Cat serum albumin recombinant protein and expression method thereof in hansenula polymorpha

Abstract

The invention discloses recombinant hansenula polymorpha for efficiently producing cat serum albumin and an expression method of the recombinant hansenula polymorpha. According to the method, an expression cassette of the cat serum albumin is integrated in hansenula polymorpha, and a promoter in hansenula polymorpha is optimized, so that the serum albumin is expressed by a constitutive promoter and a sucrose inducible promoter independently or in a combined manner, and the copy number of the serum albumin is further optimized; the stable and efficient expression of the cat serum albumin gene in hansenula polymorpha is successfully realized. The high-density fermentation yield of the recombinant cat serum albumin fermented by using the engineering bacteria can reach 1.7-2.2 g / L.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the construction of a recombinant feline serum albumin expression vector and the expression of the vector in Hansenula. Background Art

[0002] Animal serum albumin is a protein with the highest content and multiple functions in serum. Serum albumin is a globular non-glycosylated protein with a molecular weight of 66KDa. It is a carrier of various endogenous factors and exogenous drugs. It is mainly used clinically to treat shock caused by blood loss or trauma, hypoalbuminemia, edema caused by liver cirrhosis and kidney disease, and other diseases.

[0003] In recent years, the pet market has grown rapidly, and the demand for albumin in the pet market such as cats and dogs has increased sharply. However, the current source of albumin for treating pet diseases still relies on human serum albumin and albumin extracted from animal blood. Studies have found that about 30% of pets given human serum albumin have serious side effects such as severe edema, inflammation, coagulation disorders, skin lesions, vomiting, high blood pressure, and even death. In addition, the insufficient supply of animal serum, the complex serum sources, and the risk of virus transmission through blood have severely limited the industrial production of animal serum albumin. Therefore, researchers began to turn their research targets to the heterologous production of animal serum albumin.

[0004] So far, the expression of serum albumin has been mainly studied on human serum albumin, and there are few studies in the pet field. The patent KR102435211B1 applied by the Korean research team successfully expressed cat serum albumin using rice suspension cells, and the patent CN 111118018B successfully expressed cat serum albumin in Pichia pastoris. The patent CN109879958A applied by the Military Medical Research Institute of the Chinese People's Liberation Army Academy of Military Sciences uses the recombinant yeast to express low-glycosylated human serum albumin by reducing or inhibiting the activity of PMT1 protein in yeast cells.

[0005] In the yeast expression system, methanol-trophic Hansenula has a high expression level of heterologous proteins (up to 200-700 mg / L protein in the prior art), the expressed proteins have less glycosylation modification, can tolerate high temperatures, have a fast growth rate, and are suitable for high-density large-scale fermentation production of target proteins. Since methanol-trophic Hansenula requires methanol to induce the expression of target proteins, there are still major safety risks in large-scale fermentation production.

[0006] In summary, the production of feline serum albumin using Hansen yeast as chassis cells is still in the development stage. The present invention aims to construct a safe and high-yield recombinant strain of feline serum albumin to promote the large-scale application and production of feline serum albumin. Summary of the invention

[0007] The technical problem to be solved by the present invention is to solve the problems of low expression of recombinant feline serum albumin in the prior art, methanol toxicity and explosion-proof problems in methanol-induced recombinant protein production, high cooling cost during fermentation, and the like.

[0008] The present invention provides a recombinant Hansenula cell strain capable of expressing feline serum albumin or a fusion protein containing feline serum albumin. Preferably, a gene element capable of efficiently expressing serum albumin is integrated into Hansenula polymorpha, and the gene elements are: different types of promoter elements, signal peptides, feline serum albumin genes, and terminator elements. The promoter is an endogenous promoter of Hansenula, including a constitutive promoter: a glyceraldehyde-3-phosphate dehydrogenase gene promoter (P GAP ), plasma membrane ATPase gene promoter (P PMA1 ), translation elongation factor 1-α promoter (P TEF1 ), alcohol dehydrogenase gene promoter (P ADH1 ); Inducible promoter: Maltase gene promoter (P MAL ), methanol oxidase gene promoter (P MOX ), formate dehydrogenase gene promoter (P FMD ), formaldehyde dehydrogenase gene promoter (P FLD1 ), dihydroxyacetone synthase gene promoter (P DAS ), isocitrate lyase gene promoter (P ICL1 ).

[0009] The preferred promoter is an endogenous promoter in the Hansenula cell strain, P GAP , P PMA1 , P MAL , P MOX .

[0010] "Albumin" is a naturally occurring protein in mammalian plasma that plays an important role in maintaining the required osmotic pressure of the blood and in the transport of various substances in the bloodstream. Albumins from many species have been characterized and they share a high degree of sequence and structural homology.

[0011] The albumin in the present invention is selected from albumin of the cat family, and the feline serum albumin (FSA) recombinant protein comprises the following amino acid sequence or an amino acid sequence having more than 85% homology thereto: the amino acid sequence shown in SEQ ID No.1.

[0012] Codon optimization is performed according to the codon usage frequency of Hansenula, and the optimized sequence is specifically shown in SEQ ID No. 2. The nucleotide sequence shown in the codon-optimized feline serum albumin of the present invention, and its variants. The variant has a nucleotide sequence with at least 85% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with SEQ ID No. 2. The differences are caused by substitution, deletion or addition of bases.

[0013] The terminator element is a common yeast terminator in the art. The termination regulation function of the terminator is indispensable for yeast gene expression, and different terminators have different termination activities, which can affect the process of mRNA 3' end, the stability of mRNA, play an important role in completing transcription and affecting the half-life of mRNA, and affect the production of net protein by affecting the half-life of mRNA. The preferred terminator of the present invention is AOX1 terminator (T AOX1 ).

[0014] The present invention also provides strains expressing albumin using a combination of multiple promoters, including expression of a single copy of an albumin expression element in Hansenula, including P GAP -FSA-T AOX1 , P MAL -FSA-T AOX1 , P PMA1 -FSA-T AOX1 , P MOX -FSA-T AOX1 ; Expression of multiple copies of albumin expression elements in Hansenula, including (P GAP -FSA-T AOX1 )2、(P GAP -FSA-T AOX1 )3、(P MAL -FSA-T AOX1 )2、(P MAL -FSA-T AOX1 )3. P GAP -FSA-T AOX1 -(P MAL -FSA-T AOX1 2. P MAL -FSA-T AOX1 -(P GAP -FSA-T AOX1 )2.

[0015] Preferably, the expression element with a higher expression level of feline serum albumin is (P MAL -FSA-T AOX1)2、(P MAL -FSA-T AOX1 )3. P GAP -FSA-T AOX1 -(P MAL -FSA-T AOX1 )2;

[0016] The preferred expression conditions of the recombinant Hansenula expression strain in the present invention are: culture temperature 30°C-40°C, pH 5.0-7.0, preferably 35°C, 36°C, 37°C, 38°C; pH 5.0, pH 5.5, pH 6.0, pH 6.5, pH 7.0.

[0017] The inducing agent for inducing expression in the present invention is other sugars except glucose, preferably sucrose, maltose, etc., wherein the concentration of sucrose is 1%-8%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%. And methanol, its concentration is 0.1%-5%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%.

[0018] The beneficial effects of the invention are summarized as follows.

[0019] In large-scale industrial fermentation production, production costs and the safety of pharmaceutical proteins are crucial factors for market considerations. Hansen yeast is a biosafety microorganism (GRAS) with many advantages such as high efficiency, safety and economy. The protein glycosylation level of Hansen yeast is similar to that of mammalian cells, which makes the protein preparations produced by it have good biological activity and low immunogenicity; it is the most heat-resistant yeast, with a maximum growth temperature of 50°C, so it can reduce the condensation cost of industrial fermentation and is suitable for large-scale industrial production. The technology of heterologous expression of cat serum albumin in Hansen yeast is still in the exploratory stage.

[0020] The present invention performs codon optimization on the nucleotide sequence of feline serum albumin in the Hansenula expression system, further uses different endogenous promoters in Hansenula to efficiently and safely produce feline serum albumin dedicated to the pet market, replaces the traditional methanol-inducible promoter, and realizes the expression of serum albumin by a constitutive promoter and a sucrose-inducible promoter alone or in combination, further optimizes the method for the copy number of serum albumin, and successfully realizes the efficient expression of feline serum albumin in Hansenula.

[0021] The expression levels of recombinant feline serum albumin from recombinant strains of Hansenula spp. were significantly different: the sucrose-inducible promoter P MAL and the constitutive promoter P GAP The expression level of albumin in the recombinant Hansenula was higher than that in the recombinant Hansenula containing the constitutive promoter P PMA1 and methanol-inducible promoter PMOX Optimization results for different copy numbers and promoter combinations: GAP The expression level of multi-copy recombinant bacteria of promoter is related to P GAP The expression levels of single-copy recombinant bacteria were basically the same, but the sucrose-induced P MAL The expression levels of serum albumin by the recombinant bacteria S-(Mal-FSA)2 and S-(Mal-FSA)3 with multiple copies of serum albumin using the promoter were significantly higher than those by the recombinant bacteria S-Mal-FSA with a single copy number. Secondly, the expression levels of feline serum albumin by the recombinant bacteria S-Mal-FSA(Gap-FSA)2 and S-Gap-FSA-(Mal-FSA)2 with different copy numbers and different promoter combinations were significantly higher than those by the recombinant bacteria S-Mal-FSA(Gap-FSA)2 with only P. GAP Therefore, in Hansenula, promoter P MAL The expression of feline serum albumin not only has the significant advantage of high expression level, but also its induction conditions are mild and safe, which is more conducive to large-scale production than traditional methanol-inducible promoters.

[0022] The present invention contains a sucrose-inducible promoter P MAL The recombinant feline serum albumin yeast cell lines S-(Mal-FSA)2 and S-(Mal-FSA)3 expressed 1.7 and 2.2 g / L, respectively, after 6 days of high-density fermentation in a fermenter; the three-copy recombinant Hansen yeast composed of a sucrose-inducible promoter and a constitutive promoter: S-Gap-FSA-(Mal-FSA)2, expressed up to 2.0 g / L after 6 days of high-density fermentation in a fermenter.

[0023] Compared with the feline serum albumin expressed by Pichia pastoris in the prior art, the feline serum albumin expressed by the recombinant Hansenula modified by the present invention has greater safety and cost advantages in large-scale production.

[0024] Instruction Manual

[0025] Figure 1 Schematic representation of the feline serum albumin cloning vector.

[0026] Figure 2 SDS-PAGE electrophoresis of cat serum albumin regulated by different promoters in shake flask fermentation. 1: S-Gap-FSA; 2: S-Mal-FSA; 3: S-Pma1-FSA; 4: S-Mox-FSA.

[0027] Figure 3SDS-PAGE electrophoresis of cat serum albumin with different copy numbers in shake flask fermentation. Among them, 1: S-(Gap-FSA)2, 2: S-(Gap-FSA)3, 3: S-Mal-FSA-(Gap-FSA)2, 4: S-Gap-FSA-(Mal-FSA)2, 5: S-(Mal-FSA)2, 6: S-(Mal-FSA)3.

[0028] Figure 4 SDS-PAGE electrophoresis of feline serum albumin produced in a fermenter. 1: S-(Mal-FSA)3, 2: S-Gap-FSA-(Mal-FSA)2, 3: S-(Mal-FSA)2.

[0029] Figure 5 Spectrum of recombinant feline serum albumin. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments.

[0031] Example 1: Artificial synthesis of codon-optimized albumin gene

[0032] The feline serum albumin gene is derived from animals, and its codons are similar to those of eukaryotic organisms. However, there are still some differences in gene codon preferences between mammals and yeast, and this difference is likely to affect the stability and expression efficiency of animal serum albumin genes and their transcription products in Hansenula cells. In order to increase the fermentation yield of feline serum albumin, the inventors optimized the codons for Hansenula based on the published amino acid sequence of feline serum albumin (GenBank No.: NP_001009961.1). The optimization principles include: a) selecting the codons with the highest or higher frequency of use according to the frequency table of the genetic code of Hansen yeast; b) avoiding negative regulatory elements that have potential effects on gene transcription or protein translation, such as PolyAT region, PolyGC region, silencer region and internal splicing sites; c) conducting a comprehensive analysis of the mRNA secondary structure of the feline serum albumin coding region to avoid the formation of complex secondary structures and reduce the free energy of the mRNA secondary structure; d) using a 5′UTR region that is completely consistent with the natural sequence downstream of the Hansen yeast promoter as much as possible upstream of the coding region; e) eliminating commonly used restriction endonuclease recognition sites. Based on the above principles, without changing its amino acid sequence (see SEQ ID No. 1), the new feline serum albumin sequence (SEQ ID No. 2) was commissioned to be artificially synthesized by Genewise Company.

[0033] Example 2 Construction of Hansenula integrative vectors with different promoters

[0034] The steps for constructing the integrative vector of feline serum albumin gene are as follows: using plasmid pGAPzαA (purchased from Invitrogen) as a template, designing vector backbone primers BB-F:TCGAATAATAACTGTTATTTTTCAGTGTTC and BB-R:GTTTGTAGCCTTAGACATGACTG, using the above primers to PCR amplify the plasmid backbone sequence, and the amplified fragment is named F-BB; using the primers P described in Table 1 GAP -F, P GAP -R PCR amplified yeast promoter sequence, and the amplified fragment was named F-gap (SEQ ID No.3); the yeast signal peptide sequence was amplified using primers Signal-F and Signal-R described in Table 1, and the amplified fragment was named F-SP; the feline serum albumin sequence was amplified using primers FSA-F and FSA-R described in Table 1, and the amplified fragment was named F-FSA. The four fragments obtained by the above amplification were mixed in a ratio of 1:1:1:1, and 10μl seamless cloning enzyme (purchased from ABclonal) was added, and finally sterile water was added to a total volume of 20μl, and the connection was carried out at 50℃ for 1-2h, and the connection product was transferred to Escherichia coli DH5α, cultured at 37℃ overnight, and a single clone was selected for PCR sequencing verification. The verified correct vector was named pWSJ01-P GAP -FSA-T AOX1 , the schematic diagram is as follows Figure 1 shown.

[0035] The vector pWSJ01-P obtained in the above construction GAP -FSA-T AOX1 Based on this, different types of promoter sequences were further replaced, including the constitutive promoter P PMA1 , inducible promoter P MAL and P MOX The steps for replacing the promoter of the feline serum albumin vector are as follows: use primers pWSJ-FSA-R: ATGAGATTTTCCTTCAATTTTTACTGC and pWSJ-FSA-F: TCGAATAATAACTGTTATTTTTCAGTGTTC to amplify the plasmid backbone containing feline serum albumin, and the amplified fragment is named F-PWSJ-FSA; use primers P in Table 1 PMA1 -F and P PMA1 -R PCR amplification of promoter FP PMA1 (SEQ ID No. 4); using primer P in Table 1 MAL -F, PMAL -R PCR amplification of promoter FP MAL (SEQ ID No.5); using primer P in Table 1 MOX -F, P MOX -R PCR amplification of promoter FP MOX (SEQ ID No.6); the amplified feline serum albumin vector was mixed with the above three promoter fragments in a ratio of 1:1, and the feline serum albumin vector was mixed with the above three promoter fragments in a ratio of 1:1 in the same way, and connected at 50°C for 1-2h. The ligation products were respectively transferred into Escherichia coli DH5α, and PCR verification and sequencing were performed using verification primers test-F: CATGACATTAACCTATAAAAATAGGCG and test-R: TCTTTTCTCGAGAGATACCCCTT C. The vectors with correct sequencing were named: pWSJ02-P MAL -FSA-T AOX1 、pWSJ03-P PMA1 -FSA-T AOX1 、pWSJ04-P MOX -FSA-T AOX1 .

[0036] Table 1 Cloning vector primers

[0037]

[0038]

[0039] Example 3 Construction of Hansenula cell line expressing feline serum albumin

[0040] 3.1 Plasmid extraction and restriction digestion of recombinant expression vector

[0041] Pick the four E. coli colonies containing the recombinant expression plasmid obtained in Example 1, expand the culture, extract the plasmid, and use the restriction endonuclease BglⅡ or SacⅡ to linearize it at 37℃ for 2-4h. The reaction after enzyme digestion is extracted once with an equal volume of phenol: chloroform (1:1, v / v), and then precipitate with ethanol to recover the DNA. After precipitation at -20℃ for more than 2h, centrifuge at 14000rpm for 10min, wash twice with ice-cold 70% ethanol, and dry until there is no ethanol. Dissolve the DNA with a certain volume of sterile water, and measure the OD 260 DNA was quantified to make the concentration of linearized fragments about 100 ng / μl and stored in a -20°C refrigerator for later use.

[0042] 3.2 Preparation of competent cells of Hansenula

[0043] A single clone of the Hansen yeast NCYC495 strain preserved in our laboratory was selected and inoculated into a test tube containing 5 ml of YPD (1% yeast extract, 2% peptone, 2% glucose) medium, and grown overnight at 37°C and 200 rpm. 0.5 ml of the above culture was added to 500 ml of fresh YPD medium and cultured at 37°C and 200 rpm until OD 600 =1.3–1.5, centrifuge at 4°C, 5000rpm for 5min, and discard the supernatant. Resuspend the cells in 200ml 0.1M phosphate buffer (containing 25mM DTT, pH7.5), mix well, incubate at 37°C for 30min, centrifuge at 5000rpm for 10min, and discard the supernatant. Resuspend the cells in 20ml 1M sorbitol precooled on ice, centrifuge at 4°C, 5000rpm for 5min, and discard the supernatant. Repeat the above steps once, and finally resuspend the cells in 1ml 1M sorbitol precooled on ice, put on ice, and prepare for transformation.

[0044] 3.3 Electrotransformation of Hansenula cells

[0045] The linearized plasmid obtained in the above step: pWSJ01-P GAP -FSA-T AOX1 、pWSJ02-P MAL -FSA-T AOX1 、pWSJ03-P PMA1 -FSA-T AOX1 、pWSJ04-P MOX -FSA-T AOX1 , add 15μl of recombinant Hansen yeast expression plasmid and 30μl of bacterial solution in a ratio of plasmid: bacterial cell = 1:2, mix thoroughly by pipetting, and place in an ice bath for transformation; take out the electroporation cup that was previously soaked in alcohol, irradiated with ultraviolet light, and refrigerated at -20°C, and add the plasmid bacterial mixture; perform electric shock under the conditions of voltage 1500V, resistance 150Ω, and capacitance 50μF; after electric shock, quickly add 1ml of pre-cooled 1M sorbitol solution, mix gently, and transfer to an EP tube; place the electroporated bacterial cells in a 37°C water bath for 2h, and gently invert 3 times every 15min; centrifuge the bacterial solution that has been incubated for 2h at 5000rpm for 10min, and discard the supernatant; resuspend the bacterial cells with 200μl 1M sorbitol solution, and transfer the plasmid pWSJ04-P MOX -FSA-T AOX1 、pWSJ02-P MAL -FSA-T AOX1 The yeast cells were spread on YPD plates containing 100 mg / ml Zeocin; the plasmid pWSJ01-P GAP -FSA-T AOX1 、pWSJ03-P PMA1-FSA-T AOX1 The yeast cells were spread on YPD plates containing 0.4 mg / ml G418 and cultured upside down at 37°C for 3-7 days.

[0046] 3.4 Subculture and stabilization of recombinant Hansenula expression strains

[0047] Pick a single colony of the recombinant strain grown on the Zeocin resistance plate, streak it on a YPD solid plate containing 100 mg / ml Zeocin, and culture it at 37°C for 24-48 hours. After a single colony grows, streak it on a YPD solid plate containing 100 mg / ml Zeocin, and so on, pass it 10 times in a row and preserve the strain. The preservation system is YPD culture 24-48h bacterial solution: 60% glycerol = 1:1, preserve the strain according to the required amount, usually 500μl bacterial solution + 500μl 60% glycerol;

[0048] The recombinant Hansen yeast expression strain that was passed 10 times was inoculated into 5 ml YPD liquid medium without Zeocin resistance, and after culturing at 37°C and 200 rpm shaking for 24-48 hours, it was transferred to 50 ml YPD liquid medium at a ratio of 1:100, and so on, and passed 5 times in YPD liquid medium without Zeocin resistance, and the feline serum albumin content in the supernatant was detected in each generation. Finally, Hansen yeasts that stably expressed feline serum albumin were obtained, and were named S-Mox-FSA and S-Mal-FSA respectively; in the same treatment method, the recombinant strain monoclonal clone grown on the G418 resistance plate was picked, and passed 10 times on the YPD plate containing 0.4 mg / ml G418, and after 5 times in the liquid medium without G418 resistance, Hansen yeast strains that can stably express feline serum albumin were obtained, and were named S-Pma1-FSA and S-Gap-FSA respectively.

[0049] Example 4 Feline serum albumin shake flask expression screening

[0050] A single colony of constitutively expressed recombinant Hansen yeast (S-Pma1-FSA and S-Gap-FSA) was picked and inoculated into 5 ml YPD liquid culture medium, cultured at 37°C 200 rpm for 24 h, transferred to 30 ml YPD culture medium at a 1% inoculation rate, cultured at 37°C 200 rpm in a shaking incubator for 72 h, and then sampled.

[0051] Pick a single colony of inducible recombinant Hansen yeast (S-Mox-FSA and S-Mal-FSA), culture S-Mal-FSA in YPD medium for 24-48 hours, then transfer 2% to YP medium containing 2% sucrose for fermentation for 72 hours, and take samples every 24 hours for testing. S-Mox-FSA was inoculated into 5 ml BMGY liquid medium, cultured at 37°C 200 rpm for 24 hours, and the cells in BMGY were collected by centrifugation (5,000 g, 5 min), washed twice with sterile water (precooled) and collected by centrifugation (5,000 g, 5 min), and resuspended in 50 mL BMMY medium until OD 600 =1, shake flask fermentation, add 0.5% methanol every 12 hours, and take samples for electrophoresis detection.

[0052] The sampled bacterial solution was centrifuged at 12000 rpm for 10 min, and the supernatant was collected for SDS-PAGE detection. The expression results were as follows: Figure 2 As shown, the results showed that the expression levels of different promoters of feline serum albumin were significantly different, containing P MAL Promoter and P GAP The expression level of recombinant Hansenula spp. containing P PMA1 and P MOX The expression level of recombinant Hansenula spp. was lower than that of P MAL and P GAP .

