly connected to targets through electrostatic interactions, van der Waals forces, hydrogen bonds, or by folding to form a special three-dimensional structure (such as hairpins, stem-loops, and G-quadruplexes). Their targets are diverse, such as ions, peptides, proteins, viruses or bacteria, whole cells, even living animals, other organic or inorganic substances, etc. Aptamers can bind to targets in a variety of ways. They can enter cells and bind to cells through calcium phosphate coprecipitation, endocytosis, and endocytosis. Based on the diversity of aptamer action modes, aptamers are increasingly valued from disease diagnosis to treatment. Currently, more than 900 aptamers have been used in the diagnosis and treatment of various diseases. This shows that it is feasible to improve the basic research and clinical application of MSCs based on aptamer technology, and it has broad prospects. Therefore, how to separate bone marrow mesenchymal stem cells from rabbit bone marrow has become extremely urgent, and achieving effective separation and enrichment of MSCs is a technical problem that needs to be solved urgently. Summary of the invention

[0005] The purpose of the present invention is to provide a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells and its application in view of the above-mentioned deficiencies in the prior art. The nucleic acid aptamer has higher affinity and specificity, is non-immunogenic, can be chemically synthesized, has a small molecular weight, is stable, and is easy to label and store.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] The first object of the present invention is to provide a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells, wherein the nucleic acid aptamer comprises a DNA fragment as shown in SEQ ID NO.1.

[0008] Furthermore, the nucleic acid aptamer also includes a complex that is bound to biotin, digoxigenin, a fluorescent substance, a nanoluminescent material or an enzyme label on the DNA fragment.

[0009] Furthermore, the fluorescent substance is a FAM fluorescent group or a Cy5 fluorescent group; and / or the nanoluminescent material is a quantum dot or an upconversion nanoparticle; and / or the enzyme marker is horseradish peroxidase or sucrase.

[0010] The second object of the present invention is to provide a detection kit for detecting rabbit bone marrow mesenchymal stem cells, comprising the above-mentioned nucleic acid aptamer.

[0011] The third object of the present invention is to provide the use of a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1 in the preparation of a product for recruiting rabbit bone marrow mesenchymal stem cells.

[0012] The fourth objective of the present invention is to provide a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1 for use in preparing a biological probe for identifying rabbit bone marrow mesenchymal stem cells.

[0013] The fifth object of the present invention is to provide a 3WJ RNA nanoparticle comprising the nucleic acid aptamer as claimed in claim 1, wherein the 3WJ RNA nanoparticle is 3WJ-M4-CkipsiRNA, wherein 3WJ is a core scaffold, M4 is a target ligand targeting MSCs, and CkipsiRNA is used as a therapeutic agent.

[0014] Furthermore, the 3WJ RNA nanoparticles also include a fluorescent tracer, and the fluorescent tracer is Alexa647.

[0015] Furthermore, the 3WJ RNA nanoparticles promote osteogenic differentiation of mesenchymal stem cells.

[0016] Furthermore, the 3WJ RNA nanoparticles are targeted and accumulated in the femur.

[0017] Compared with the prior art, the technical solution provided by the present invention has the following beneficial effects:

[0018] (1) The present invention screened and obtained a nucleic acid aptamer that specifically binds to rabbit bone marrow mesenchymal stem cells. The nucleic acid aptamer has higher affinity and specificity, low immunogenicity, good stability, can be chemically synthesized in vitro, has a small molecular weight, can be modified and replaced at different parts, and has stable chemical properties, is easy to store, and is convenient for labeling. The nucleic acid aptamer that can recognize rabbit bone marrow mesenchymal stem cells of the present invention has a strong binding ability. The nucleic acid aptamer of the present invention is used to capture the target molecule to which it binds, and its target molecule may be obtained, which can greatly promote the separation and enrichment of rabbit bone marrow mesenchymal stem cells, and has broad application prospects in the fields of tissue engineering and regenerative medicine.

[0019] (2) The nucleic acid aptamer provided by the present invention recognizes living cells and can be used to recruit rabbit bone marrow mesenchymal stem cells, providing a new idea for the effective separation and enrichment of rabbit bone marrow mesenchymal stem cells and a solid foundation for subsequent applications in tissue engineering and regenerative medicine.

[0020] (3) The nucleic acid aptamer provided by the present invention recognizes living cells and can be used as a biological probe to identify rabbit bone marrow mesenchymal stem cells. It can deliver small molecules to the rabbit bone marrow mesenchymal stem cells recognized by the nucleic acid aptamer, opening up a new way to solve some of the problems in the current clinical application of MSC.

