Method for culturing low-temperature-resistant variety of pinctada martensii by using LncRNA as molecular marker and application
By screening the low-temperature-resistant varieties of Mahayana beads using LncRNA molecular marker technology, the problems of low screening efficiency, phenotype selection dependence and long cycle in the existing technology are solved, and efficient and accurate low-temperature-resistant individual screening is achieved, which is suitable for industrial breeding needs.
Patent Information
- Application Number
- CN202411826203.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-12
- Publication Date
- 2025-03-14
AI Technical Summary
When screening low-temperature resistant mother Martellia beads, the prior art has low efficiency, depends on phenotypic selection, and long cycles, making it difficult to meet the needs of rapid reproduction and industrial breeding.
Using LncRNA as a molecular marker, DNA fragments containing the lncrunt allele were amplified by PCR technology, and molecular marking analysis was performed to determine the tolerance of Mahayana beads to low temperature, and individuals that were resistant to low temperature were screened through screening and verification steps.
It improves screening efficiency and accuracy, shortens screening cycle, reduces costs, and is suitable for industrial aquaculture needs.
Smart Images
Figure CN119614714A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of aquaculture, and more specifically, to a method and application of cultivating low-temperature-resistant varieties of Pinctada martensii by using LncRNA as a molecular marker. Background Art
[0002] Non-coding transcripts are an important part of the genome sequence, accounting for 30%-60% of the genome. Among them, long non-coding RNA regulates a variety of molecular biological functions in cells and has heritable ability. Unlike commonly used DNA molecular markers, LncRNA itself has precise RNA characteristics and extremely strong regulatory effects. Gene fragment polymorphism changes directly affect the function of LncRNA, thereby producing clear phenotypic effects. Therefore, LncRNA has become a class of molecules with huge potential for molecular marker development.
[0003] Pinctada fucata martensii, also known as Hepu pearl oyster, belongs to the class Bivalvia of the phylum Mollusca. The cultivated Pinctada fucata martensii is mainly used to produce pearls. Its shells can be made into pearl layer powder, which is used as a substitute for pearls for medicinal purposes and cosmetics. The shells are also good raw materials for shell carving. Shell meat is a delicious food. It has high economic value, and increasing its aquaculture scale is conducive to the development of my country's aquatic economy. Pinctada fucata martensii is mainly distributed in Guangdong, Guangxi and Hainan in the South China Sea. It is a typical warm-water shellfish with a suitable water temperature of 10-35℃ and dies at 6-7℃. If you want to expand the aquaculture scale of Pinctada fucata martensii, moving northward for aquaculture is the only way, and the influence of the water temperature of northward aquaculture on its growth is extremely critical, so it is extremely important to select low-temperature resistant Pinctada fucata martensii.
[0004] The existing technology for shell low temperature resistance has the following disadvantages when screening low temperature resistant Pinctada martensii oysters:
[0005] (1) Low screening efficiency: Existing screening methods rely on phenotypes to select low-temperature populations. For example, after low-temperature treatment of larvae and adults, individuals with low temperature resistance are selected; or overwintering experiments are used to select low-temperature resistant populations through environmental acclimatization. This is time-consuming and inefficient.
[0006] (2) Parent selection relies on phenotypic resistance: Phenotypic observation is greatly influenced by human judgment and environmental factors, and is prone to errors.
[0007] (3) Long screening cycle: Low-temperature tests in natural environments take a long time and are not suitable for rapid reproduction and industrial farming. Summary of the invention
[0008] The purpose of the present invention is to provide a method and application of cultivating a low-temperature-resistant variety of Pinctada martensii using LncRNA as a molecular marker, so as to solve the above-mentioned technical problems.
[0009] The above technical objectives of the present invention are achieved through the following technical solutions: a method and application of cultivating low-temperature resistant varieties of Pinctada martensii using LncRNA as a molecular marker, comprising the following 5 steps:
[0010] S1. Sample collection: Extraction of genomic DNA from the cold-tolerant Pinctada martensii strain;
[0011] S2. Gene amplification: Use PCR technology to amplify the DNA fragment containing the lncrunt allele;
[0012] S3. Molecular marker analysis: Use specific molecular marker technology to detect the amplified DNA fragments to determine the presence or absence of the lncrunt allele;
[0013] S4. Data processing: Statistical analysis is performed on the data obtained from the molecular marker analysis to determine the tolerance of individual Pinctada martensii to low temperatures;
[0014] S5. Screening and verification: Based on the data processing results, select the low-temperature resistant Pinctada martensii individuals and conduct biological verification to ensure their low-temperature resistance.