[0053] Example 5 Optimization of feline serum albumin genome copy number

[0054] In order to further improve the yield of feline serum albumin expressed in Hansenula, the inventors optimized the copy number of feline serum albumin in the Hansenula genome and the combined use of promoters with different strengths.

[0055] According to the results of serum albumin expression levels of different promoters in Example 3, as shown in Table 2, integration vectors containing different copy numbers were constructed.

[0056] 5.1 Construction of two copies of feline serum albumin vector:

[0057] The plasmid vector pWSJ01-P constructed in Example 1 was digested with restriction endonuclease BglⅡ. GAP -FSA-T AOX1 , using the primers GAP-2-F and GAP-2-R in Table 2, PCR amplified the cat albumin expression element (including P GAP -FSA-T AOX1), the feline albumin expression elements amplified by PCR were inserted into the above digested vectors respectively, and the insertion method was the same as that in Example 2-seamless cloning. The vector successfully constructed by sequencing was named pWSJ05-(P GAP -FSA-T AOX1 )2

[0058] The same construction method was used to digest pWSJ02-P with BglⅡ. MAL -FSA-T AOX1 Primers Mal-2-F and Mal-2-R were used to amplify the feline albumin expression element by PCR, and the seamless clone enzyme was connected and verified. The vector with the correct sequence was named: pWSJ06-(P MAL -FSA-T AOX1 )2.

[0059] 5.2 Construction of three-copy feline serum albumin vector:

[0060] The vector pWSJ05-(P GAP -FSA-T AOX1 )2, using the primers GAP-2-F and GAP-2-R in Table 2, PCR amplified the feline albumin expression element, and the PCR amplified products were respectively inserted into the vectors after the above restriction digestion. The insertion method was the same as that in Example 2-seamless cloning. The vector successfully constructed by sequencing was named pWSJ07-(P GAP -FSA-T AOX1 )3.

[0061] pWSJ06-(P MAL -FSA-T AOX1 )2, primers Mal-2-F and Mal-2-R were used to amplify the feline albumin expression element by PCR, and the seamless clone enzyme was connected and verified. The vector with correct sequencing was named: pWSJ08-(P MAL -FSA-T AOX1 )3.

[0062] The vector template pWSJ06-(P MAL -FSA-T AOX1 )2; Use primers GAP-3-F and GAP-3-R in Table 2 to clone a single copy of pWSJ01-P GAP -FSA-T AOX1 The vector was used as a template to PCR amplify the feline albumin expression element FP GAP -FSA; insert the amplified target fragment into the vector after restriction digestion by seamless cloning, and the vector verified by sequencing is named: pWSJ09-P GAP-FSA-T AOX1 -(P MAL -FSA-T AOX1 )2.

[0063] The vector template pWSJ05-(P GAP -FSA-T AOX1 )2, using primers Mal-3-F and Mal-3-R in Table 2, with a single copy of pWSJ02-P MAL -FSA-T AOX1 The vector was used as a template to PCR amplify the feline albumin expression element FP MAL -FSA, insert the amplified target fragment into the vector after restriction digestion by seamless cloning, and the vector verified by sequencing is named pWSJ10-P MAL -FSA-T AOX1 -(P GAP -FSA-T AOX1 )2.

[0064] 5.3. Construction of multi-copy feline serum albumin Hansenula cell line

[0065] The constructed vector pWSJ05-(P GAP -FSA-T AOX1 )2. pWSJ06-(P MAL -FSA-T AOX1 )2、pWSJ07-(P GAP -FSA-T AOX1 )3. pWSJ08-(P MAL -FSA-T AOX1 )3. pWSJ09-P GAP -FSA-T AOX1 -(P MAL -FSA-T AOX1 )2 and pWSJ10-P MAL -FSA-T AOX1 -(P GAP -FSA-T AOX1 )2, the vector was linearized and transformed into Hansenula according to the method in Example 2, and the new Hansenula strains obtained were named: S-(Gap-FSA)2, S-(Mal-FSA)2, S-(Gap-FSA)3, S-(Mal-FSA)3, S-Gap-FSA-(Mal-FSA)2 and S-Mal-FSA-(Gap-FSA)2.

[0066] Finally, the multi-copy strain and the single-copy strain were fermented in shake flasks according to the culture conditions in Example 3. The results of SDS-PAGE electrophoresis were as follows: Figure 3 As shown. Figure 1 Compared with the single-copy recombinant strain, P GAP The expression level of the promoter-containing multi-copy recombinant bacteria was basically the same as that of the single-copy recombinant bacteria, but P MAL The expression of feline serum albumin in recombinant bacteria induced by promoter was significantly higher than that in recombinant bacteria with single copy number. Secondly, the expression of feline serum albumin in recombinant bacteria with different copy numbers and different promoter combinations was significantly higher than that in recombinant bacteria with only P GAP The multi-copy strains with relatively good expression in shake flasks are: S-(Mal-FSA)2, S-(Mal-FSA)3 and S-Gap-FSA-(Mal-FSA)2.

