A kind of duck circovirus tandem repeat sequence and its application

A technology in the sequence and sequence listing, applied in the field of duck circovirus tandem repeats, can solve the problem of few studies on tandem repeats, and achieve the effect of strong promotion value and application value

Active Publication Date: 2020-07-31
LINYI UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, little research has been done on the tandem repeats in the DuCV genome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of duck circovirus tandem repeat sequence and its application
  • A kind of duck circovirus tandem repeat sequence and its application
  • A kind of duck circovirus tandem repeat sequence and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1 Dottup bioinformatics tool analysis of DuCV repeat sequences

[0074] 1. Using the dottup bioinformatics tool of EMBOSS Program, taking DuCV strain as the representative strain of genotype I and FJ0601 strain as the representative strain of genotype II, analyzed the DuCV genome repeat sequence, and found the middle of gene I and type II DuCV genome There are tandem 4-copy repeat sequences (QTR) in the region, and there are 2 small repeat sequences in each large repeat unit of genotype I QTR;

[0075] 2. In order to analyze whether the original QTR circovirus is conservative, use the dottup tool to select porcine circovirus (PCV1 and PCV2), goose circovirus GoCV, and parrot beak and feather disease virus (PBFDV) with relatively advanced DuCV kinship. Genome analysis did not reveal repetitive sequences.

Embodiment 2

[0076] Example 2 Sequence of tandem repeat QTR, genomic location and comparative analysis of two genotype QTR sequences

[0077] 1. Analysis of the DuCV genome location of QTR found that QTR is located in the middle region of Rep and Cap genes;

[0078] 2. QTR sequence analysis found that the genotype II QTR is 168bp long, including four 42bp tandem repeat units, and the genotype I QTR is 180bp long, including four 45bp tandem repeat units, and each repeat unit contains two 7bp spacer repeat units;

[0079] Genotype I QTR sequence:

[0080] 5'-cacttggcagggattaaacacttgggcagctcggttaaggttaggcacttggcagggagtaaacacttgggcagctcggttaaggttaggcacttggcagggattaaacacttgggcagctcggttaaggttaggcacttggcagggattaaacacttgggcagctcggttaaggttaga-3' (SEQ ID NO. 1)

[0081] Genotype II QTR sequence:

[0082] 5'-ttaaggtgaacactcgaaagggatatacacttgggcagctggttatggtgaacactcgaaagggatatacacttgggcagctggttatggtgaacactcgaaagggatatacacttgggcagctggttatggtgaacactcgacagggatatacacttgggcagctgg-3' (SEQ ID NO. 2)

[00...

Embodiment 3

[0084] Example 3 Analysis of QTR transcription regulation

[0085] 1. Construction of luciferase reporter plasmid: DuCV strain was used as the representative strain of genotype I, FJ0601 strain was used as the representative strain of genotype II, and the genotype I DuCV QTR fragment (G1-QTR) and genotype II were amplified respectively DuCV QTR fragment (G2-QTR);

[0086] 2. Using different restriction sites and seamless cloning technology, insert G1-QTR and G2-QTR forward or reverse into the upstream and downstream regulatory regions of the luciferase gene, respectively

[0087] 3. The constructed luciferase reporter plasmid was transfected into DEF cells, and the pRL-TK plasmid was simultaneously transfected as an internal reference reporter plasmid. After 36 hours of transfection, the cells were collected, and the luciferase activity was detected by a dual-luciferase detection system.

[0088]4. Analysis of transcription regulation function: QTR inserted downstream of poly...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a duck circovirus tandem repeated sequence and application thereof and belongs to the technical fields of bioengineering and molecular biology. The invention firstly discovers aQTR sequence in which DuCV specifically exists, and the tandem repeated sequence does not appear in other circoviruses. QTR can serve as a gene I type and II type DuCV genetic typing new molecular marker; meanwhile, the invention proves the effect of regulating and controlling mRNA stability by the QTR serving as a DSE component by a dual-luciferase reporter system and a semi-anchored reverse mutation PCR technology, and defines the important effect of regulating and controlling virus gene expression by the QTR. The invention provides important technical and theoretical basis for researchingDuCV genotyping and virus replication regulation and control mechanism.

Description

technical field [0001] The invention belongs to the technical fields of bioengineering and molecular biology, and in particular relates to a duck circovirus tandem repeat sequence and an application thereof. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Duck circovirus (DuCV) can cause immunosuppressive disease in ducks. Infected ducks mainly manifest as disheveled feathers, growth retardation, weight loss, hemorrhage and swelling of thymus, bursa of Fabricius, spleen and liver in varying degrees, and lymphocyte necrosis. and other features. DuCV is a single-stranded circular DNA virus. The DuCV genome is about 1.99kb, encoding three viral proteins: Rep, Cap and ORF3 p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12Q1/70C12Q1/6858
CPCC12Q1/6858C12Q1/707C12Q2600/156C12Q2600/172C12Q2531/113
Inventor王鑫武专昌夏小静姜世金张兴林李浩然
OwnerLINYI UNIVERSITY