Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer group and test kit for detecting polymorphism of related genes of hypertensive drugs

A technology of genetic polymorphism and detection kits, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems such as complex operation, false positive, cross-contamination, etc.

Pending Publication Date: 2018-01-09
SHANGHAI PERSONAL BIOTECH
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the clinical detection of genetic polymorphisms of hypertension drugs is mainly carried out by sequencing and gene chip methods. The sensitivity of the sequencing method is low and the entire detection cycle takes 7 days. 10 4 copies / ml, and the operation process is likely to cause cross-contamination and lead to false positives

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group and test kit for detecting polymorphism of related genes of hypertensive drugs
  • Primer group and test kit for detecting polymorphism of related genes of hypertensive drugs
  • Primer group and test kit for detecting polymorphism of related genes of hypertensive drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] The primer set of the present invention for detecting polymorphisms of genes related to hypertension medication comprises the following primers:

[0028] CYP2D6*10-F:aggtgtgtccagaggagcccat;

[0029] CYP2D6*10-R:CCACCATCCATGTTTGCTTCTGG;

[0030] ADRB1-F:CGCCTCTTCGTCTTTCTAA;

[0031] ADRB1-R:AGTTCACCTGCTATCGGTCTTA;

[0032] AGTR1-F:ctcagataatgtaagctcatccacc;

[0033] AGTR1-R: AGCAGCCGTCATCTGTCTAATGC;

[0034] ACE-F: gactctgtaagccactgctggag;

[0035] ACE-R:GACGTGGCCATCACATTCGTCA;

[0036] CYP2C9*3-F:GTCCAGGAAGAGATTGAACGTGTGA;

[0037] CYP2C9*3-R:TATCACCCGGTGATGGTAGAGGTT;

[0038] As a detection kit prepared by using the above-mentioned primer set for detecting hypertensive drug-related gene polymorphisms of the present invention, the above-mentioned primer set is included.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group and a test kit for detecting the polymorphism of related genes of hypertensive drugs. The primer group is characterized by containing the following primers: CYP2D6*10-F, CYP2D6*10-R, ADRB1-F, ADRB1-R, AGTR1-F, AGTR1-R, ACE-F, ACE-R, CYP2C9*3-F and CYP2C9*3-R. The genes of CYP2C9*3, ADRB1 (1165G is greater than C), AGTR1 (1166A is greater than C), CYP2D6*10 and ACBL (I / D) disclosed by the invention are proved to be closely related to the efficacy of common drugs for treating hypertension; in addition, the rational and safety use of drugs for hypertension patients can be guided according to detection results of polymorphism site of the genes.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a primer set and a detection kit for detecting gene polymorphisms related to hypertension medication. Background technique: [0002] It is conservatively estimated that the number of hypertensive patients in my country exceeds 160 million. The incidence of hypertension is on the rise, and stroke, a complication of hypertension, is the second leading cause of death in my country. Hypertension and its complications have become the third largest economic burden of disease in the world. Controlling blood pressure through drug therapy is the main means to reduce the occurrence of hypertensive complications at present and for a long time in the future. [0003] Among the top 200 best-selling medicines in the world in 2000, medicines for treating high blood pressure accounted for 17 kinds. However, individual differences in clinical responses to drugs for the treatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 丁慧孙建云孙子奎
Owner SHANGHAI PERSONAL BIOTECH