[0067] Table 2 Primers for inserting Hansenula into vector

[0068]

[0069]

[0070] Example 6 Fermentation production of feline serum albumin

[0071] The recombinant strains S-(Mal-FSA)2, S-(Mal-FSA)3 and S-Gap-FSA-(Mal-FSA)2 with higher yields in shake flask fermentation were fermented in a fermenter and their fermentation yields were determined. The specific steps are as follows:

[0072] Fermentation seed solution: Take 1 frozen glycerol bacteria, streak on a YPD plate until a single colony grows, inoculate the single colony into 20 ml YPD medium, and culture at 30°C, 200 rpm shaking for 20-24 hours. 600 After the test is qualified, 10 ml is transferred to a bottle of 500 ml YPD medium and cultured at 30°C and 200 rpm in a shaking incubator for 20-24 hours until OD 600 About 10-15, after passing the test, it can be used as fermentation seed liquid.

[0073] Fermentation process: The fermentation starting medium contains 100g yeast powder, 50g peptone, 200g glycerol, basic salt (K2SO491g, MgSO475g, 85% H3PO4140ml, KOH25g), 4L purified water is fully dissolved, added to a 10L fermentation tank, the purified water is adjusted to 4.5L, 121℃, 30min sterilization, cooled to 30℃, and then 20ml PTM1 trace element solution (CuSO4·5H2O6.0g, KI0.088g, MnSO4·H2O3.0g, Na2MoO4·2H2O0.2g, H3BO30.02g, CoCl2·6H2O0.5g, ZnCl220.0g, FeSO4·7H2O65.0g, Biotin 0.2g, leucine 0.04g, concentrated H2SO4 5.0ml, purified water to 1L, 0.22μm filter membrane sterilization), ammonia water to adjust pH 5.6, inoculate 500ml fermentation seed liquid, the fermentation volume is 5L. The initial stirring speed is 400rpm, the air flow rate is 0.5Nm 3 / h, tank pressure 0.5bar, dissolved oxygen value is controlled to be ≧20% during fermentation. After the initial growth period is maintained for about 25h, bacterial liquid A 600nm When the dissolved oxygen reaches about 60, the dissolved oxygen starts to rise rapidly, and the feed medium (50% glycerol (W / V), 12ml PTM1) is added at a flow rate of 12-18ml / L / h. This is the time to enter the fed-batch growth phase. After about 6-8h of culture, the bacterial solution A 600nm When the pH reaches about 90, stop adding and adjust the pH value to 6.0 with ammonia water. After the dissolved oxygen starts to rise, start adding sucrose to enter the induction expression period. The initial sucrose flow rate is 10 ml / h. Samples are taken every hour and the concentration is measured by sucrose electrode (the sucrose flow acceleration is adjusted according to the dissolved oxygen change). The concentration is controlled at <5 g / L by adjusting the sucrose flow rate.

[0074] Centrifugation and expression level detection: After 5-7 days of induction, the cells were removed from the tank (samples were taken every 12 hours during this period) and A was detected. 600nm Record the OD value and detect the wet weight of the bacteria. Collect the wet bacteria by centrifugation at 5000 rpm for 30 min at 4°C and freeze at -20°C for later use (for the next step of protein content determination). In addition, transfer 10 ml of the fermentation broth to a 50 ml centrifuge tube, centrifuge at 10000 rpm for 10 min, take the supernatant, and use the cat serum albumin detection kit (purchased from Jiangsu Jingmei Biotechnology Co., Ltd.) to determine the cat serum albumin content in the fermentation supernatant, and detect it by SDS-PAGE electrophoresis. The results are as follows: Figure 4As shown, the recombinant Hansen yeast S-(Mal-FSA)2, S-(Mal-FSA)3 and S-Gap-FSA-(Mal-FSA)2 can produce 1.7, 2.2 g / L and 2.0 g / L respectively in 6 days of high-density fermentation in fermenters.

Claims

1. A recombinant Hansenula expressing feline serum albumin or a fusion protein comprising feline serum albumin, characterized in that In Hansenula Hansenula polymorpha ) has a gene element for expressing feline serum albumin integrated into its genome.