[0021] (4) The present invention provides a detection kit containing a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells. Since the synthesis cost of the nucleic acid aptamer is lower than that of the antibody preparation, and the cycle is short and the reproducibility is good, when the nucleic acid aptamer of the present invention is used to detect rabbit bone marrow mesenchymal stem cells, the operation is simpler and faster. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1a This is the input and recovery diagram of the first screening method;

[0023] Figure 1b This is the input and recovery diagram of the second screening method;

[0024] Figure 1c This is the input and recovery diagram of the third screening method;

[0025] Figure 2 The confocal detection enriched library (AC) was the first, second, and third screening method;

[0026] Figure 3A-3C Comparison of three sequencing results and candidate sequence binding ability (AC) are the sequencing results of the first, second and third screening methods respectively;

[0027] Figure 3D-Figure 3F The binding ability of candidate sequences to fixed cells in system Ⅰ, living cell system Ⅰ and living cell system ⅠⅠ were compared by flow cytometry respectively;

[0028] Figure 4 Figure 1 is a graph showing the specificity, KD value and cytotoxicity test results of M4, where A and B are flow cytometry tests of the binding of M4 to rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells, respectively; C is the KD value of M4; D is flow cytometry analysis of the cytotoxicity of M4 to MSCs; and E is flow cytometry analysis of the binding of M4 to human MSCs, normal liver cells (Lo2) and normal human lung epithelial cells (beas-2b);

[0029] Figure 5 The results of isolating MSCs from bone marrow using M4, wherein AC is the results of isolating MSCs from bone marrow using magnetic beads alone and observed under a microscope after 0, 24 and 72 hours, DF is the results of isolating MSCs from bone marrow using aptamer-magnetic beads and observed under a microscope after 0, 24 and 72 hours, GI is the results of flow cytometry detection of MSCs surface markers CD45, CD29 and CD44 (J, K) to detect osteogenic and chondrogenic differentiation abilities of MSCs, respectively;

[0030] Figure 6 Figure 1 is a graph showing the detection of nanoparticle assembly, particle size, potential and serum stability, where A is the nanoparticle sequence, B is the assembly graph of the multifunctional aptamer detected by AGE gel, C is the particle size graph of the multifunctional aptamer detected by transmission electron microscopy, D and E are the particle size and potential graphs of the multifunctional aptamer detected by dynamic light scattering, and F is the result graph of the multifunctional aptamer serum stability analyzed by PAGE gel;

[0031] Figure 7 The results of analyzing the binding of q3WJ-M4-CkipsiRNA to MSCs and its effect on osteogenic differentiation of MSCs are shown in Figure 5, where AC is the confocal detection of the binding of 3WJ-M4-CkipsiRNA to MSCs, and D is the flow cytometry analysis of the binding of 3WJ-M4-CkipsiRNA to MSCs;

[0032] Figure 8 In the middle, E is the expression change diagram of the target gene Ckip analyzed by qPCR, and FG are the expression change diagrams of osteogenic genes analyzed by Western blot and qPCR, respectively;

[0033] Fig. 9To analyze the tissue distribution of nanoparticles and the effect of repairing necrotic femoral head, A is the organ fluorescence imaging analysis of nanoparticle aggregation in vivo, B1-B4 are HE staining analysis of nanoparticle organ toxicity, C1-C4 are Masson analysis of necrotic femoral head repair, D1-D4 are macroscopic observations of necrotic femoral head repair, E1-E4 are microCT detection of necrotic femoral head repair, and F1-F4 are 3D printing analysis of necrotic femoral head repair. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical scheme and advantages of the present invention clearer, the specific embodiments of the present invention are further described in detail below in conjunction with specific examples and drawings. If no specific technology or conditions are specified in the examples, the technology or conditions described in the literature in this field or the product instructions are used. If the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be obtained commercially.

[0035] The applicant uses the cell-based SELEX technology, using the third-generation MSCs isolated and cultured in the applicant's laboratory as target cells to enrich the aptamer sequence, and the seventh-generation MSCs as the elimination target. In order to improve the screening success rate, the applicant selected fixed MSCs and living MSCs as targets, while ensuring the natural conformation of the target while improving the success rate. These enriched DNA aptamers can bind to fixed and living MSCs. Therefore, the applicant confirms that the screened aptamers can successfully bind to the cells.

[0036] As a preferred embodiment, in step (2), rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells are used to verify the specificity of the DNA aptamer of rabbit bone marrow mesenchymal stem cells.

[0037] The key to the application of aptamers lies in specificity. The applicant uses rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells to verify whether the DNA aptamer of rabbit bone marrow mesenchymal stem cells has specificity. At the same time, the applicant verifies the binding force of the aptamer to human bone marrow mesenchymal stem cells, and verifies the binding of the aptamer to human normal liver cells (Lo2) and normal human lung epithelial cells (beas-2b). It has been verified that the sequence 1 aptamer produces very strong fluorescence after binding to rabbit and human bone marrow mesenchymal stem cells, and has no obvious fluorescence with rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells (kidney cells), human normal liver cells (Lo2) and normal human lung epithelial cells (beas-2b), or does not exceed the background fluorescence. The data of the present invention have proved that the sequence 1 aptamer can not only bind to rabbit bone marrow mesenchymal stem cells, but also has strong specificity.

