Endostatin mutants with mutations at atp binding sites
a technology of atp binding site and endostatin, which is applied in the direction of enzyme stabilisation, drug composition, peptide/protein ingredients, etc., can solve the problems of low accuracy and reproducibility, high cell culture quality, and subjectiveness, and achieve the effect of significant inhibitory effect, reduced activity and endothelial cell migration inhibiting activity, and equal or equal
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Construction of ES Recombinant Strain
[0129]The gene of Endostatin was amplified from cDNA of lung cancer cell A549, and then was cloned into pET30a plasmid to obtain a recombinant plasmid. The 5′-primer for gene amplification was GGAATTCCATATGCACAGCCACCGCGACTTC, and the 3′-primer was CCGCTCGAGTTACTTGGAGGCAGTCATGAAGCTG. The restriction endonucleases were NdeI and XhoI respectively. The above recombinant plasmid was transformed into E. coli via conventional techniques in the art for further protein expression.
example 2
Construction of the Strains Producing ES or Endu Mutants Containing a Mutated ATP Binding Site
[0130]The ATP binding site of wild type human ES was modified by mutation. The detail mutation process, the primer pairs and the transformation process were the same as example 1. The mutants were listed as follows:
ES001—ES-K96R(SEQ ID NO. 5) (FIG. 14)ES003—ES-G90A(SEQ ID NO. 6) (FIG. 15)ES004—ES-G93A&K96R(SEQ ID NO. 7) (FIG. 16)ES005—ES-G90A&G93A&K96R(SEQ ID NO. 8) (FIG. 17)ES006—ES-G93A(SEQ ID NO. 9) (FIG. 18)ES007—ES-G90A&E92K&G93A&K96R(SEQ ID NO. 10) (FIG. 19)ES008—ES-E92Q&P94Q&K96Q(SEQ ID NO. 11) (FIG. 20)
[0131]As controls, we also constructed the mutants containing a mutated ATP binding site, i.e. Endu001, Endu003 and Endu008, by using the same protocol as the above based on the sequence of wild type Endu.
[0132]Endu001-Endu-K104R (SEQ ID NO.12) (FIG. 21)
[0133]Endu003-Endu-G98A (SEQ ID NO.13) (FIG. 22)
[0134]Endu008-Endu-E100Q&P102Q&K104Q (SEQ ID NO.14) (FIG. 23)
example 3
Preparation of Recombinant ES, ES Mutant and Endu Mutant
[0135]The preparation of mutant ES003 was taken as an example for illustrating the expression and preparation of recombinant ES, ES mutant and Endu mutant. Specifically, the strains for producing ES and its mutants were cultured in a shake flask containing LB medium over night, and then inoculated into a 5L fermenter (Sartorius). IPTG was added at the appropriate time, and then the bacteria were harvested after about 4 hours (FIG. 2A). The bacteria were resuspended in a buffer solution and deeply broken by a high pressure homogenizer, and the broken bacteria were centrifuged to collect pellets. This process was repeated for three times. Then, DEAE column or Q column (GE Healthcare), and CM column or SP column (GE Healthcare) were used for the elution of proteins with a pH gradient of 4.0 to 10.0. The renatured and un-renatured proteins were purified respectively, so as to obtain the renatured proteins with purity greater than 9...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molar concentration | aaaaa | aaaaa |
| molar concentration | aaaaa | aaaaa |
| time | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 