2. The recombinant Hansenula according to claim 1, characterized in that The gene elements are: promoter element, signal peptide, cat serum albumin gene and terminator element in sequence; Preferably, the promoter is an endogenous promoter of Hansenula, specifically: glyceraldehyde-3-phosphate dehydrogenase gene promoter P GAP , plasma membrane ATPase gene promoter P PMA1 , translation elongation factor 1-α promoter P TEF1 , alcohol dehydrogenase gene promoter P ADH1 ; or inducible promoter: maltase gene promoter P MAL , methanol oxidase gene promoter P MOX , formate dehydrogenase gene promoter P FMD , formaldehyde dehydrogenase gene promoter P FLD1 , dihydroxyacetone synthase gene promoter P DAS , isocitrate lyase gene promoter P ICL1 ; The cat serum albumin is an amino acid sequence shown in SEQ ID No. 1 or an amino acid sequence having more than 85% homology thereto.

3. The recombinant Hansenula according to claim 1, characterized in that The coding nucleotide sequence of feline serum albumin was codon-optimized according to the codon usage frequency of Hansenula polymorpha.

4. The recombinant Hansenula according to claim 3, characterized in that The optimized nucleotide sequence is shown in SEQ ID No. 2, or a nucleotide sequence having at least 85%, for example, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity with the nucleotide sequence shown in SEQ ID No.

2.

5. The recombinant Hansenula according to claim 1, characterized in that The terminator is AOX1 terminator T AOX1 .

6. The recombinant Hansenula according to claim 1, characterized in that The expression of feline serum albumin expression element in Hansenula is performed using multiple copies, preferably 2-4 copies, such as 3 copies; different copies use the same or different promoters.

7. A method for expressing recombinant feline serum albumin in Hansenula, characterized in that: Cultivate the recombinant Hansenula as claimed in any one of claims 1 to 6 to produce recombinant feline serum albumin.

8. The expression method according to claim 7, characterized in that: It is an induced expression, and the inducer used is a non-glucose sugar, preferably sucrose, maltose, etc., and more preferably the sucrose concentration used is 1%-8%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%; and the methanol concentration is 0.1%-5%, preferably 1%, 1.5%, 2.0%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%; The expression conditions are as follows: culture temperature 30°C-40°C, pH 5.0-7.0, preferably 35°C, 36°C, 37°C, 38°C; pH is preferably pH 5.0, pH 5.5, pH 6.0, pH 6.5, pH 7.

0.

9. The expression method according to claim 7 or 8, characterized in that: The method also includes the steps of collecting the supernatant by centrifugation and separating or purifying the recombinant feline serum albumin.

10. The expression method according to claim 7 or 8, characterized in that: The culture method and conditions are as follows: The fermentation starting medium is calculated based on a fermentation volume of 5 L: containing yeast powder 100 g, peptone 50 g, glycerol 200 g, basic salts (K2SO4 91 g, MgSO4 75 g, 85% H3PO4 140 ml, KOH 25 g), fully dissolved in 4 L purified water, added to a 10 L fermenter, the purified water was made up to 4.5 L, sterilized at 121 ° C for 30 min, cooled to 30 ° C and then added with 20 ml PTM1 trace element solution: CuSO4·5H2O 6.0 g, KI 0.088 g, MnSO4·H2O 3.0 g, Na2MoO4·2H2O 0.2 g, H3BO3 0.02 g, CoCl2·6H2O 0.5 g, ZnCl2 20.0 g, FeSO4·7H2O 65.0 g, Biotin 0.2 g, leucine 0.04 g, concentrated H2SO4 5.0 ml, purified water to 1 L, sterilized by filtration with 0.22 μm filter membrane; pH 5.6 adjusted with ammonia water, inoculated with fermentation seed liquid, and the fermentation volume was 5 L; The initial stirring speed was 400 rpm and the air flow rate was 0.5 Nm 3 / h, tank pressure 0.5 bar, dissolved oxygen value was controlled to be ≧20% during fermentation. After the initial growth phase was maintained for about 25 h, the A600nm of the bacterial solution reached 55-65, and 50% glycerol (W / V) of the feed medium and 12 ml PTM1 were added at a flow rate of 12-18 ml / L / h, and the feeding growth phase began. After 6-8 h of cultivation, the A600nm of the bacterial solution reached 80-100, and the feeding was stopped. The pH value was adjusted to 6.0 with ammonia water. After the dissolved oxygen began to rise, sucrose was added, and the induced expression phase began. The initial sucrose flow acceleration rate was 10 ml / h, and samples were taken every hour. The concentration was measured by sucrose electrode (the sucrose flow acceleration was adjusted according to the dissolved oxygen change), and the concentration was controlled at <5 g / L by adjusting the sucrose flow acceleration rate.

Images