[0038] Example 1

[0039] This embodiment provides a nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells, wherein the nucleic acid aptamer comprises one of the following DNA fragments:

[0040] SEQ ID NO.1:

[0041] 5'-GCAATGGGTACGGTACTTCCATTGGTCTTCGCGATCAATTCGCTACCGCGCCTAGCCTGCAAAAGTGCACGCTACTTTGCTAA-3';

[0042] The DNA fragments of the above-mentioned nucleic acid aptamers are mainly obtained by the following screening method:

[0043] 1. Screening of DNA aptamers targeting rabbit bone marrow mesenchymal stem cells;

[0044] P3 MSCs isolated and cultured in the applicant's laboratory were used as target cells, P7 MSCs were used as subtractive cells, and SELEX technology was used to enrich aptamer sequences.

[0045] The detailed operation steps of SELEX technology are as follows:

[0046] 1. Buffers and Solutions

[0047] (1) Binding buffer I: pH 7.4 PBS, containing 5 mM MgCl2, 0.1 μg / μL ytRNA and 0.1 μg / μL salmon sperm DNA; Binding buffer II: pH 7.4 PBS, containing 100 mM NaCl, 2 mM MgCl 2、 1mM CaCl2, 0.1μg / μL ytRNA, and 0.1μg / μL salmon sperm DNA.

[0048] (2) Washing buffer I: pH 7.4 PBS, containing 5 mM MgCl2; Washing buffer II: pH 7.4 PBS, containing 100 mM NaCl, 2 mM MgCl 2、 1mM CaCl2.

[0049] (3) Gel elution buffer: pH 8.0, containing 0.5 mol / L NH4Ac, 0.1% SDS and 1 mmol / L EDTA.

[0050] (4) Depleted cells: MSCs cultured to the seventh generation.

[0051] 2. Incubation of library and target cells

[0052] (1) Fixed cell suspension screening

[0053] Count the cells using a cell counting plate and take 1×10 6 P3 MSCs were fixed with paraformaldehyde and washed twice with washing buffer I. In the first round, 5 nmol of aptamer library was added and dissolved in 1×PBS-5mMMgCl2 (binding buffer I), denatured at 100°C for 5 min, and ice-water bathed for 5 min; the previously prepared ytRNA and salmon sperm DNA (operated in a 4°C ice-water mixture) were added and mixed to make the final concentration of the incubation system 1×PBS-5mMMgCl2-0.1μg / μL ytRNA-0.1μg / μL salmon sperm DNA, and added to the cells and incubated at 37°C for 30 min; in the 4th to 7th rounds, subtractive screening was first performed, that is, the denatured ssDNA library was first added to P7 MSCs, mixed, incubated at 37°C for 30 min, centrifuged at 1400rpm×5min, the supernatant was collected and added to P3 MSCs, mixed, and incubated at 37°C for 30 min;

[0054] After incubation, add 1 mL of washing buffer I and gently pipette, centrifuge at 1400 rpm × 5 min, aspirate the supernatant, repeat washing 3-5 times, aspirate the supernatant, add 100 μl of DEPC water and boil for 5 min, and use it as a PCR amplification template.

[0055] (2) Live cell suspension screening

[0056] Count the cells using a cell counting plate and take 1×10 6 P3 MSCs were washed twice with washing buffer I; in the first round, 5 nmol of aptamer library was added, the library was dissolved in 1×PBS-5mMMgCl2 (binding buffer I), denatured at 100℃ for 5min, and ice-water bathed for 5min; the previously prepared ytRNA and salmon sperm DNA (operated in a 4℃ ice-water mixture) were added and mixed to make the final concentration of the incubation system 1×PBS-5mMMgCl2-0.1μg / μL ytRNA-0.1μg / μL salmon sperm DNA, and added to the cells, and incubated at 37℃ for 30min; in the 3rd, 7th, 11th, and 15th rounds, subtractive screening was performed first, that is, the denatured ssDNA library was first added to P7MSCs, mixed, incubated at 37℃ for 30min, centrifuged at 1400rpm×5min, the supernatant was collected and added to P3 MSCs, mixed, and incubated at 37℃ for 30min;

[0057] After incubation, add 1 mL of washing buffer I and gently pipette, centrifuge at 1400 rpm × 5 min, aspirate the supernatant, repeat washing 3-5 times, aspirate the supernatant, add 100 μl of DEPC water and boil for 5 min, and use it as a PCR amplification template.

[0058] (3) Screening of live cell adhesion

[0059] P3 and P7 MSCs were seeded in 24-well plates, respectively. When the cell fusion reached about 80%, the culture medium in the well plate was aspirated and the cells were rinsed with washing buffer II for 3 times, each time for 1 minute. In the first round, 5 nmol of the library was added, and the ssDNA library was dissolved in 1×PBS-100mmol / L NaCl-2mmol / LMgCl2-1mmol / L CaCl2 solution (binding buffer II), denatured at 100℃ for 5min, and ice-bathed for 5min. The previously prepared ytRNA and salmon sperm DNA (operated in a 4℃ ice-water mixture) were added and mixed to make the final concentration of the incubation system 1×PBS-5mMMgCl2-0.1μg / μL ytRNA-0.1μg / μL salmon sperm DNA; In the 3rd, 7th, 11th and 15th rounds, subtractive screening was first performed, that is, the medium of P7 generation rabbit MSCs in the 24-well plate was first aspirated and discarded, and the plate was rinsed twice with washing buffer II for 1 minute each time. After aspiration, the denatured ssDNA library was added, and the cells were gently mixed and covered. The cells were incubated at 37°C for 30 minutes, and the supernatant was collected and then incubated with the rinsed P3 generation rabbit MSCs at 37°C for 30 minutes.

[0060] After incubation, the supernatant was discarded, and the 24-well plate was gently rinsed 3 times with washing buffer II, 1 min / time, the supernatant was discarded, 100 μL ddH2O was added, and all the cells were scraped and collected in Ep and boiled for 5 min as a PCR amplification template.

[0061] 3. Amplify binding sequence

[0062] This step is to determine the optimal number of PCR cycles required. This operation must be performed in each step of SELEX. All three schemes use unequal-length PCR to amplify the binding sequence. First, a small amount of template is amplified and amplified according to the standard PCR reaction system. 100 μL / tube is divided into 10 tubes, which are marked as 12 rounds, 15 rounds, 18 rounds, 21 rounds, 24 rounds, 27 rounds, and 30 rounds respectively. The optimal number of PCR amplification cycles is determined by 7 M urea 8% polyacrylamide denaturing gel electrophoresis.

[0063] 4. Amplification and preparation of secondary libraries

[0064] After determining the optimal number of PCR cycles, the remaining spare templates were amplified in large quantities according to the same procedure. After amplification, the product was denatured at 100°C for 5 minutes, ice-water bathed for 5 minutes, and electrophoresed at 140V through 7M urea 8% polyacrylamide denaturing gel; the gel was then stained with Goldview nucleic acid stain and placed on a UV lamp platform covered with plastic wrap to confirm the position of the target band, and the gel at the target band was cut with a blade, and the gel strip was cut into 1 cubic millimeter size and transferred to a 1.5mL Ep tube; 400μL (more than twice the volume of the gel strip) of gel elution buffer was added to each Ep tube, and eluted at 37°C constant temperature shaker for 8 hours; the Ep tube was centrifuged instantly, and the eluate in the Ep tube was carefully aspirated into a new 1.5mL Ep tube to prevent the gel from being aspirated; 1 / 100 volume of 1mol / L MgCl2 and 1 / 10 volume of 3mol / LNaAc (pH 5.2), add 2.5 times the volume of anhydrous ethanol in sequence, shake and mix, and let it stand at -80℃ for 8h; centrifuge at 13000rpm at 4℃ for 30min; discard the supernatant, add 1mL pre-cooled 75% ethanol to rinse, and centrifuge at e; discard the supernatant, dry at room temperature for about 30min (ethanol evaporates), add 100μL ddH2O to dissolve ssDNA, quantify by UV spectrophotometer, and store at -20℃ for later use.

[0065] 5. Confocal Identification of Enriched Libraries

[0066] The secondary libraries recovered in the 4th, 5th, 6th and 7th rounds of fixed cell suspension screening, and the secondary libraries recovered in the 9th, 11th, 13th and 15th rounds of live cell suspension screening and live cell adherence screening were identified as enriched libraries. The ssDNA secondary libraries screened in fixed cell suspension were fluorescently labeled with FITC, and the ssDNA secondary libraries screened in live cell suspension and live cell adherence were fluorescently labeled with CY5, that is, the ssDNA secondary libraries were used as templates, the primers were labeled with FITC or CY5, and then amplified according to the above PCR procedure to prepare the fluorescent library and stored at -20°C in the dark;

