Plant flavonoid synthesis regulation gene and its application

A technology of flavonoids and genes, applied in the field of plant genetic engineering and biology, can solve the problems of very little research on the synthesis of effective ingredients flavonoids and the molecular mechanism of regulation

Inactive Publication Date: 2013-06-05
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF4 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented new technique uses an organism called Escherichia coli that produces enzyme called esmaquinone oxide lyase (EMO) or erythrocyte glycerol lipase (ERGL). These techniques allow scientists to study how certain chemical substances are produced by these microorganisms. They also help identify important biological processes related to their production process such as flavorings from different sources like tea leaves.

Problems solved by technology

This patents discuss various aspects related to enzyme networks controlling the production of flavones during rice growth processes. It suggests how specific proteins called histone binding modules or chromatin domains mediate this process through interactions between them.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant flavonoid synthesis regulation gene and its application
  • Plant flavonoid synthesis regulation gene and its application
  • Plant flavonoid synthesis regulation gene and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Embodiment 1: the isolated clone of EsMYBA1 gene

[0042] The EsMYBA1 gene was isolated from Epimedium sagittatum by homologous cloning combined with RACE technology, and the process was as follows:

[0043] First, total RNA was extracted from the young leaves of Epimedium sagittatum according to the operating instructions of the RNAiso plus reagent (Takara company, the same below). The specific method is as follows: Take 50-100mg of fresh tissue or frozen tissue, fully grind it in liquid nitrogen, transfer the powder to a 1.5mL centrifuge tube, add 1mL RNAiso plus reagent to fully lyse, and go through chloroform layering, isopropanol precipitation and ethanol Wash and finally dissolve in 50uL of RNase-free ddH 2 O middle. The quality and yield of the RNA solution was detected by gel electrophoresis and UV spectrophotometer Nanodrop2000c (ThermoFisher scientific company, the same below), which met the requirements of reverse transcription, and then stored at -20oC for...

Embodiment 2

[0049] Embodiment 2: subcellular localization

[0050] First, the complete ORF of the EsMYBA1 gene was transferred to the cloning vector pBI221-GFP containing the GFP reporter gene by enzyme-cut ligation, and then the onion epidermal cells were bombarded with a gene gun, observed and photographed under a confocal laser microscope. The vector construction process for subcellular localization analysis is as follows: design a pair of GSP (forward primer: GC GGATCC ATGAAGCCAGATTTTAGTGAGAT, underlined BamHI restriction site; reverse primer: 5'CG GTC GAC TTCAAAATTCCAAAAGTTCAAG, the underlined SalI restriction site), using the recombinant plasmid pMD19-T containing the full-length sequence of EsMYBA1 as a template, amplified its ORF with high-fidelity PrimeStar DNA polymerase, and the PCR system was as described in Example 1. Direct PCR product recovery, BamHI and SalI double digestion, the target fragment recovered after digestion was connected to the cloning vector pBI221-GFP (c...

Embodiment 3

[0051] Embodiment 3: yeast two-hybrid

[0052] In order to verify whether EsMYBA1 has the ability to interact with other bHLH TFs that regulate flavonoid synthesis, we used yeast two hybrid assay (yeast two hybrid) for analysis. The yeast two-hybrid vectors used are pAD-GAL4-2.1 and pBD-GAL4Cam (Stratagene, abbreviated as pAD and pBD, the same below), which contain the AD (activating domain) and BD (binding domain) of the GAL4 protein, respectively. , binding domain), all located under the ADH1 (alcohol dehydrogenase 1, alcohol dehydrogenase 1) promoter. Firstly, the ORF of EsMYBA1 was cloned into pAD and pBD vectors by double enzyme digestion EcoRI / SalI to obtain recombinant vectors pAD-EsMYBA1 and pBD-EsMYBA1, and the recombinant plasmids were digested, identified by PCR and sequencing. The primers used to amplify the ORF of EsMYBA1 are GC GAATTC ATGA AGCCAGATTTTAGTGAGAT (underlined EcoRI restriction site) and CG GTC GAC TTCAAAAATTCCAAAAGTTCAAG (the underline is the Sal...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a plant flavonoid synthesis regulation gene and its application. CDNA obtained through the inverse transcription of the total RNA of Epimedium brevicornum Maxim blades is treated as a template and undergoes PCR to obtain a 233bp fragment, the 233bp fragment has a very high homology with flavonoid related R2R3-MYB gene, a full-length cDNA sequence is obtained through an RACE technology and is named EsMYBA1 gene, and the sequence of the EsMYBA1 gene is represented by SEQIDNO.1. The EsMYBA1 gene codes an R2R3-MYB transcription factor which has an about 50% homology with other MYB regulation genes for controlling the flavonoid synthesis approaches, and the improvement of the expression level of the EsMYBA1 gene through a genetic engineering technology promotes the synthesis and the accumulation of anthocyanidin.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap