Application of REG3A in the preparation of reagents or drugs for auxiliary diagnosis or treatment of hepatoblastoma

Abstract

The present invention discloses the application of REG3A in the preparation of reagents or drugs for auxiliary diagnosis or treatment of hepatoblastoma, and belongs to the field of biomedicine. The application of REG3A as a biomarker for auxiliary diagnosis of hepatoblastoma is a reagent for detecting the expression level of REG3A protein in the serum or tissue sample of the subject. A high expression level of REG3A protein indicates a high risk of childhood hepatoblastoma. REG3A can also be used to prepare drugs for the treatment of hepatoblastoma, especially targeted drugs. On the one hand, the present invention proves that REG3A can be used as a marker for auxiliary diagnosis of hepatoblastoma, improving the current situation of the lack of auxiliary diagnosis markers while improving the auxiliary diagnosis efficiency. On the other hand, it proves that REG3A is involved in the occurrence and development of hepatoblastoma, and can be used as a new target for the treatment of hepatoblastoma, providing new means and methods for its auxiliary diagnosis and targeted treatment, which has important scientific and clinical value.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of REG3A in preparing reagents or drugs for auxiliary diagnosis or treatment of hepatoblastoma. Background Art

[0002] Hepatoblastoma is a highly malignant embryonic childhood liver tumor that originates from immature hepatoblasts that are arrested at different stages of liver differentiation and development in the early embryonic period. The specific pathogenesis is still unclear. Hepatoblastoma mostly occurs in infants and young children under 5 years old, accounting for about 80% of childhood liver malignant tumors. The disease progresses rapidly, and the incidence has gradually increased in the past 30 years. Whether the tumor can be completely removed is a key factor affecting the prognosis of hepatoblastoma. However, due to the insidious onset and rapid progression of hepatoblastoma, more than 70% of children are in stage III-IV at the time of initial diagnosis. Missing the opportunity for complete surgical resection leads to a poor prognosis, with a 5-year survival rate of about 60%. Therefore, laboratory-assisted diagnosis is of great significance.

[0003] AFP is currently the only serum marker for auxiliary diagnosis of hepatoblastoma in clinical practice. However, about 10% of children have normal or only slightly elevated serum AFP levels. Patients with benign liver lesions may also have elevated AFP levels, and infants and young children have naturally high serum AFP levels. Laboratory-assisted diagnosis and prognosis of hepatoblastoma based solely on serum AFP levels have certain limitations. AFP levels cannot indicate the variability of the genetic characteristics of hepatoblastoma, and are of limited use in developing evidence-based treatments.

[0004] Regeneration gene family protein 3A (REG3A) is a 19-kDa calcium-dependent lectin protein that is involved in the regulation of biological processes such as cell proliferation, apoptosis, and tissue repair, and can be secreted into the blood. At present, research on the pathogenesis of hepatoblastoma mainly focuses on the overactivation of the Wnt / β-catenin signaling pathway. About 70% of hepatoblastomas show abnormal activation of the Wnt / β-catenin signaling pathway. According to literature reports, REG3A is a downstream protein of the Wnt / β-catenin signaling pathway. In 28 cases of hepatoblastoma with β-catenin mutations, REG3A was upregulated.

[0005] However, there is no study to detect the expression level of REG3A in the serum of children with hepatoblastoma, and there is no application of REG3A in the auxiliary diagnosis and treatment of hepatoblastoma. Summary of the invention

[0006] The purpose of the present invention is to provide the application of REG3A as a biomarker for auxiliary diagnosis of hepatoblastoma in view of the deficiencies in the prior art.

[0007] In a first aspect, the present invention provides the use of REG3A gene or protein as an auxiliary diagnostic marker in the preparation of a reagent for auxiliary diagnosis of hepatoblastoma.

[0008] In a second aspect, the present invention provides an application of a reagent for detecting REG3A in the preparation of a reagent for auxiliary diagnosis of hepatoblastoma, wherein the reagent for detecting REG3A is a reagent for detecting the content of REG3A gene or protein, wherein a high expression level of REG3A gene or protein indicates a high risk of hepatoblastoma in children.

[0009] Preferably, the reagent for detecting the content of REG3A gene or protein is selected from a primer for specific amplification of REG3A gene, a probe for specific recognition of REG3A gene or its transcript, and an antibody specific against REG3A protein.

[0010] Preferably, the test sample is tissue, serum or plasma.

[0011] Preferably, the reagents for auxiliary diagnosis of hepatoblastoma include but are not limited to nucleic acid extraction reagents, polymerase chain reaction reagents, protein immunoblotting reagents and enzyme-linked immunosorbent assay reagents.

[0012] In a third aspect, the present invention provides a kit for diagnosing hepatoblastoma, comprising the aforementioned reagent for detecting the content of REG3A gene or protein.

