Unlock instant, AI-driven research and patent intelligence for your innovation.

DNA bar code standard gene used for identifying culex tritaeniorhynchus and applications

A standard gene and barcode technology, used in recombinant DNA technology, DNA/RNA fragments, and microbial determination/inspection, etc., can solve the problems of prolonged customs clearance period, incomplete samples, and low accuracy of morphological classification methods, and achieves the promotion of The effect of improved quality, improved accuracy

Inactive Publication Date: 2016-03-23
宋锋林 +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is mainly aimed at the adult stage, and is limited to other developmental stage vectors (larvae, pupae, etc.) captured in the actual work of health supervision; for the identification of closely related species of vector species similar to Culex tritaeniorhynchus in external form, The accuracy of the morphological classification method is low
In the actual work of inspection and quarantine, non-adult insects such as larvae, eggs, and pupae are often intercepted. Usually, they need to be cultivated into adults before identification. The entire quarantine identification process takes several weeks, and often collected Incomplete samples, morphological methods encounter many difficulties in the identification of incomplete samples, which greatly lengthens the customs clearance period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA bar code standard gene used for identifying culex tritaeniorhynchus and applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0031] A DNA barcode standard gene for identifying Culex tritaeniorhynchus, the nucleotide sequence (679bp) of the gene is as follows:

[0032] TTTTATTTTTGGAGCTTGAGCTGGAATAGTTGGTACTTCTTTAAGTATTTTAATTCGAGCAGAATTAAGTCAACCTGGAGTATTTATTGGAAATGATCAAATTTATAATGTTATTGTAACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGTGGATTTGGAAATTGATTAGTTCCTTTAATACTTGGAGCTCCTGATATAGCCTTTCCACGAATAAATAATATAAGTTTTTGAATACTACCTCCTTCATTAACTCTACTACTTTCAAGTAGTTTAGTAGAAAATGGGGCTGGAACTGGATGAACAGTTTATCCACCTCTATCATCTGGAACAGCACACGCTGGAGCTTCAGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGGATTTCATCAATTTTAGGGGCAGTAAATTTTATTACAACAGTAATTAATATACGATCTTCAGGAATTACACTTGATCGAATGCCTTTATTTGTTTGATCAGTAGTAATTACTGCTGTTTTATTACTTCTTTCACTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACAGATCGAAATCTTAATACTTCATTCTTTGACCCAATTGGAGGAGGAGACCCAATTCTTTATCAACACTTAGTCTGATTTTTTGGTCACCGGGGAAGTAAAAAA。

[0033] The molecular biological identification method for identifying Culex tritaeniorhynchus using the DNA barcode standard gene for identifying Culex tritaeniorhync...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the biotechnology field, and especially relates to a DNA bar code standard gene used for identifying culex tritaeniorhynchus and applications. The nucleotide sequence of the DNA bar code standard gene used for identifying culex tritaeniorhynchus is shown in the ID No.1 in a sequence table. The provided DNA bar code standard gene can be applied to identification whether a specimen to be detected is culex tritaeniorhynchus. The DNA bar code standard gene is suitable for practical needs of border port health quarantine work, and a relatively stable and accurate molecule identification method is established by utilization of the DNA bar code technology and aimed to culex tritaeniorhynchus. Defected samples can be identified, culex tritaeniorhynchus and sibling species can be distinguished and identified well, and the non-imago phase of culex tritaeniorhynchus can be identified accurately. The provided DNA bar code standard gene has important promoting effects on raising accuracy of culex tritaeniorhynchus classification identification and promoting health supervision work quality improvement.

Description

technical field [0001] The invention belongs to the field of biotechnology, in particular to a DNA barcode standard gene for identifying Culex tritaeniorhynchus and its application. Background technique [0002] At present, the classification and identification of vector organisms at home and abroad mainly rely on traditional morphological classification methods. This method is mainly aimed at the adult stage, and is limited to vectors of other developmental stages (larvae, pupae, etc.) captured in the actual work of health supervision; for the identification of closely related species of vectors with similar external shapes, the accuracy of the morphological classification method In addition, incomplete samples are often collected in practical work, and morphological methods encounter many difficulties in the identification of incomplete samples. In the port quarantine work, if the intercepted larvae, eggs, pupae and other non-adult worms, it is usually necessary to cultiv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6888C12Q1/686
Inventor 程晓兰宋锋林靳木子高玉峰姜陆万雪
Owner 宋锋林
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More