[0015] The present invention is further configured as follows: the specific operation of sample collection is as follows:
[0016] (1) Extracting genomic DNA from the low-temperature resistant Pinctada martensii strain using a marine animal tissue genomic DNA extraction kit; the collection method is to use an opening forceps to pry open the shell, cut a little gill filament with sterile scissors without damaging the shell body, and cut no more than 30 mg of tissue material according to the instructions, put it into a centrifuge tube containing 200 μl GA buffer, and vortex for 15 seconds;
[0017] (2) Add 20 μl of Proteinase K (20 mg / ml) solution, vortex to mix, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. Place at 56°C for 1 h, and shake the sample 3 times every 15 minutes, each time shaking and mixing for 15 seconds; until the tissue is completely dissolved, briefly centrifuge to remove water droplets on the inner wall of the tube cap, and then proceed to the next step;
[0018] (3) Add 200 μl of buffer GB, mix thoroughly by inverting, and place at 70°C for 10 min. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap. Add 200 μl of anhydrous ethanol, mix thoroughly by inverting. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0019] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 back into the collection tube;
[0020] (5) Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, place the adsorption column CB3 in a collection tube, add 600 μl of rinse solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube;
[0021] (6) Repeat step (5);
[0022] (7) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid;
[0023] (8) Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material; transfer the adsorption column CB3 to a clean centrifuge tube, add 50 μl of elution buffer TE to the middle part of the adsorption membrane, place it at room temperature for 2-5 minutes, and centrifuge it at 12000 rpm (13,400×g) for 2 minutes;
[0024] (9) The solution eluted into the centrifuge tube was again added dropwise to the adsorption film of the adsorption column, left at room temperature for 2-5 min, and centrifuged at 12000 rpm for 2 min for secondary elution to improve the elution efficiency. After centrifugation, the adsorption column CB3 was discarded and the solution was collected into a centrifuge tube;
[0025] (10) The extracted DNA was detected by 1.0% agarose gel electrophoresis. Take 1.5 μl of DNA template solution, add 1 μl of Loading Buffer solution, add 1.5 μl of 15000 bp Marker to the control well, adjust the voltage to 150 V, the current to 80 mA, and the power to 80 W. Run the electrophoresis for 25 minutes, then use a gel scanner to illuminate the gel. Clear and bright DNA bands are preferred. In addition, use a nucleic acid quantifier to determine the DNA concentration. Finally, store the DNA in a -20°C refrigerator.
[0026] The present invention is further configured as follows: the specific operation of gene amplification is as follows:
[0027] Design specific primers and amplify the DNA fragment containing the lncrunt allele by PCR technology;
[0028] Amplification conditions were as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing temperature (determined according to primer characteristics) for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and final extension at 72°C for 10 minutes.
[0029] The present invention is further configured as follows: the molecular marker analysis is specifically performed as follows:
[0030] Agarose gel electrophoresis was performed on different cold-resistant individuals using allele-specific primers of lncRunt. 1.5 μl of PCR product was added with 1 μl Loading Buffer solution, and 1.5 μl of 2000 bp Marker was added to the control well. The voltage was adjusted to 150 V, the current was adjusted to 80 mA, and the power was adjusted to 80 W. The electrophoresis was performed for 25 minutes, and then the gel was scanned with a gel scanner. The PCR product was preferably one with clear and bright bands.
[0031] The present invention is further configured as follows: the specific operations of the data processing are as follows:
[0032] The data obtained from the molecular marker analysis were statistically analyzed to determine the tolerance of Pinctada martensii individuals to low temperatures, and the genotype frequency index was used to evaluate the low temperature resistance.
[0033] The present invention is further configured as follows: the sequence of the allele lncRunt specific primer is as follows:
[0034] lncRunt F: GGTATCTACTGAACTCTTGC;
[0035] lncRunt R: GTCTTTGGAACTTACTGC.
[0036] The present invention also provides the application of LncRNA molecular markers in cultivating low-temperature-resistant varieties of Pinctada martensii.
[0037] In summary, the present invention has the following beneficial effects:
[0038] (1) Simple operation. Only a small amount of tissue needs to be taken from the shellfish for DNA extraction and PCR testing, without the need for low temperature stress or acclimation experiments.
[0039] (2) High accuracy. The selected lncRNA marker is only missing in the low-temperature population, and the judgment is highly accurate.