[0067] P3 MSCs were seeded in confocal microplates and cultured until 70% confluence; FITC or CY5 labeled ssDNA secondary libraries were dissolved in 1×PBS-5mmol / L MgCl2 solution (freshly prepared) and 1×PBS-100mmol / L NaCl-2mmol / LMgCl2-1mmol / L CaCl2 solution (freshly prepared), denatured at 100℃ for 5min, and ice-bathed for 5min; previously prepared ytRNA and salmon sperm DNA were added and mixed to make the final concentration of the incubation system 1×PBS-5mmol / L MgCl 2-0.1μg / μL ytRNA-0.1μg / μL salmon sperm DNA or 1×PBS-100mmol / L NaCl-2mmol / LMgCl2-1mmol / L CaCl2-0.1μg / μL ytRNA-0.1μg / μL salmon sperm DNA, total volume 200μL; the blank well incubation system did not add fluorescently labeled ssDNA secondary library, and the rest of the operations were the same; P3 rabbit MSCs in the confocal dish were rinsed twice with washing buffer, added with the above library, and incubated at 37℃ for 30min; the FITC or CY5 fluorescence intensity was observed under a confocal microscope.

[0068] 6. Enriched library for monoclonal sequencing and high-throughput sequencing

[0069] 1) After the library is enriched, further sequencing is required to obtain the aptamer nucleotide sequence. First, the enriched library is amplified by PCR to recover the dsDNA library. This amplification uses equal-length PCR, a standard PCR reaction system, and 10% polyacrylamide gel electrophoresis for recovery.

[0070] 2) Monoclonal sequencing: The dsDNA library screened by the recovered fixed cell suspension was connected to the T vector and mixed with the competent cells. 100 μL of bacterial solution was taken in the clean bench and applied to the LB medium containing Amp. After drying, it was inverted and cultured overnight in a 5% CO2, 20% O2, 37°C incubator. A single colony was picked for sequencing.

[0071] 3) High-throughput sequencing: Perform high-throughput sequencing on the dsDNA libraries screened by live cell suspension and live cell adhesion.

[0072] 7. Analyze and obtain nucleotide sequences

[0073] The monoclonal sequencing results were analyzed by DNAMAN for primary sequence analysis, MEME online software (http: / / meme.sdsc.edu / meme / cgi-bin / meme.cgi) for family analysis, and RNA structure for secondary structure analysis. Sequences with lower energy levels and higher base repeat numbers were selected for comparative analysis with two other high-throughput results, and sequences that existed in common in the sequencing results of the three schemes were identified for affinity and specificity.

[0074] The final nucleotide sequence obtained is: SEQ ID NO.1.

[0075] The nucleotide sequence of the nucleic acid aptamer provided by the present invention can be directly synthesized to supplement the primer sequence.

[0076] In the present invention, biotin, digoxigenin, fluorescent substances, nanoluminescent materials or enzyme markers are combined with the nucleotide sequence shown in SEQ ID NO.1, and the obtained nucleic acid aptamers can achieve the same or similar technical effects as those in Example 1.

[0077] In the present invention, the nucleic acid aptamer with the 5' end of the nucleotide sequence of SEQ ID NO.1 labeled with a thiol group -SH or an amino group -NH2 can achieve the same or similar technical effects as those of Example 1.

[0078] refer to Figure 1a-1c ,With the increase of screening rounds, the ratio of recovery to input amount of the three screening methods gradually increased, indicating that the library was gradually enriched.

[0079] refer to Figure 2 ,To further clarify whether the library has been enriched, the libraries from rounds 4 to 7 were detected by confocal microscopy.,The results showed that the three screening methods were enriched in rounds 6, 7, and 8, respectively.

[0080] refer to Figure 3A-Figure 3F After determining the library enrichment rounds, the three libraries were sequenced. The first screening method used monoclonal sequencing, and the other two used high-throughput sequencing. The sequences were analyzed by MEME software and RNAstructure. Nine sequences were selected from the monoclonal sequencing results, compared with the two high-throughput results, and repeated sequences were selected. Finally, five candidate sequences (M4, M15, M22, M53 and M56) were determined. The binding ability of the five candidate sequences to fixed MSCs and live MSCs was compared by flow cytometry. The results showed that the five sequences bound to MSCs, regardless of whether the MSCs were fixed or not and what system they were in.

[0081] refer to Figure 4 The present invention not only detected the specificity of aptamer M4 to rabbit MSCs, but also analyzed the specificity of aptamer M4 to human MSCs. The results showed that aptamer M4 did not bind to rabbit PBMC, Kidney cells, human lo2 and beas-2b, but bound to human MSCs ( Figure 4 This indicates that aptamer M4 may be suitable for clinical practice. Figure 4 As shown in Figure C, the mean fluorescence intensity of MSCs increased with the increase of aptamer concentration (0, 150, 250, 500, 750 or 1000 nM), and the Kd of aptamer M4 was calculated to be in the nanomolar (51.82 nM) range. Cytotoxicity tests showed that the proportion of live MSCs after incubation with aptamer M4 was 92.67% ( Figure 4 This result indicates that aptamer M4 has little cytotoxicity to MSCs.

