A molecular module and application related to regulating the content of monounsaturated fatty acids and temperature adaptability in oysters

Abstract

The present invention belongs to the field of genetic engineering and genetic breeding, and relates to a molecular module related to regulating the content of monounsaturated fatty acids (C18:1Ω9) and temperature adaptability of oysters (long oysters, Fujian oysters) and its application in screening oysters with high monounsaturated fatty acid parent shellfish. The molecular module is located in the 1010bp region within 1207bp to 197bp at the 5' end of the start codon of the Scd gene. The present invention provides a specific molecular module significantly related to the C18:1Ω9 content of long oysters and Fujian oysters and its potential application. Its advantage is that by quickly performing molecular marker typing on parent shellfish before breeding, individuals with high monounsaturated fatty acid C18:1Ω9 content are selected as parent shellfish, thereby improving the C18:1Ω9 content of offspring and their environmental adaptability. Based on downstream experimental verification, the SNP molecular markers obtained in this study have higher credibility, a wider range of adaptation groups, and more stable effects.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and genetic breeding, and relates to a molecular module for regulating the content of monounsaturated fatty acids (C18:1Ω9) and temperature adaptability of oysters (long oysters, Fujian oysters) and its application in screening oyster broodstock. Background Art

[0002] Oysters are economic edible shellfish that are widely cultivated around the world and have high economic value. my country's oyster production has always ranked first in the world, accounting for more than 80%. In my country, oysters account for more than a quarter of marine aquaculture production. However, my country's oyster industry also has problems such as being large but not strong and low industrial efficiency. Using genetic improvement technology to improve the quality and adaptability of oyster products is an important way to improve oyster quality and resistance and solve the above-mentioned industrial problems.

[0003] Fatty acids, as one of the three major nutrients, are the main determinants of oyster quality. Among them, unsaturated fatty acids are important nutrients that the human body cannot synthesize and need to be taken from the outside world. Studies have reported that fatty acids have a high heritability in oysters. Therefore, genetic improvement of oyster unsaturated fatty acids is an important way to improve oyster quality and market competitiveness. Oleic acid C18:1Ω9 is a monounsaturated fatty acid with stable properties. It is called a safe fatty acid by the nutrition community. Reasonable intake is beneficial to the human body. It can reduce low-density lipoprotein cholesterol in the human body, reduce the occurrence of cardiovascular diseases, regulate human physiological functions, promote growth and development, and play a vital role in the human body's metabolism. In addition, unsaturated fatty acids are also an important temperature-responsive metabolite, which maintains the structure and function of the cell membrane by affecting the ratio of saturated fatty acids to unsaturated fatty acids in the cell membrane phospholipids. For example, at low temperatures, the lipid chain will fully extend into an all-trans structure, causing the cell membrane to change from a liquid crystal state to a solidified state. The increase in the proportion of unsaturated fatty acids will reduce the plasma membrane phase transition temperature, thereby maintaining the cell membrane structure and function at low temperatures. Therefore, unsaturated fatty acids are not only an important nutritional quality trait, but also a temperature adaptability trait. Genetic improvement of unsaturated fatty acids can significantly improve the quality and resistance of oysters.

[0004] The long oyster and the Fujian oyster naturally inhabit the northern and southern coasts of China divided by the Yangtze River. They are the main economic aquaculture species of oysters in the north and south, respectively. The two are most closely related in the phylogenetic analysis of the giant oyster genus. The temperature difference between the northern and southern coasts of my country has shaped the different temperature adaptability of the two, which is reflected in the long oyster having a higher content of unsaturated fatty acids (such as C18:1Ω9) and glycogen and other nutrients to adapt to the relatively low temperature environment of the northern sea area, while the Fujian oyster has better growth performance in the first year and stronger metabolic rate and respiration rate under high temperature stress to adapt to the relatively high temperature environment of the southern sea area. In addition, there is no reproductive isolation between the long oyster and the Fujian oyster, so it is possible to construct a multi-trait aggregate oyster by combining the advantageous traits of the two through interspecific hybridization, backcrossing and breeding.

[0005] In the past, traditional breeding methods were mainly used to genetically improve growth and resistance traits in aquatic animals, including selection, hybridization and polyploid breeding. The relevant methods have problems such as long breeding cycles and low efficiency. For nutritional quality traits, traditional breeding has the problem that phenotypes are difficult to sample and test in vivo, so progress is relatively slow. Molecular breeding is an important way to improve breeding efficiency and break through the bottleneck of quality trait breeding. At present, whole genome selection breeding is an important development trend of molecular breeding, and this technology has been applied to a small number of scallops and fish. Improving the breeding efficiency of whole genome selection and reducing its cost are the main concerns of current technological progress, which will promote the widespread application of this technology in aquatic animals with low added value of individual individuals. Molecular module breeding technology is a technology that uses genetic positioning and gene function research methods to identify molecular modules (gene modules) composed of major effect genes and multi-gene networks related to target traits, and uses them as a genetic unit to assist breeding. Genes in a module are highly correlated in structure, distribution space or function. As a development of whole genome technology, molecular module breeding technology has significantly reduced the cost of whole genome breeding and improved its breeding efficiency, and has been widely used in crops. It has also been gradually adopted in aquatic animals, such as the high-glycogen oyster "Haili No. 1" bred based on molecular module-assisted breeding technology. Therefore, using genetic positioning and molecular biological methods to analyze trait inheritance and molecular mechanisms, identify key genes, and explore breeding molecular modules (elements) will significantly improve the efficiency of molecular breeding and reduce breeding costs. It is an important basic work of molecular breeding. At present, the methods for genetic positioning mainly include QTL positioning, whole genome association analysis (GWAS), and population genomics. With the development of genomics and high-throughput sequencing technology, the foundation for molecular breeding has been laid by large-scale screening of single nucleotide polymorphism (SNP) markers related to traits across the whole genome. Summary of the invention

[0006] The purpose of the present invention is to provide a molecular module for regulating the content of monounsaturated fatty acids (C18:1Ω9) and temperature adaptability in oysters (long oysters, Fujian oysters) and its application in screening oyster broodstock.