[0013] In a fourth aspect, the present invention provides use of REG3A gene or protein or their inhibitors in the preparation of a drug for treating hepatoblastoma.

[0014] Preferably, the inhibitor is selected from small molecule compounds or biological macromolecules.

[0015] More preferably, the biomacromolecule is selected from small interfering RNA, dsRNA, shRNA, microRNA, antisense nucleic acid that has REG3A gene or its transcript as the target sequence and can inhibit REG3A protein expression or gene transcription; or a construct that can express or form the small interfering RNA, dsRNA, microRNA, antisense nucleic acid.

[0016] More preferably, the biomacromolecule is an interfering RNA of the REG3A gene, and the targets include siREG3A-1 and siREG3A-2, and the sequences are as follows:

[0017] siREG3A-1: UCCCUCUGGGGUUCUUCAC (SEQ ID NO: 1)

[0018] siREG3A-2:UAAUUCAUCACAUCACUGC (SEQ ID NO: 2).

[0019] In a fifth aspect, the present invention provides a method for screening a potential substance for treating hepatoblastoma, comprising:

[0020] (1) treating a system expressing REG3A gene or protein with a candidate substance;

[0021] (2) detecting the expression of the REG3A gene or protein in the system of step (1); if the candidate substance can reduce the expression of the REG3A gene or protein, it indicates that the candidate substance is a desired potential substance, otherwise it indicates that the candidate substance is an undesired potential substance.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention conducted high-throughput sequencing analysis in 16 pairs of hepatoblastoma tissues and adjacent tissues and found that REG3A was highly expressed in hepatoblastoma and was verified in patient serum, indicating that it can be used as a marker for auxiliary diagnosis of hepatoblastoma, improving the current situation of lack of auxiliary diagnostic markers.

[0024] 2. The auxiliary diagnostic specimens in the present invention can be tissues, serum or blood, which are abundant in source and easy to obtain.

[0025] 3. The present invention found that knocking down REG3A can significantly inhibit the proliferation of hepatoblastoma cells and promote their apoptosis process, indicating that REG3A is involved in the occurrence and development of hepatoblastoma and can be used as a new target for the treatment of hepatoblastoma, which has important scientific and clinical value.

[0026] In summary, the present invention provides new means and methods for clinical auxiliary diagnosis and treatment of hepatoblastoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 In the example, REG3A is highly expressed in hepatoblastoma tissues and cells; A: Heatmap indicates the top 10 genes highly expressed in hepatoblastoma tissues compared with adjacent tissues; B: Volcano plot indicates differential gene expression in hepatoblastoma tissues and adjacent tissues; C: qPCR detection of REG3A mRNA expression in tumor tissues of hepatoblastoma patients; D: WB detection of REG3A protein expression levels in 4 pairs of hepatoblastoma tissues; E: WB detection of REG3A expression levels in mouse liver tissues at different stages; F: WB detection of REG3A expression levels in hepatoblastoma cells and normal liver cells.

[0028] Figure 2The expression level of REG3A in hepatoblastoma serum in the example; A: WB detection of REG3A expression level in 18 hepatoblastoma sera and 18 healthy children's sera underwent physical examination; B: ELISA method detected the expression level in 44 hepatoblastoma sera and 44 healthy children's sera underwent physical examination; C: ROC curve analysis of the auxiliary diagnostic efficacy of serum REG3A level.

[0029] Figure 3 The effects of interfering with REG3A on hepatoblastoma in the examples; A: detection of REG3A expression after siREG3A treatment; BC: determination of proliferation of HepG2 and HuH6 after siREG3A treatment using CCK8 method; DE: detection of apoptosis of HepG2 cells after siREG3A using flow cytometry. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described in conjunction with the drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0031] Example 1

[0032] 1. Materials and methods

[0033] 1.1 Inclusion criteria of the research subjects

[0034] All hepatoblastoma patients and children undergoing physical examinations included in the study signed informed consent before blood sample collection. 1) The inclusion criteria for the hepatoblastoma patient group were confirmed hepatoblastoma by pathological histology or cytology examination; 2) The inclusion criteria for the healthy children group were children who had a physical examination in the pediatric health department without malignant tumors or liver-related benign or malignant diseases.

[0035] 1.2 Collection and processing of serum samples

[0036] Serum samples were collected from 44 children with hepatoblastoma and 44 children undergoing physical examination under the same conditions. Serum was obtained by centrifugation and stored in a -80℃ refrigerator for future use.

[0037] 1.3 Collection and processing of hepatoblastoma tissue samples

[0038] Hepatoblastoma tissue samples and adjacent tissue specimens (>3 cm from the tumor edge) were obtained from the Department of Oncology, Shanghai Children's Medical Center. All samples were obtained with the consent of the patients and approved by the Ethics Committee.