[0082] refer to Figure 5 After isolating MSCs from whole bone marrow by aptamer-coupled magnetism, their morphology and characteristics were detected and recorded. MSCs were observed by inverted microscope after 0, 24 or 72 hours of culture. The results showed that only a few MSCs were isolated in the simple magnetic bead group ( Figure 5 AC), while the aptamer magnetic beads group showed significant growth of MSCs with spindle-like and fibroblast-like morphology ( Figure 5 DF).

[0083] To evaluate the effectiveness of isolating MSCs using aptamer magnetic beads, their differentiation capacity and surface markers were examined. Flow cytometric analysis showed that these MSCs were positive for CD29 and CD44, but negative for CD45 ( Figure 5 GI). After three weeks of osteogenic induction, Alizarin red staining revealed the extensive formation of mineralized nodules ( Figure 5 J). After chondrogenesis induction, visible cartilage tissue appeared and the acidic mucopolysaccharide was vividly stained blue by Alcian blue ( Figure 5 K). Collectively, these findings confirm that the aptamer magnetic bead cell sorting system can isolate MSCs from whole bone marrow while maintaining their differentiation potential.

[0084] Example 2

[0085] Verification of DNA aptamer specificity for rabbit bone marrow mesenchymal stem cells.

[0086] The key to the application of aptamers lies in specificity. The applicant uses rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells to verify whether the DNA aptamer of rabbit bone marrow mesenchymal stem cells has specificity. At the same time, the applicant verifies the binding force of the aptamer to human bone marrow mesenchymal stem cells, and verifies the binding of the aptamer to human normal liver cells (Lo2) and normal human lung epithelial cells (beas-2b). It has been verified that the sequence 1 aptamer produces very strong fluorescence after binding to rabbit and human bone marrow mesenchymal stem cells, and has no obvious fluorescence with rabbit peripheral blood mononuclear cells (PBMC) and rabbit kidney cells (kidney cells), human normal liver cells (Lo2) and normal human lung epithelial cells (beas-2b), or does not exceed the background fluorescence. The data of the present invention have proved that the sequence 1 aptamer can not only bind to rabbit bone marrow mesenchymal stem cells, but also has strong specificity.

[0087] Example 3

[0088] Construction of 3WJ RNA nanoparticles.

[0089] 1. Design and Assembly of 3WJ Nanoparticles

[0090] 3WJ RNA nanoparticles were constructed using a bottom-up approach. 3WJ-M4-CkipsiRNA-Alexa647 consists of four parts: 3WJ as the core scaffold, M4 as the target ligand targeting MSCs, CkipsiRNA as the therapeutic agent, and Alexa647 as the fluorescent tracer. Nanoparticles without aptamer M4 or CkipsiRNA were used as controls. All sequences are as follows: lowercase letters are 2'F modifications.

[0091] 3WJ:sense strand:

[0092] 5'-uuGccAuGuGuAuGuGGGGGAGGuAAAAGAuGAGAAAuu-3'

[0093] 3WJ-Alexa 647:

[0094] 5'-cccAcAuAcuuuGuuGAucc(Alexa 647)-3'

[0095] M4:

[0096] 5'GCAATGGGTACGGTACTTCCATTGGTCTTCGCGATCAATTCGCTACGCGCGCCT AGCCTGCAAAAGTGCACGCTACTTTGCTAACCCGGATCAATCATGGCAA-3'

[0097] Antisense:5'-uuucucAucuuuuAccuccuu-3'

[0098] The four sequences were mixed in PBS buffer (1×PBS, pH 7.4, 50mM MgCl2) with equimolar concentrations, heated to 95°C, slowly cooled to 4°C within 45 minutes, and electrophoresed through 12% PAGE polyacrylamide gel at 4°C, 100V in TBE (89mM Tris, 200mM borate acid, and 5mM MgCl2) electrophoresis buffer, and observed under a gel imaging system after Gelred staining.

[0099] 2.3 Serum stability test of WJ nanoparticles

[0100] A volume of 10 μL of nanoparticles with a concentration of 500 nM was placed in 10% fetal bovine serum and cultured continuously at 37°C for 24 hours. Samples were taken out at 0, 0.5, 1, 2, 4, 8, 12 and 24 hours, and electrophoresis and imaging observation were performed under the above conditions.

[0101] 3. Detection of Nanoparticle Characteristics by Transmission Electron Microscopy, Dynamic Light Scattering and Zeta Potential

[0102] The particle size (or zeta potential) was measured using a Zetasizer Nano ZSP nanoparticle size potential analyzer from Malvern Panalytical. The test temperature was 25°C, the test angle was 173°, the He-Ne laser power was 10mW, and the wavelength was 633nm. The morphological characteristics were detected by transmission electron microscopy.