[0007] To achieve the above purpose, the present invention adopts the following technical solution:

[0008] A molecular module for regulating the content of monounsaturated fatty acids and temperature adaptability in oysters is located in a 1010 bp region within 1207 bp to 197 bp at the 5' end of the start codon of the Scd gene.

[0009] The molecular module is a molecular module related to regulating the content of monounsaturated fatty acids C18:1Ω9 and temperature adaptability in long oysters and Fujian oysters.

[0010] The molecular module is one or more of the following bases: g.-1207C>A (SNP1), g.-1196T>C (SNP2), g.-1185C>G (SNP3), g.-1107A>T (SNP4), g.-908T>C (SNP5), g.-720A>G (SNP6), g.-649A>G (SNP7), g.-491C>A (SNP8), g.-389T>C (SNP9), g.-354G>C (SNP10), g.-333C>T (SNP11), g.-310A>G (SNP12), g.-275G>T (SNP13), g.-273G>A (SNP14), and g.-198C>T (SNP15) in the Scd gene.

[0011] The SNP1-SNP15 marker sites and their upstream and downstream 100bp nucleotide sequences are shown in SEQ ID No.1 respectively; SNP1 to 15 markers are located at the 101st, 112th, 123rd, 201st, 400th, 588, 659, 817, 919, 954, 975, 998, 1033, 1035 and 1110th bases M, Y, S, W, Y, R, R, M, Y, S, Y, R, K, R and Y at the 5' end shown in SEQ ID No.1, respectively, and the mutation types are C / A, T / C, C / G, A / T, T / C, A / G, A / G, C / A, T / C, G / C, C / T, A / G, G / T, G / A and C / T.

[0012] The invention discloses an application of a molecular module for regulating the monounsaturated fatty acid content and temperature adaptability of oysters. The molecular module and SNP markers can be applied to the molecular module-assisted breeding for increasing the monounsaturated fatty acid C18:1Ω9 content and temperature adaptability of long oysters and Fujian oysters.

[0013] A specific primer for a molecular module related to regulating the monounsaturated fatty acid content and temperature adaptability of oysters according to claim 1, wherein the sequence of the specific amplification primer pair for detecting 15 SNP sites in the molecular module is:

[0014] Forward primer F: 5′-GGCCAAGTGGATTACACTCG-3′;

[0015] Reverse primer R: 5′-TGCTAACAGTTTCGCTCCAC-3′.

[0016] A method for assisting breeding by using the molecular module, wherein the genotype of at least one of 15 SNP marker sites is identified for parental mussels before breeding, and the order of C18:1Ω9 content of individuals is: SNP1: CC>CA>AA; SNP2: TT>TC>CC; SNP3: CC>GC>GG, SNP4: AA>AT>TT; SNP5: TT>TC>CC; SNP6: AA>AG>GG; SNP7: AA>AG>GG; SNP8: CC>CA>AA; SNP9: TT>TC>CC; SNP10: GG>GC>CC; SNP11: CC>CT>TT; SNP12: AA>AG>GG; SNP13: GG>GT>TT; SNP14: GG>GA>AA; SNP15 site CC>CT>TT; and by screening parental mussels with a dominant genotype combination, parental mussels with improved C18:1Ω9 content and temperature adaptability of offspring individuals are obtained.

[0017] Specifically:

[0018] (1) DNA extraction: The total DNA of each individual was extracted from the adductor muscle of the oyster to be tested using the sodium laurate method;

[0019] (2) using the genomic DNA of the oyster to be tested as a template, and using the pair of specific primers described in claim 6 to perform PCR amplification on the SNP site;

[0020] (3) Use Sanger sequencing to perform genotyping on the above loci.

[0021] The advantages of the present invention are:

[0022] The present invention is based on the method of targeted high-throughput sequencing and Sanger sequencing of the promoter region of the major gene Scd of monounsaturated fatty acid C18:1Ω9 content, and screens out SNP markers that are highly correlated with the content of monounsaturated fatty acids C18:1Ω9 in oysters, and verifies the regulatory mechanism of the site for promoter activity for the first time, and develops a molecular module containing 15 functional markers in the promoter region of the major gene of the target trait, which is used as a genetic unit for molecular module assisted breeding. Compared with the large number of SNP markers screened by large-scale whole genome genetic selection before, molecular marker screening based on the promoter region of the major gene can significantly improve accuracy and reduce costs, and downstream functional verification can further screen functional molecular markers, thereby improving breeding efficiency. In addition, the associated molecular markers within the module are more likely to form dominant molecular marker individuals, thereby quickly and stably screening the target parent shellfish. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a schematic diagram of the C18:1Ω9 content of the homogenously cultured long oysters and Fujian oysters provided in Example 1 of the present invention.