[0039] 1.4 Cells

[0040] Hepatoblastoma cell lines Hep-G2 and HUH6 were purchased from the Cell Bank of the Chinese Academy of Sciences (Shanghai). Hep-G2 cells were cultured in MEM medium, and HUH6 cells were cultured in DMEM medium. The cells were placed in a 37°C cell culture incubator with 5% CO2.

[0041] 1.5 Detection of REG3A mRNA expression by quantitative PCR

[0042] Real-time fluorescence quantitative polymerase chain reaction (PCR) was used to detect the expression of REG3A mRNA. Total RNA from tissues or cells was extracted and cDNA was obtained by RNA reverse transcription. Real-time fluorescence quantitative PCR analysis was performed using cDNA as a template. The primer sequences of REG3A were: upstream primer ATATCCCACCAGAGAGGTAAG (SEQ ID NO: 3), and downstream primer GGTCACATCCATCATCTTCTAC (SEQ ID NO: 4).

[0043] 1.6 WB detection of REG3A protein levels in tissues and blood

[0044] Western blotting (WB) was used to detect the expression of REG3A protein in tissues and serum. 6× Loading Buffer was added to the hepatoblastoma tissue lysate or serum, boiled for 10 min, and then loaded on SDS-PAGE gel, and marker was added at the same time. Electrophoresis was performed at 80V. When the bromophenol blue front reached the separation gel, 15mA / plate was used until the bromophenol blue reached the bottom of the gel. The black grid, absorbent sponge, three filter papers, absorbent sponge, gel, labeled PVDF membrane, three filter papers, absorbent sponge, and red grid were installed in the order of sandwich structure and placed in the transfer device, with the PVDF membrane facing the positive electrode and the gel facing the negative electrode, and transferred at a constant current of 200mA and 4°C for 30min. The PVDF membrane was rinsed with 1×TBST for 5 minutes, non-specific antigen sites were blocked with calf serum, and REG3A rabbit polyclonal antibody diluted with 1×TBST was added, shaken overnight at 4°C, and the membrane was washed with 1×TBST for 10 minutes for a total of 3 times, and the goat anti-rabbit Ig labeled with horseradish peroxidase (HRP) diluted with TBST was added and incubated at room temperature for 1 hour, and the membrane was washed with 1×TBST for 10 minutes for a total of 3 times. The membrane was placed in a substrate mixture containing hydrogen peroxide / luminol and p-iodophenol and shaken for 10 minutes. In a dark room, an X-ray film was pressed on the membrane, and after exposure for 1-3 minutes, the X-ray film was taken out and placed in a developer until a clear image appeared, and the water was removed and placed in a fixer for 2 minutes. The film was rinsed with clean water and dried.

[0045] 1.7 ELISA

[0046] Use the purified REG3A capture antibody to coat the microplate. Add the specimen to the microplate and set up the control standard well. Add 50μL of standard with different final concentrations to each well. First add 40μL of sample diluent to each well of the sample well and then add 10μL of serum specimen. Add 100μL of horseradish peroxidase labeling solution to each well, seal the film and incubate at 37℃ for 1h. Discard the excess liquid, add the washing solution to each well for 30s and then discard it. Repeat 5 times and then dry the liquid in the well. Add 50μL of A and B colorants to each well, incubate at 37℃ in the dark, add the reaction stop solution after 15min, and use the microplate reader to measure the absorbance value at 450nm. The regression equation is calculated based on the absorbance value of the standard to obtain the concentration of REG3A in the patient's serum specimen.

[0047] 1.8 Artificial synthesis of siRNA targeting REG3A

[0048] siRNA targeting REG3A was designed: siREG3A-1 and siREG3A-2, the target sequences are as follows:

[0049] siREG3A-1: UCCCUCUGGGGUUCUUCAC (SEQ ID NO: 1);

[0050] siREG3A-2:UAAUUCAUCACAUCACUGC (SEQ ID NO: 2).

[0051] 1.9CCK8 detection of cell proliferation

[0052] The cells were seeded into 6-well plates at the corresponding density. The cell confluence was about 40-50% on the day of transfection. During transfection, siRNA was added to OPTI-MEM containing cationic liposomes (the final concentration of siRNA was 50nM). After incubation in a cell culture incubator for 5-6h, fresh complete medium was replaced. The cells were collected about 48h after transfection for standby use. After the cells were treated, 1000 cells per well were seeded into 96-well plates. 10μL CCK8 solution was added every day after seeding, and the culture was continued. After 2h, the absorbance at a wavelength of 450nm was detected by a microplate reader to calculate the relative proliferation activity.

[0053] 1.10 Statistical methods

[0054] The data were analyzed statistically using SPSS 20.0 (SPSS, Chicago, USA). The chi-square test was used to analyze the differences among the groups, and p < 0.05 indicated statistical significance.