[0040] (3) Reduce costs: Individual screening does not require the killing of individuals, and only causes minor injuries. It does not threaten the health and survival of individuals, reduces the waste of experimental materials, and reduces experimental costs.
[0041] (4) Greatly improve screening efficiency: Through molecular marker technology, low-temperature-resistant genotypes can be quickly and accurately identified, greatly improving screening efficiency.
[0042] (5) Shorten the screening cycle: Through molecular marker-assisted selection, individuals that are resistant to low temperatures can be screened out in the early generations, shortening the time period from reproduction to breeding.
[0043] By comparing the disadvantages of the prior art with the advantages of the present invention, it can be seen that the present invention has significant improvements in cost, ease of operation, accuracy and reaction speed, and provides a more efficient and accurate method for screening low-temperature-resistant Pinctada martensii. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 is the result of agarose gel electrophoresis of low-temperature resistant population DNA in the embodiment of the present invention;
[0045] Figure 2 It is the agarose gel electrophoresis result of the amplification of the cold-resistant population PCR product in the embodiment of the present invention. DETAILED DESCRIPTION
[0046] The following is combined with Figure 1-2 The present invention is described in further detail.
[0047] Example:
[0048] 1. Primer design
[0049] Based on the SV variant sequences of the two LncRunt genes of Pinctada martensii, primers were designed using Primer 5.0 software for differential detection between different Pinctada martensii cultured populations. The two pairs of primers were obtained as follows
[0050]
[0051] 2. Cloning and sequencing verification of LncRunt SV variant primers
[0052] (1) DNA from a Pinctada martensii oyster that had been previously identified to have two gene variants was used for PCR amplification to verify the two primers. The reaction system was 200 μl system: 100 μl HS (Premix), 1 μl DNA template, 8 μl forward primer, 8 μl reverse primer, 83 μl ddH2O. Divide into 4 tubes, 50 μl each, and put into PCR instrument for amplification.
[0053] (2) After amplification, the products from the four tubes were pooled into one tube and subjected to electrophoresis on a 1% agarose gel. The target fragments were recovered after being observed and purified according to the instructions of the GeneJET Gel Extraction Kit.
[0054] (3) Take 0.5 μl of the purified product, 1 μl of the Blunt vector, and 3.5 μl of ddH2O to make a 5 μl system, mix well, and connect at room temperature for 7 minutes to obtain the ligation product. Add the ligation product to Trans1-T1 competent cells, adsorb on ice for 30 minutes, heat shock at 42°C for 30 seconds, and then quickly put it in ice for 2 minutes. Add LA liquid culture medium, culture on an oscillator for 3 hours, and then inoculate into LA solid culture medium for overnight culture.
[0055] (4) Pick a single colony and add it to LA medium for expansion.
[0056] (5) Bacterial liquid PCR identification, prepare 10μl system: 5μl rTaq supper mix, 0.4μl M13 upstream primer, 0.4μl M13 downstream primer, 1μl bacterial liquid, 3.2μl ddH2O. PCR products were detected by agarose gel electrophoresis, and colony samples with fragment lengths that met the theoretical value were selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing.
[0057] 3. Extraction of Pinctada martensii DNA
[0058] The experiment used the silicon matrix column method to extract DNA for PCR amplification. The process is as follows:
[0059] (1) Cut no more than 30 mg of tissue material, place it in a centrifuge tube containing 200 μl GA buffer, and vortex for 15 seconds.
[0060] (2) Add 20 μl of Proteinase K (20 mg / ml) solution, vortex to mix, and briefly centrifuge to remove water droplets on the inner wall of the tube cap. Place at 56°C for 1 hour, and shake the sample 3 times every 15 minutes, each time shaking and mixing for 15 seconds. When the tissue is completely dissolved, briefly centrifuge to remove water droplets on the inner wall of the tube cap, and then proceed to the next step.
[0061] (3) Add 200 μl of buffer GB, mix thoroughly by inversion, and incubate at 70°C for 10 min. The solution should become clear and centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0062] (4) Add 200 μl of anhydrous ethanol and mix thoroughly by inverting. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.
[0063] (5) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.
[0064] (6) Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.
[0065] (7) Add 600 μl of rinse solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use) and spin at 12000 rpm.
[0066] (8) Centrifuge for 30 seconds, discard the waste liquid, and place the adsorption column CB3 into the collection tube.
[0067] (9) Repeat step 7.
[0068] (10) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.
[0069] (11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50 μl of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2-5 min, and centrifuge it at 12000 rpm for 2 min.
[0070] (12) The solution eluted into the centrifuge tube was added dropwise to the adsorption film of the adsorption column again, left at room temperature for 2-5 min, and centrifuged at 12000 rpm for 2 min for secondary elution to improve the elution efficiency. After centrifugation, the adsorption column CB3 was discarded and the solution was collected into a centrifuge tube.
[0071] (13) Detect the extracted DNA by 1.0% agarose gel electrophoresis. Take 1.5 μl of DNA template solution, add 1 μl of Loading Buffer solution, and add 1.5 μl of 15000 bp Marker to the control well. Adjust the voltage to 150 V, the current to 80 mA, and the power to 80 W. Perform electrophoresis for 25 minutes. Then use a gel scanner to illuminate the gel. DNA should have clear and bright bands. In addition, use a nucleic acid quantifier to measure the DNA concentration. Finally, store the DNA in a -20°C refrigerator.
[0072] 4. PCR system
[0073] The template DNA is from the Pinctada martensii population. The PCR reaction system is 10 μl system: 5 μl HS (Premix), 0.4 μl DNA template, 0.4 μl forward primer, 0.4 μl reverse primer, 3.8 μl ddH2O. The reaction program of LncRunt-variant-1 primer was 95℃ pre-denaturation for 5 min, 98℃ denaturation for 15 s, 53℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min, and storage at 4℃. After the PCR reaction was completed, the PCR products were subjected to gel electrophoresis using 1% agarose gel. The reaction program of LncRunt-variant-2 primer was 95℃ pre-denaturation for 5 min, 98℃ denaturation for 15 s, 52℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 5 min, and storage at 4℃. After the PCR reaction was completed, the PCR products were subjected to gel electrophoresis using 1% agarose gel.
[0074] 5. Experimental results
[0075] (1) Primer verification results
[0076] The bacterial liquid samples were sent to Shanghai Sangon Biotechnology Co., Ltd. for bidirectional sequencing. The sequencing results showed that the amplified LncRunt gene fragment was 530 bp in length.
[0077] GGTATCTACTGAACTCTTGCTCTATCCCCTTCTCTTACACATTGTTATCATACTTTG
[0078] TTAAATATGCATTACCGCCGCCTCCCACACAAGATCACCCCTCTCTCTCTCTCTCTC
[0079] TCTCTCTCTCTCTCCAATGCTGCTTTTGAAAAAAGGGGAAAGGAAAATTTTATATCGC
[0080] TTGCAAAGCAAACCACGACTTACTATATGATAAATCGCGGTTTTGGTGTTTTTCGCCGA
[0081] TAATCGATAATCAAACGTTTAAAGTATATCCAAGTCGATCATCAACTATTTCACATCAT
[0082] CTTAGATAATCAATCATATTAATTATCGTGCAAGGAAATGTAGGAAACATTTGATCAAA
[0083] CTCGTGTTGTTCACAATACATATCGATACGACTTTTATCGATATCGAACATCAATATCG
[0084] AATCGGTTATGTCAACCGATTACTTTTCAATAATCGATTATCGATTTTACTTCGATTCT
[0085] GCCGCCAATATTTAAAGCTATGGTATGCATGTTATGATGTGCAGTAAGTTCCAAAGACDNA quality results: The results of low-temperature resistant population DNA agarose gel electrophoresis are as follows ( Figure 1 ), DNA bands appeared.
[0086] (2) PCR product results
[0087] LncRunt was amplified by PCR using DNA from a cold-resistant population of Pinctada martensii as a template. Among the cold-resistant population of Pinctada martensii, the sample size was 30 individuals, of which 93% were LncRunt-deficient ( Figure 2 b). However, in the “Haixing 1” population, LncRunt deletion accounted for only 6.7% ( Figure 2 a).
[0088] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law.
Claims
1. A method for cultivating a low-temperature-resistant variety of Pinctada martensii using LncRNA as a molecular marker, characterized in that: Includes the following 5 steps: S1. Sample collection: Extraction of genomic DNA from the cold-tolerant Pinctada martensii strain; S2. Gene amplification: Use PCR technology to amplify the DNA fragment containing the lncrunt allele; S3. Molecular marker analysis: Use specific molecular marker technology to detect the amplified DNA fragments to determine the presence or absence of the lncrunt allele; S4. Data processing: Statistical analysis is performed on the data obtained from the molecular marker analysis to determine the tolerance of individual Pinctada martensii to low temperatures; S5. Screening and verification: Based on the data processing results, select the low-temperature resistant Pinctada martensii individuals and conduct biological verification to ensure their low-temperature resistance.