[0103] The results are as follows Figure 6 As shown, 3WJ of phi29 pRNA (3WJ pRNA) can be used as a core scaffold to connect different modules, including the therapeutic agent CkipsiRNA, the MSCs aptamer M4, and Alexa 647 as an imaging module. PAGE gel electrophoresis showed efficient assembly of nanoparticles ( Figure 6 Transmission electron microscopy (TEM) and dynamic light scattering (DLS) showed that the size of 3WJ-M4-CkipsiRNA nanoparticles was 6.66±0.83nm. The zeta potential of the nanoparticles was -13.57±0.61mV ( Figure 6 Serum stability results showed that the nanoparticles remained stable within 24 hours without significant degradation ( Figure 6 (shown in F).

[0104] Example 4

[0105] Study on the effect of 3WJ-M4-CkipsiRNA on the osteogenic differentiation ability of MSCs.

[0106] 1. Detect the binding of 3WJ-M4-CkipsiRNA complex to MSCs by flow cytometry.

[0107] About 5×10 5 MSCs were trypsinized and washed twice with PBS. After centrifugation at 1500 rpm for 5 minutes, MSCs were incubated with 3WJ-M4-CkipsiRNA (100 nM) in 100 μL PBS solution at 37°C for 40 minutes. Then, MSCs were washed and resuspended in PBS and analyzed by flow cytometry.

[0108] 2. Confocal microscopy to detect the binding of 3WJ-M4-CkipsiRNA complex to MSCs

[0109] MSCs and OBs were trypsinized and seeded into confocal culture dishes overnight. After washing twice with PBS, the cells were incubated with 100 nM 3WJ-M4-CkipsiRNA nanoparticles at 37 °C for 40 min. MSCs were then washed with PBS and fixed with 4% paraformaldehyde for 30 min. Alexa Fluor 488phalloidin and DAPI were used to stain the cytoskeleton and nucleus, respectively. Then, confocal microscopy was used for detection.

[0110] 3. Detection of the effect of 3WJ-M4-CkipsiRNA on the osteogenic differentiation ability of MSCs

[0111] 2×10 4 MSCs were seeded in 6-well plates. When the cell fusion reached about 60%, 3WJ-M4-CkipsiRNA (100nM) was added. 3WJ-M4 and 3WJ-CkipsiRNA were used as control groups. After continuous culture for 48 hours, the expression of osteogenic genes OPN, OCN and BMP2 was detected by qPCR and Western blot.

[0112] The results are as follows Figure 7 and Figure 8 As shown, confocal and flow cytometry results showed that 3WJ-M4-CkipsiRNA could efficiently bind to MSCs and deliver the targeted therapeutic agent CkipsiRNA into MSCs ( Figure 7 qPCR and Western blot results showed that 3WJ-M4-CkipsiRNA could promote the osteogenic differentiation of MSCs ( Figure 8 (shown in FG).

[0113] Example 5

[0114] Establishment of femoral head necrosis model and intervention study.

[0115] 1. Twenty-four 2-month-old Japanese white rabbits (weight 2.5±0.5kg) were selected and supplied by Wuhan Wanqian Jiaxing Biotechnology Co., Ltd. (No. SCXK Hubei 2023-0011, Animal Certification No.: 42815900000180), regardless of gender, and were kept in single cages. All animal experiments were approved by the Ethics Committee of the Third Hospital of Wuhan University and followed the Guide for the Care and Use of Laboratory Animals.

[0116] After one week of adaptive feeding, the femoral head articular surface was exposed under sterile conditions and frozen with liquid nitrogen for 3-5 minutes until the color of the articular cartilage turned white. The femoral head was immediately rewarmed in 37°C saline for 3 minutes. The incision was sutured. Then 800KU of penicillin was injected intramuscularly for 5 consecutive days.

[0117] Rabbits were divided into four groups (6 mice in each group): (1) model group; (2) 3WJ-CkipsiRNA group, 100 μM, 500 μL PBS solution; (3) 3WJ-M4 group, 100 μM, 500 μL PBS solution; (4) 3WJ-M4-CkipsiRNA group, 100 μM, 500 μL PBS solution. Drugs were administered by ear vein injection at 1 week and 3 weeks after model establishment.

[0118] 2. Nanoparticle tissue distribution and organ toxicity detection

[0119] Rabbits were injected with 3WJ-M4-siRNA-Alexa 647 for 12 hours, and then the fluorescence distribution of organs (heart, liver, spleen, lung, kidney, and femur) was imaged using the IVIS Lumina LT imaging system. In addition, the toxicity of these organs was detected by HE staining.