[0055] 2. Results

[0056] 2.1 Transcriptomic analysis of REG3A overexpression in hepatoblastoma patients

[0057] High-throughput sequencing technology was used to analyze the mRNA expression levels in 16 pairs of hepatoblastoma tissues and their paired adjacent tissues. The sequencing data were analyzed for bioinformatics, and Foldchange>2 and p-value<0.05 were used as cut-off values ​​to statistically analyze differentially expressed genes ( Figure 1 A and 1B), it was found that REG3A mRNA was highly expressed in HB tissues and ranked Top 1 according to the FoldChange value. Then, the expression of REG3A mRNA was verified by qPCR experiment in 32 pairs of hepatoblastoma tissues and their paired adjacent cancer tissues. The results also showed that REG3A was significantly highly expressed in hepatoblastoma patients ( Figure 1 C). Subsequently, WB was used to examine the protein level of REG3A in 4 pairs of hepatoblastoma tissues and paired adjacent tissues, and it was found that REG3A protein was highly expressed in hepatoblastoma tissues ( Figure 1 D). It was also found that the expression level of REG3A in hepatoblastoma cells was significantly higher than that in normal liver cells ( Figure 1 E). And with the development of mouse fetal liver, the expression level of REG3A protein gradually decreased, and the expression level in adult tissues was extremely low ( Figure 1 E), the above results indicate that REG3A, as an oncofetal gene, is highly expressed in hepatoblastoma tissues, but its expression level is extremely low in adult tissues, suggesting that REG3A may have good auxiliary diagnosis and targeted therapy value.

[0058] 2.2REG3A is highly expressed in the serum of hepatoblastoma patients

[0059] To evaluate the potential of REG3A as a serum auxiliary diagnostic marker for hepatoblastoma, the expression level of REG3A in the sera of 18 hepatoblastoma patients and 18 healthy children undergoing physical examinations was first detected by WB. The results showed that the expression level of REG3A in the sera of the children undergoing physical examinations was extremely low, while it was significantly high in the sera of hepatoblastoma patients ( Figure 2 A). ELISA was further used to detect the level of REG3A in the serum of 44 hepatoblastoma patients and 44 healthy children. According to the numerical distribution characteristics of the standard, a cubic equation was used for fitting (y = 3.266x 3 -5.6061x 2 +5.2062x-0.475, R 2 =1). The measured OD value was substituted into the formula and the obtained value was multiplied by 4 to obtain the concentration of REG3A in the sample (Table 1). The results showed that REG3A was significantly overexpressed in the serum of hepatoblastoma patients ( Figure 2B) (Table 2). The ROC curve analysis of REG3A's specificity and sensitivity in distinguishing serum from hepatoblastoma patients and healthy children showed that REG3A had a very high auxiliary diagnostic efficacy, with an area under the curve of up to 0.9685, indicating that REG3A can be used as a serum marker for auxiliary diagnosis of hepatoblastoma ( Figure 2 C).

[0060] Table 1

[0061] Table 2

[0062] Control Case P-value N 44 44 Age, years 3.16±1.54 3.82±2.59 0.8863 Malegender.no.(%) 29(65.91％) 29(65.91％) 1 REG3A,ng / mL 7.39±5.75 35.97±12.04 <0.0001

[0063] 2.3REG3A promotes the occurrence and development of hepatoblastoma

[0064] To explore the role of REG3A in hepatoblastoma, siRNA was used to silence the expression of REG3A gene, and qRT-PCR was used to verify the efficiency ( Figure 3 A), CCK8 experimental results showed that knocking down REG3A could inhibit the proliferation of hepatoblastoma cells ( Figure 3 BC); flow cytometry was used to detect the number of apoptotic cells and it was found that siREG3A interference effectively induced apoptosis of hepatoblastoma cells ( Figure 3 DE). In summary, REG3A is involved in the occurrence and development of hepatoblastoma, plays an important role in the proliferation of hepatoblastoma cells, and can be used as a new target for the treatment of hepatoblastoma, which has important scientific and clinical value.

[0065] The above description of the embodiments is to facilitate the understanding and use of the present invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments. Improvements and modifications made by those skilled in the art based on the principles of the present invention without departing from the scope of the present invention should be within the protection scope of the present invention.

Claims

1. Application of REG3A gene inhibitors in the preparation of drugs for treating hepatoblastoma; The inhibitor of the REG3A gene is siRNA targeting the REG3A gene; The siRNAs are siREG3A-1 and siREG3A-2, wherein: The sequence of siREG3A-1 is UCCCUCUGGGGUUCUUCAC; The sequence of siREG3A-2 is UAAUUCAUCACAUCACUGC.

Images