[0024] Figure 2 It is a schematic diagram of genotyping 15 SNP sites based on Sanger sequencing provided in Example 1 of the present invention.

[0025] Figure 3 It is a linkage disequilibrium diagram of 15 SNP sites in a molecular module closely related to C18:1Ω9 content provided in Example 1 of the present invention.

[0026] Figure 4 It is a schematic diagram of the mutation effects of 15 specific SNP sites within the molecular module closely associated with C18:1Ω9 content provided in Example 1 of the present invention.

[0027] Figure 5 It is a schematic diagram of the Scd gene expression level and C18:1Ω9 content after cold shock provided in Example 1 of the present invention.

[0028] Figure 6 It is a schematic diagram of the fluorescence photobleaching recovery experiment after Scd overexpression provided in Example 1 of the present invention.

[0029] Figure 7 This is a schematic diagram of the association analysis between 15 SNP sites and C18:1Ω9 content in an independent population provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0030] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0031] The present invention further screens and verifies the differential genetic loci between the long oyster and the Fujian oyster populations based on the second-generation mixed pool targeted sequencing and Sanger sequencing methods for the promoter region of the monounsaturated fatty acid C18:1Ω9 major gene Scd screened by population resequencing, and verifies 15 functional SNP molecular markers with significant genotype frequency differences and capable of regulating Scd expression and C18:1Ω9 content in combination with functional tests. In addition, cold shock experiments and fluorescence photobleaching recovery experiments were combined to prove that the gene and metabolites respond to low temperature stress and are closely related to temperature adaptability by regulating cell membrane fluidity. Detection method for molecular modules related to the content of monounsaturated fatty acids C18:1Ω9 in long oysters and Fujian oysters and their temperature adaptability.

[0032] The present invention is based on a method of high-throughput mixed pool targeted sequencing and single individual Sanger sequencing of the promoter region of the monounsaturated fatty acid C18:1Ω9 major gene Scd, and identifies that there is a molecular module composed of 15 strongly linked SNP molecular markers in the promoter region of a monounsaturated fatty acid C18:1Ω9 major gene Stearoyl-CoA Desaturase (Scd) between the long oyster and the Fujian oyster, which includes a molecular module of 15 functional SNP markers located in the Scd promoter region of chromosome 6 of the long oyster and the Fujian oyster, and develops a corresponding detection method. The results show that the method can be used to simply and quickly detect these SNP sites, and the significance of these sites is verified in independent populations of wild long oysters and Fujian oysters. The results show that the C18:1Ω9 of the long oyster population is significantly higher than that of the Fujian oyster population by 36.5%, thereby regulating the cell membrane fluidity to affect its temperature adaptability. The significance of the frequency of these sites and the content of C18:1Ω9 was verified in an independent population. This method can be used to quickly screen parent oysters with superior molecular markers for oyster breeding. The nucleotide sequence of 100 bp upstream and downstream of the molecular module is shown in SEQ ID No. 1, and all 15 SNP molecular markers are included in this interval.

[0033] The present invention provides a specific molecular module significantly correlated with the C18:1Ω9 content of long oysters and Fujian oysters and its potential application. The advantage is that by quickly performing molecular marker typing on parent oysters before breeding, individuals with high monounsaturated fatty acid C18:1Ω9 content are selected as parent oysters, thereby improving the C18:1Ω9 content of offspring and their environmental adaptability. Based on downstream experimental verification, the SNP molecular markers obtained in this study have higher credibility, a wider range of adaptable populations, and more stable effects. Sequence Listing (1) Information on SEQ ID NO.1 The approximately 1kb region of oyster chromosome 6 5,226,824-5,227,833 100bp upstream and downstream sequence feature length: 1194bp

[0034] Type: Nucleic Acid

[0035] Chain type: Single chain

[0036] Topology: Linear

[0037] Molecule type: DNA

[0038] Source: Long Oyster

[0039] Sequence Description:

[0040] AAATATCTTCATGTTGCAGTAGATTTACAGCATGCAGAATATTTACTTT

[0041] GAGAATTTGATAAATTTTAATTAATTCTCTAACAAATTCAGCGACCTTT

[0042] CTMTATAAGTAGAYATTTGACTGCSTTTCGAACATGAACCATTCAGCG

[0043] GCTCTTTAGGTTCGAGTTTACTGGGTTCGATTCTATAACACGGGGTAA

[0044] AAACGTWCATACGTAAACATATATTGTGTCTTACGACCAAGTACTGCA

[0045] AGTTATGCAAGTATATAGGTAAAAATGTGAATAACCAAACCGCAGATA

[0046] CATGTAAATACCAAAGTAAGAGAACTTCGTGTCTATTATATACAATGTG

[0047] TCTGTTTGTATGTATATTCCAGTATACATGTATTTACATGTACATGTATAA

[0048] TCATTTTTGYTATAATATATATATTACAATACTACATATGAATACACATAG

[0049] CTGTTATGAATCGAAAACAAAAGCATTTCCCTATTTTCACGTGCGTTCT

[0050] ATACATGGGAGTCAAACAAATATGTGTTGTGATGAATAAAACTAAATG

[0051] TATCTAACAGATATTAATACATGCATTTACGTACTTGTAGTACATGCAGR

[0052] TCGATTACAAAACTAACATCTAACTGTGGATCCCGGTTTATATCTATGA

[0053] ATCTGTACATATAATTATATARTCTTTAAGTTAGCCCCATGTTAATATATT

[0054] ATACTAATTTTCAATTAAACGACAAACTTAATTGCTAGATAATAAAAGA

[0055] TGAAACATCAGAATCTATACGTCAGTGTTCCTGGGATTTATTGACGTCA

[0056] CAACGAACAGTTTAATGTAAAGGATAGCCCMAATCACATGGTGTAAA

[0057] GAAAACCCACACAGGACTACCGCGAAGTAAATGCAATTTTTAAGAAA

[0058] TTATGGACTTTGGAATATGATCGAGTCCCGCTAAAACCYCAGTAATGA

[0059] AATATTTTGCCTTAATTGGTTATAASGACGTTTTGAAAGGAGTGACYAT

[0060] CCCTTGCAGAACTAGTCTTTRCTGAAATAAATGATCGATGTTGATACA

[0061] GAAATATKARAGAGAAGCTTATATACTGTATACAGGAAAATATTTGCCC

[0062] CTGTTTACTTTCACCCCTTTCGCCCTTTTTGTCAGYAGGCGAATTTAAA

[0063] ACTTGGCAAATTACATCGTTTCGAATGATCTTTCTTTATACAAATCTGG

[0064] CCGAATTCAAGGTGGAGCGAAACTGTTAGCACAGGGCG

[0065] Example 1

[0066] a) Collection of experimental materials and homogenized domestication: In 2020, wild long oysters and Fujian oysters were collected from the coast of Qingdao and Xiamen and temporarily cultured in Qingdao for 3 months. Group breeding of 30 female parents and 30 male parents was used to construct the F1 groups of long oysters and Fujian oysters, respectively. In February 2021, gill tissues of 15 long oysters and Fujian oysters F1 individuals were collected for fatty acid detection and genotyping.

[0067] b) C18:1Ω9 content determination: The C18:1Ω9 content of oysters was determined by gas chromatography using Agilent7890A on the GC-FID platform. Three generations of the first generation were mixed as one biological replicate, with a total of five biological replicates. All phenotypic values ​​were statistically analyzed, showing that the C18:1Ω9 content of the long oyster population was significantly higher than that of the Fujian oyster population by 36.5%, see Appendix Figure 1 .

[0068] c) Genetic site screening: high-throughput second-generation mixed pool targeted sequencing after PCR amplification was used to screen the genetic difference sites in the Scd promoter region

[0069] A pair of specific primer sequences was used to perform genotyping on the Scd promoter region;

[0070] 1) DNA extraction: The total DNA of each individual was extracted from the remaining tissues using the sodium laurate method.

[0071] 1) Preparation of sodium laurate buffer: accurately weigh 5.844 g of NaCl and 10 g of sodium laurate and place them in a 1000 mL beaker, add 100 ml of Tris-HCl (1 M) and 40 ml of LEDTA (0.5 M), 800 ml of ddH2O, adjust the pH to 8.0 with hydrochloric acid, make up to 1000 mL, and store at room temperature after sterilization.

[0072] 2) Take a 1.5 ml sterilized centrifuge tube, add 200 μl of sodium laurate extraction buffer, take 5-20 mg of the remaining oyster tissue, homogenize the tissue with a grinding rod, and then add 500 μl of sodium laurate extraction buffer.

[0073] 3) Add 700 μl of phenol:chloroform:isoamyl alcohol (volume ratio 25:24:1) and shake slowly repeatedly until the upper layer becomes turbid.

[0074] 4) Centrifuge twice at 12,000 rpm and 4°C for 15 min, then remove the supernatant and carefully pipette 400 μl of the supernatant into a new 1.5 ml centrifuge tube.

[0075] 5) Add 280μl (0.7*400μl) -20℃ pre-cooled isopropanol; place the centrifuge tube in a -20℃ refrigerator for 30 minutes. Then slowly invert it upside down 6 times, and a white flocculent precipitate will precipitate. Invert it in one direction to prevent the precipitate from dispersing.

[0076] 6) Centrifuge at 12,000 rpm and 4°C for 10 minutes. Aspirate the supernatant until a precipitate appears at the bottom of the tube.

[0077] 7) Add 500 μl of pre-cooled 70% ethanol to the centrifuge tube, shake repeatedly to wash the precipitate, centrifuge at 12000 rpm, 4°C for 10 minutes, discard the supernatant, and repeat twice.

[0078] 8) Briefly centrifuge the precipitate at 12,000 rpm and 4°C for 8 seconds to wash out the residual ethanol, and then ventilate and drain the residual ethanol in a clean bench.

[0079] 9) After the precipitate becomes transparent, add 80 μl of TE buffer (pH 8.0) and gently tap at 65°C to dissolve (metal bath).

[0080] 10) Add 1 μl RNase (0.1 mg / ml) and digest RNA in a 37°C water bath for 30 minutes to obtain a DNA solution. Store at -20°C for later use. 2) Use specific primers to perform PCR amplification. The reaction system is as follows:

[0081] Element Dosage DNA polymerase 45μl Forward Primer 2μl Reverse primer 2μl DNA template 1μl

[0082] The primer sequences are:

[0083] Forward Primer F: 5'-GAGGTGAAGGGAAGACATAAGGACGA-3'

[0084] Reverse primer R: 5'-CGTATTGAAAGGGCGGCAGAT-3'

[0085] The reaction procedure for PCR amplification is:

[0086]

[0087] 3) After the PCR reaction described in step (1) is completed, the PCR products are separated by 2% polyacrylamide gel electrophoresis, and the band at the 1 kb position is cut and recovered from the gel, and the purified PCR products are further measured for DNA concentration and quality using a nucleic acid detector (Nanodrop2000, USA).

[0088] 4) The PCR products of 15 individuals of the long oyster, Crassostrea fujianensis, were mixed in equal amounts, and a total of two PCR products were subjected to high-throughput second-generation mixed pool targeted sequencing. A total of 18 genetic loci with significant differences were selected based on the site sequencing depth.

[0089] Based on the results of high-throughput second-generation mixed pool targeted sequencing, 18 genetic difference sites screened out were amplified by PCR and then sequenced by Sanger sequencing to perform individual genotyping of 50 wild long oysters and Fujian oysters collected in Qingdao, Shandong and Xiamen, Fujian.

[0090] A pair of specific primer sequences was used to perform genotyping on the Scd promoter region:

[0091] The DNA extraction and PCR amplification reaction system and procedures are the same as above, and the primer sequences are:

[0092] Forward Primer F: 5'-GGCCAAGTGGATTACACTCG-3'

[0093] Reverse Primer R: 5'-TGCTAACAGTTTCGCTCCAC-3'

[0094] The 18 genetically different loci in the Scd promoter region were further verified by Sanger sequencing after PCR amplification of the expanded population. Among them, the genotype frequencies of 15 SNP loci were significantly different. See Appendix Figure 2 , and has strong linkage disequilibrium, which is defined as a molecular module closely associated with C18:1Ω9 content (see Appendix Figure 3 .

[0095] Then, a molecular module closely related to the C18:1Ω9 content was obtained, namely, the SNP1-SNP15 marker sites and their upstream and downstream 100bp nucleotide sequences were shown in SEQ ID No.1 respectively; the SNP1-15 markers were located at the 101st, 112th, 123rd, 201st, 400th, 588th, 659th, 817th, 919, 954, 975, 998, 1033, 1035th and 1110th bases M, Y, S, W, Y, R, R, M, Y, S, Y, R, K, R and Y at the 5' end shown in SEQ ID No.1, respectively, and the mutation types were C / A, T / C, C / G, A / T, T / C, A / G, A / G, C / A, T / C, G / C, C / T, A / G, G / T, G / A and C / T.

[0096] d) Functional verification of genetic difference sites:

[0097] Based on the dual luciferase reporter enzyme experiment after point mutation, the ectopic functions of the 15 SNP sites identified above were further verified in cells.

[0098] 1) Plasmid construction: The oyster Scd promoter region sequence was constructed into the pGL3-basic vector based on the ClonExpress seamless ligation method.

[0099] Specific primers were used to perform PCR amplification. The reaction system and reaction procedure were the same as above.

[0100] The primer sequences are:

[0101] Forward Primer F:

[0102] 5'-ATCTGCGATCTAAGTAAGCTTTAGTTTCCAGAAGTGGATGGAG-3'

[0103] Reverse Primer R:

[0104] 5'-CAGTACCGGAATGCCAAGCTTCGAGGTGAAGGGAAGACATGAG-3'

[0105] The plasmid construction reaction system is as follows:

[0106] Element Dosage Ligase 2μl Buffer 4μl PCR products 10μl Plasmid after restriction digestion 4μl

[0107] The plasmid construction reaction procedure is:

[0108] 37℃ for 30min; cool to 4℃ or immediately cool on ice.

[0109] The ligated plasmid was transformed into E. coli cells, positive strains were selected by Sanger sequencing, and the bacterial solution was supplemented to 15 ml. After vigorous shaking at 37°C for 16 to 20 hours, the plasmid was extracted by alkaline lysis.

[0110] 1) Solution configuration:

[0111] Solution I: 50 mmol / L glucose, 25 mmol / L Tris.Cl (pH 8.0), 10 mmol / L ETA (pH 8.0).

[0112] Solution II: 0.2 mol / L NaOH (dilute with 10 mol / L storage solution before use), 1% SDS.

[0113] Solution III: 60 ml of 5 mol / L potassium acetate, 11.5 ml of glacial acetic acid, and 28.5 ml of water.

[0114] 2) Bacterial precipitation: Pour 15 ml of the culture into a 50 ml centrifuge tube and centrifuge at 12,000 g for 30 seconds at 4°C using a microcentrifuge.

[0115] 3) Aspirate the culture medium and make the bacterial pellet as dry as possible. Resuspend the bacterial pellet in 500 μl of ice-cold solution I and shake vigorously.

[0116] 4) Add 500 μl of the newly prepared solution II. Cover the tube tightly and quickly invert the tube 5 times to mix the contents. Make sure that the entire inner surface of the tube is in contact with solution II. Do not shake and place the tube on ice.

[0117] 5) Add 500 μl of pre-cooled solution III, cover the tube tightly, invert the tube and shake it for 10 seconds to evenly disperse solution III in the viscous bacterial lysate, then place the tube on ice for 3-5 minutes.

[0118] 6) Centrifuge at 12000 g for 5 minutes at 4°C and transfer the supernatant to another 1.5 ml centrifuge tube.

[0119] 7) Use 2 volumes of ethanol to precipitate double-stranded DNA at room temperature. Vortex to mix and leave at room temperature for 2 minutes.

[0120] 8) Centrifuge at 12,000 g for 5 minutes at 4°C in a microcentrifuge.

[0121] 9) Carefully remove the supernatant and invert the centrifuge tube on a piece of paper towel to allow all the liquid to flow out. Remove any droplets attached to the tube wall.

[0122] 10) Wash the double-stranded DNA precipitate with 1 ml of 70% ethanol at 4°C, remove the supernatant as described in step 9), and dry the nucleic acid precipitate in air for 10 minutes.

[0123] 11) Add 200 μl DEPC water to dissolve the plasmid and use a nucleic acid detector

[0124] (Nanodrop2000, USA) was used to further determine the plasmid concentration and quality.

[0125] 2) Point mutation experiment: Based on the ClonExpress homologous recombination method, a single point mutation was performed on the target SNP site in the Scd promoter region of the long oyster on the plasmid (dominant genotype of long oyster > dominant genotype of Fujian oyster).

[0126] PCR amplification: The reaction system and reaction procedure are the same as above.

[0127] The primer sequences are:

[0128] g.-198C>T:

[0129] Forward Primer F:

[0130] 5'-CAAGGGTCTGTACCCCAGGAGGTGGAGGACTC-3'

[0131] Reverse Primer R:

[0132] 5'-TGGGGTACAGACCCTTGGGCGGGCACTGGCTC-3'

[0133] g.-273G>A:

[0134] Forward Primer F:

[0135] 5'-GAGAAGCTTATATAATGTATACAGGAAAATATTTGCCCCT-3'

[0136] Reverse Primer R:

[0137] 5'-CATTATATAAGCTTCTCTCTCATATTTCTGTATCA-3'

[0138] g.-275G>T:

[0139] Forward Primer F:

[0140] 5'-AAATATGAAAGAGAAGCTTATATACTGTATACAGGAAAATATT-3'

[0141] Reverse Primer R:

[0142] 5'-GCTTCTCTTTCATATTTCTGTATCAACATCGATCATT-3'

[0143] g.-310A>G:

[0144] Forward Primer F:

[0145] 5'-CAGAAATATTAGAGAGAAGCTTATATACTGTATACAGGAAAA-3'

[0146] Reverse Primer R:

[0147] 5'-TCTCTCTAATATTTCTGTATCAACATCGATCATTTATT-3'

[0148] g.-333C>T:

[0149] Forward Primer F:

[0150] 5'-GCAGAACTAGTCTTTGCTGAAATAAATGATCGATGTTGATACA-3'

[0151] Reverse Primer R:

[0152] 5'-GCAAAGACTAGTTCTGCAAGGGATGGTCACTC-3'

[0153] g.-354G>C:

[0154] Forward Primer F:

[0155] 5'-GGAGTGACTATCCCTTGCAGAACTAGTCTTTACTG-3'

[0156] Reverse Primer R:

[0157] 5'-CAAGGGATAGTCACTCCTTTCAAAACGTCCTTAT-3'

[0158] g.-389T>C:

[0159] Forward Primer F:

[0160] 5'-CGACGTTTTGAAAGGAGTGACCATCCCTTGCA-3'

[0161] Reverse Primer R:

[0162] 5'-CTCCTTTCAAAACGTCGTTATAACCAATTAAGGCAAAATATTTCA-3'

[0163] g.-491C>A:

[0164] Forward Primer F:

[0165] 5'-CGCTAAAACCCCAGTAATGAAATATTTTGCCTTAATTGG-3'

[0166] Reverse primer R: 5'-TTACTGGGGTTTTAGCGGGACTCGATCATATT-3'

[0167] g.-649A>G:

[0168] Forward Primer F:

[0169] 5'-GGATAGCCCAAATCACATGGTGTAAAGAAAACCCA-3'

[0170] Reverse Primer R:

[0171] 5'-TGTGATTTGGGCTATCCTTTACATTAAACTGTTCG-3'

[0172] g.-720A>G:

[0173] Forward Primer F: 5'-GTCTTTAAGTTAGCCCCATGTTAATATATTAT-3'

[0174] Reverse Primer R:

[0175] 5'-GGGGCTAACTTAAAGACTATATAATTATATGTACAGATTCATAGATATAAACCG-3'

[0176] g.-908T>C:

[0177] Forward Primer F:

[0178] 5'-ACATGCAGGTCGATTACAAAACTAACATCTAACTGTGG-3'

[0179] Reverse Primer R:

[0180] 5'-GTAATCGACCTGCATGTACTACAAGTACGTAAATGC-3'

[0181] g.-1107A>T:

[0182] Forward Primer F:

[0183] 5'-GTATAATCATTTTTGCTATAATATATATATTACAATACTACATATGAATACACATAGC-3'

[0184] Reverse Primer R:

[0185] 5'-AGCAAAAATGATTATACATGTACATGTAAATACA-3'

[0186] g.-1185C>G:

[0187] Forward Primer F:

[0188] 5'-CGGGGTAAAAACGTTCATACGTAAACATATATTGTGTCTTACGAC-3'

[0189] Reverse primer R: 5'-TGAACGTTTTTACCCCGTGTTATAGAATCGAA-3'

[0190] g.-1196T>C:

[0191] Forward Primer F: 5'-TTGACTGCGTTTCGAACATGAACCATTCAGCG-3'

[0192] Reverse Primer R:

[0193] 5'-GTTCGAAACGCAGTCAAATATCTACTTATAGAGAAAGGTC-3'

[0194] g.-1207C>A

[0195] Forward Primer F: 5'-GTAGACATTTGACTGCCTTTCGAACATGAACC-3'

[0196] Reverse Primer R:

[0197] 5'-GGCAGTCAAATGTCTACTTATAGAGAAAGGTCGCTGAATT-3'

[0198] 1 μl of Dpn I was added to the PCR product, and the original plasmid was digested at 37°C for 2 h. The PCR product was purified by gel recovery and ligated.

[0199] The ligation reaction system is as follows:

[0200] Element Dosage Dpn I digestion products 14μl Buffer 4μl Ligase 2μl

[0201] The ligation reaction procedure is as follows:

[0202] 37℃, 30min; cool to 4℃ or immediately cool on ice.

[0203] The ligated plasmid was transformed into E. coli cells, positive strains were selected by Sanger sequencing, and the bacterial solution was supplemented to 15 ml, and the plasmid was extracted by alkaline lysis after vigorous shaking at 37°C for 16 to 20 hours. The concentration and quality of the plasmid were further determined using a nucleic acid detector (Nanodrop2000, USA).

[0204] 3) Dual luciferase reporter assay: The original plasmid, mutant plasmid and internal reference plasmid pRL-TK were transfected at a ratio of 19:1 into HEK293T cells cultured in a 24-well plate at a growth density of about 70% to 80%.

[0205] The transfection system is as follows:

[0206]

[0207] After mixing the mixed solution I and the mixed solution II, they were placed at room temperature for 10 minutes, then gently added to the culture plate, and cultured at 37° C. under 5% carbon dioxide for 36 hours before conducting a dual luciferase reporter enzyme assay.

[0208] The reaction procedure is as follows:

[0209] 1) Use a pipette to remove the culture medium and add 500 μl of pre-cooled PBS to wash, repeat once.

[0210] 2) Add 200 μl of luciferase detection reagent, lyse at room temperature in the dark for 10 minutes, transfer to a 96-well plate with white round holes and opaque bottom, and read the fluorescence signal at a wavelength of 600 nm using a full-wavelength scanning multifunctional reader.

[0211] 3) Add 200 μl of stop reagent, let stand at room temperature in the dark for 10 minutes, and read the second fluorescence signal at a wavelength of 600 nm using a full-wavelength scanning multifunctional reader.

[0212] 4) All experiments were performed in triplicate, and the firefly luciferase activity of each sample was normalized to the Renilla luciferase activity.

[0213] The results showed that mutations at each site significantly reduced the transcriptional activity of the promoter region of Crassostrea gigas. These sites may mediate the basal expression of the Scd gene in Crassostrea gigas. Figure 4 .

[0214] e) Scd temperature adaptability function verification:

[0215] 1) Oyster low temperature stress experiment: Long oysters and Fujian oysters were placed in an ice bath at 4℃ for 10 days and gill tissues were collected for Scd gene quantification and C18:1Ω9 content determination. The results showed that Scd gene and its metabolite C18:1Ω9 are important temperature response genes and metabolites. See Appendix Figure 5 .

[0216] 2) Scd cell membrane fluidity experiment: The oyster Scd gene was constructed on the overexpression vector pcDNA3.1, and the plasmid construction was the same as above. Transfection was performed into HEK293T cells cultured in a 35mm confocal dish, and the transfection steps were the same as above. 1μM 4'-(trimethylammonium)diphenylhexatriene (TMA-DPH) live cell membrane staining reagent was added to stain the cell membrane. After strong laser bleaching of the selected area using a Zeiss LSM710 laser scanning confocal microscope, the fluorescence intensity value of the target area was collected every 0.783 seconds. The maximum recovery rate and half recovery time were calculated based on the fluorescence recovery curve. The results showed that after overexpressing the oyster Scd gene, the fluorescence recovery time after laser bleaching was significantly accelerated, and the maximum recovery rate was significantly improved, further verifying that the Scd gene can regulate cell membrane fluidity, thereby affecting the cell membrane and biological temperature adaptability. See Appendix. Figure 6 .

[0217] Example 2

[0218] a) Collection of experimental materials and homogenized domestication: In 2020, wild long oysters and Fujian oysters were collected in Qingdao and Xiamen respectively and temporarily cultured in Qingdao for 3 months. 30 female long oysters and 30 male Fujian oysters were hybridized to construct the hybrid population F1 of long oysters and Fujian oysters. In March 2021, 30 females and 30 males were self-pollinated in the hybrid population F1 to construct the self-pollinated population F2, which was cultured along the coast of Qingdao. In February 2022, the mantle tissues of 120 F2 populations were collected and quickly frozen in liquid nitrogen for fatty acid content determination, and the remaining tissues were quickly frozen in liquid nitrogen and stored at -80°C for DNA extraction and genotype detection.

[0219] b) Determination of fatty acid content: The mantle tissue was freeze-dried for 48 hours, ground into fine powder using a tissue grinder, and the oyster monounsaturated fatty acid C18:1Ω9 content was determined by gas chromatography using an Agilent 7890A on a GC-FID platform.