[0120] 3.Masson test for femoral head repair

[0121] After the rabbits were anesthetized and killed, the femoral heads were fixed with 4% paraformaldehyde, rinsed with pure water after 24 hours, and then embedded in paraffin. After a series of treatments, the specimens were prepared with a freezing microtome with a thickness of 2 to 3 μm, and the tissue sections were stained with Masson trichrome. Under a microscope, collagen and cartilage were stained blue. Then, the modified O'Driscoll histological scoring scale was used for histological scoring to evaluate the degree of repair.

[0122] 4. Gross observation and microCT analysis of femoral head necrosis repair

[0123] The femoral head was examined using microCT (skyscan1276, Bruker), with the following scanning parameters: filter was Al+Cu, and resolution was 20 μm.

[0124] The results are as follows Fig. 9 As shown in the figure, 12 hours after intravenous administration, organ imaging results showed that the fluorescence was mainly concentrated in the femur, and no obvious fluorescence was observed in other organs ( Fig. 9 HE staining showed that there was no obvious inflammatory cell infiltration in peripheral organs (heart, liver, lungs and kidneys). The above results show that 3WJ-M4-CkipsiRNA can target and accumulate in the femur without obvious organ toxicity ( Fig. 9 (as shown in B1-B4).

[0125] 2. Masson staining was used to detect the histological changes of the necrotic femoral head at 8 weeks. The data showed that compared with the model group, 3WJ-CkipsiRNA group and 3WJ-M4 group, the combined treatment (3WJ-M4-CkipsiRNA) group contained abundant cartilage and bone tissue, which basically completely covered the necrotic femoral head ( Fig. 9 (shown in C1-C4).

[0126] 3. At 8 weeks, the repair performance of the necrotic femoral head was evaluated using gross morphology and CT images. The model group, 3WJ-CkipsiRNA group, and 3WJ-M4 group had obvious bone defects and femoral head collapse, with large bone defects and less cartilage coverage ( Fig. 9 In the 3WJ-M4-CkipsiRNA group, the necrotic femoral head was basically repaired, covered with hyaline cartilage, and the regenerated femoral head was smooth and regular ( Fig. 9 CT and 3D printing images showed that the femoral head was destroyed, the density was uneven, and the subchondral bone trabeculae were missing and disordered in the model group, 3WJ-CkipsiRNA group, and 3WJ-M4 group ( Fig. 9 Figures E1-E3, F1-F3); The Ad-Runx2 group had normal morphology, uniform density, regular arrangement of trabeculae, and no fractures ( Fig. 9 (shown as E4 and F4 in the middle).

[0127] In the absence of conflict, the above embodiments and features in the embodiments may be combined with each other.

[0128] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A nucleic acid aptamer for detecting rabbit bone marrow mesenchymal stem cells, characterized in that: The nucleic acid aptamer includes a DNA fragment as shown in SEQ ID NO.

1.

2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid aptamer also includes a complex that is combined with biotin, digoxin, a fluorescent substance, a nano-luminescent material or an enzyme label on the DNA fragment.

3. The nucleic acid aptamer according to claim 2, characterized in that The fluorescent substance is a FAM fluorescent group or a Cy5 fluorescent group; and / or, the nano luminescent material is a quantum dot or an up-conversion nanoparticle; and / or, the enzyme marker is horseradish peroxidase or sucrase.

4. A detection kit for detecting rabbit bone marrow mesenchymal stem cells, characterized in that: The invention comprises the nucleic acid aptamer according to any one of claims 1 to 3.

5. Use of a nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO. 1 in claim 1 in the preparation of a product for recruiting rabbit bone marrow mesenchymal stem cells.

6. Use of a nucleic acid aptamer whose nucleotide sequence is shown as SEQ ID NO. 1 in claim 1 in preparing a biological probe for identifying rabbit bone marrow mesenchymal stem cells.

7. A 3WJ RNA nanoparticle comprising the nucleic acid aptamer according to claim 1, characterized in that: The 3WJRNA nanoparticle is 3WJ-M4-CkipsiRNA, wherein 3WJ is a core scaffold, M4 is a target ligand targeting MSCs, and CkipsiRNA is a therapeutic agent.

8. The 3WJ RNA nanoparticle according to claim 7, characterized in that The 3WJ RNA nanoparticles further include a fluorescent tracer, which is Alexa647.

9. The 3WJ RNA nanoparticle according to claim 7 or 8, characterized in that The 3WJ RNA nanoparticles promote osteogenic differentiation of mesenchymal stem cells.

10. The 3WJ RNA nanoparticle according to claim 7 or 8, characterized in that The 3WJ RNA nanoparticles were targeted and accumulated in the femur.

Images