2. The method for cultivating low-temperature-resistant varieties of Pinctada martensii using LncRNA as a molecular marker according to claim 1, characterized in that: The specific operation of sample collection is as follows: (1) Extracting genomic DNA from the low-temperature resistant Pinctada martensii strain using a marine animal tissue genomic DNA extraction kit; the collection method is to use an opening forceps to pry open the shell, cut a little gill filament with sterile scissors without damaging the shell body, and cut no more than 30 mg of tissue material according to the instructions, put it into a centrifuge tube containing 200 μl GA buffer, and vortex for 15 seconds; (2) Add 20 μl of Proteinase K (20 mg / ml) solution, vortex to mix, centrifuge briefly to remove water droplets on the inner wall of the tube cap, and place at 56°C for 1 h. Vortex the sample 3 times every 15 min, and vortex for 15 sec each time. After the tissue is completely dissolved, centrifuge briefly to remove the water droplets on the inner wall of the tube cap before proceeding to the next step; (3) Add 200 μl of buffer GB, mix thoroughly by inverting, and place at 70°C for 10 min. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap. Add 200 μl of anhydrous ethanol, mix thoroughly by inverting. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap. (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 back into the collection tube; (5) Add 500 μl of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, place the adsorption column CB3 in a collection tube, add 600 μl of rinse solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube; (6) Repeat step (5); (7) Place the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid; (8) Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse solution in the adsorption material; transfer the adsorption column CB3 to a clean centrifuge tube, add 50 μl of elution buffer TE to the middle part of the adsorption membrane, place it at room temperature for 2-5 minutes, and centrifuge it at 12000 rpm (13,400×g) for 2 minutes; (9) The solution eluted into the centrifuge tube was again added dropwise to the adsorption film of the adsorption column, left at room temperature for 2-5 min, and centrifuged at 12000 rpm for 2 min for secondary elution to improve the elution efficiency. After centrifugation, the adsorption column CB3 was discarded and the solution was collected into a centrifuge tube; (10) The extracted DNA was detected by 1.0% agarose gel electrophoresis. Take 1.5 μl of DNA template solution, add 1 μl of Loading Buffer solution, add 1.5 μl of 15000 bp Marker to the control well, adjust the voltage to 150 V, the current to 80 mA, and the power to 80 W. Run the electrophoresis for 25 minutes, then use a gel scanner to illuminate the gel. Clear and bright DNA bands are preferred. In addition, use a nucleic acid quantifier to determine the DNA concentration. Finally, store the DNA in a -20°C refrigerator.
3. According to the method for cultivating low-temperature-resistant varieties of Pinctada martensii using LncRNA as a molecular marker according to claim 2, the specific operation of gene amplification is as follows: Design specific primers and amplify the DNA fragment containing the lncrunt allele by PCR technology; Premix PrimeSTAR HS enzyme (Takara) Amplification conditions were as follows: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing temperature (determined according to primer characteristics) for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; and final extension at 72°C for 10 minutes.
4. The method for cultivating low-temperature-resistant varieties of Pinctada martensii using LncRNA as a molecular marker according to claim 3, characterized in that: The molecular marker analysis is specifically performed as follows: Agarose gel electrophoresis was performed on different cold-resistant individuals using allele-specific primers of lncRunt. 1.5 μl of PCR product was added with 1 μl Loading Buffer solution, and 1.5 μl of 2000 bp Marker was added to the control well. The voltage was adjusted to 150 V, the current was adjusted to 80 mA, and the power was adjusted to 80 W. The electrophoresis was performed for 25 minutes, and then the gel was scanned with a gel scanner. The PCR product was preferably one with clear and bright bands.
5. The method for cultivating low-temperature-resistant varieties of Pinctada martensii using LncRNA as a molecular marker according to claim 4, characterized in that: The specific operations of the data processing are as follows: The data obtained from the molecular marker analysis were statistically analyzed to determine the tolerance of Pinctada martensii individuals to low temperatures, and the genotype frequency index was used to evaluate the low temperature resistance.
6. The method for cultivating low-temperature-resistant varieties of Pinctada martensii using LncRNA as a molecular marker according to claim 4, characterized in that: The sequences of the allele lncRunt specific primers are as follows: lncRunt F: GGTATCTACTGAACTCTTGC; lncRunt R: GTCTTTGGAACTTACTGC.
7. Use of the LncRNA molecular marker according to any one of claims 1 to 6 in cultivating low-temperature-resistant varieties of Pinctada fucata.