[0220] c) DNA extraction, the extraction method is the same as above d) SNP site genotype detection by Sanger sequencing after PCR amplification:

[0221] A pair of specific primer sequences was used to perform typing tests on 15 SNP loci;

[0222] 1) Use specific primers to perform peripheral amplification. The reaction system is as follows;

[0223] Element Dosage DNA polymerase 45μl Forward Primer 2μl Reverse primer 2μl DNA template 1μl

[0224] The primer sequences are:

[0225] Forward Primer F: 5'-GGCCAAGTGGATTACACTCG-3'

[0226] Reverse Primer R: 5'-TGCTAACAGTTTCGCTCCAC-3'

[0227] The reaction procedure for PCR amplification is:

[0228]

[0229] 2) After the PCR reaction described in step (1) is completed, the PCR products are separated by 2% polyacrylamide gel electrophoresis, and the band at the 1 kb position is cut and recovered from the gel, and the purified PCR products are further measured for DNA concentration and quality using a nucleic acid detector (Nanodrop2000, USA).

[0230] 3) The purified PCR products were used for genotyping by Sanger sequencing.

[0231] e) Association analysis: The C18:1Ω9 content data and genotype data were imported into the online association analysis tool SHEsisPlus (http: / / shesisplus.bio-x.cn / SHEsis.html) for single marker association analysis. The results showed that the 15 SNP sites were significantly correlated with the C18:1Ω9 content (P<0.05). The C18:1Ω9 content of 120 individuals was statistically obtained, SNP1 site CC>AA>CA, SNP2 site TT>CC>TC, SNP3 site CC>GC>GG, SNP4 site AA>AT>TT, SNP5 site TT>TC>CC, SNP6 site AA>AG>GG, SNP7 site AA>AG>GG, SNP8 site CC>CA>AA, SNP9 site TT>TC>CC, SNP10 site GG>GC>CC, SNP11 site CC>CT>TT, SNP12 site AA>AG>GG, SNP13 site GG>GT>TT, SNP14 site GG>GA>AA, SNP15 site CC>CT>TT. The content of individuals with superior genotype combination of 15 sites was significantly higher than that of individuals with inferior genotype combination. The specific information is shown in Table 1 and Appendix Figure 7

[0232] Table 1: C18:1Ω9 content and genotyping analysis of 120 hybrid F2 individuals

[0233]

[0234]

Claims

1. Application of a molecular module for regulating the content of monounsaturated fatty acids and temperature adaptability in oysters, Features: The molecular module is used for auxiliary breeding to improve the monounsaturated fatty acid C18:1Ω9 content and temperature adaptability of long oysters and Fujian oysters; The molecular module is located in the 1010 bp region within 1207 bp to 197 bp at the 5' end of the start codon of the Scd gene; the nucleotide sequence of 100 bp upstream and downstream of the molecular module is shown in SEQ ID No. 1; The molecular module comprises the following 15 SNP marker sites, wherein SNP1 is g.-1207 C>A, SNP2 is g.-1196 T>C, SNP3 is g.-1185 C>G, SNP4 is g.-1107 A>T, SNP5 is g.-908 T>C, SNP6 is g.-720 A>G, SNP7 is g.-649 A>G, SNP8 is g.-491 C>A, SNP9 is g.-389 T>C, SNP10 is g.-354 G>C, SNP11 is g.-333 C>T, SNP12 is g.-310 A>G, SNP13 is g.-275G>T, SNP14 is g.-273 G>A, and SNP15 is g.-198 C>T; SNP1-15 markers are located at the 101st, 112th, 123rd, 201st, 400th, 588th, 659th, 817th, 919, 954, 975, 998, 1033, 1035th and 1110th bases M, Y, S, W, Y, R, R, M, Y, S, Y, R, K, R and Y at the 5' end of SEQ ID No. 1, respectively, and the mutation types are C / A, T / C, C / G, A / T, T / C, A / G, A / G, C / A, T / C, G / C, C / T, A / G, G / T, G / A and C / T.

2. A method for assisting breeding using the molecular module according to claim 1, Features: Before breeding, the genotype of at least one of the 15 SNP marker sites was identified for the parent shellfish, and the order of C18:1Ω9 content of the individuals was: SNP1: CC>CA>AA; SNP2: TT>TC>CC; SNP3: CC>GC>GG, SNP4: AA>AT>TT; SNP5: TT>TC>CC; SNP6: AA>AG>GG; SNP7: AA>AG>GG; SNP8: CC>CA>AA; SNP9: TT>TC>CC; SNP10: GG>GC>CC; SNP11: CC>CT>TT; SNP12: AA>AG>GG; SNP13: GG>GT>TT; SNP14: GG>GA>AA; SNP15 site CC>CT>TT; and by screening the parent shellfish with the advantageous genotype combination, the parent shellfish with improved C18:1Ω9 content and temperature adaptability of the offspring individuals were obtained.

3. The method for molecular module-assisted breeding as claimed in claim 2, Features: (1) DNA extraction: The total DNA of each individual was extracted from the adductor muscle of the oyster to be tested using the sodium laurate method; (2) Using the genomic DNA of the oyster to be tested as a template, PCR amplification of the SNP site was performed using specific primers; (3) Genotyping of the above loci using Sanger sequencing; The specific primer pair sequences are: Forward primer F: 5′- GGCCAAGTGGATTACACTCG -3′; Reverse primer R: 5'- TGCTAACAGTTTCGCTCCAC -3'.

Images