Lactobacillus rhamnosus, application, plasmid, gene knockout strain and preparation method thereof

Abstract

The present application belongs to the field of microorganisms, and discloses a strain of Lactobacillus rhamnosus, with the classification name of Lactobacillus Rhamnosus, the deposit number of which is: CGMCC 28996; the deposit date is: November 14, 2023, and the deposit unit is: General Microbiological Center of China Microbiological Culture Collection Administration. Its nucleoside degradation ability is comparable to that of Lactobacillus plantarum SQ001. At the same time, the present invention also provides a plasmid for knocking out a target gene, a preparation method of a target gene knockout strain of Lactobacillus rhamnosus, and its application.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to a Lactobacillus rhamnosus strain, application, plasmid, gene knockout strain and preparation method thereof. Background Art

[0002] In the applicant's prior application ZL202211437854.7, a strain of Lactobacillus plantarum was disclosed, which has excellent ability to degrade nucleosides. At the same time, it can produce the metabolite proline, promote the production of α-linolenic acid, and reduce blood uric acid levels by promoting the expression of liver HGPRT (hypoxanthine guanine phosphoribosyltransferase) and ADSS2 (adenylate succinate synthetase).

[0003] The applicant has made new discoveries in subsequent research. By screening a large number of candidate strains, we screened out another strain with equal or better effects, and verified its specific functional genes, proving the role of the relevant genes.

[0004] The problem that this scheme needs to solve: How to discover a bacterium with better ability to reduce nucleosides. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Lactobacillus rhamnosus, whose nucleoside degradation ability is comparable to that of Lactobacillus plantarum SQ001.

[0006] At the same time, the present invention also provides a plasmid for knocking out a target gene, a preparation method of a target gene knockout strain of Lactobacillus rhamnosus and applications thereof.

[0007] To achieve the above-mentioned purpose, the present application discloses a strain of Lactobacillus rhamnosus, classified as Lactobacillus Rhamnosus, with a preservation number of CGMCC 28996; preservation date: November 14, 2023, preservation unit: General Microbiology Center of China Microbiological Culture Collection Administration, and preservation address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0008] The present invention also discloses the use of the above-mentioned Lactobacillus rhamnosus to prepare a medicament for degrading nucleosides outside an organism or for degrading nucleosides inside an organism.

[0009] The strain provided by the present invention has been subjected to in vivo and in vitro nucleoside degradation experiments of organisms. Based on the above experiments, we can reasonably infer that the strain of the present invention can not only be used as a related in vitro material such as culture medium, related food pretreatment and other applications to degrade nucleosides, but also can be used as an oral medicament, such as one of the raw materials in probiotics or composite probiotics, and as one of the raw materials of probiotic feed additives.

[0010] The invention also discloses the use of the lactobacillus rhamnosus for preparing food or feed additives added with the lactobacillus rhamnosus.

[0011] The food of the present invention includes but is not limited to: dairy products, meat products, pre-prepared dishes, beverages, etc.;

[0012] The feed additives of the present invention include but are not limited to: probiotics, compound enzyme preparations, compound probiotics, bacterial proteins, etc.;

[0013] In addition, the present invention also discloses a plasmid for constructing a target gene knockout strain of Lactobacillus rhamnosus, wherein the plasmid contains the following fragments:

[0014] Used to screen for resistance gene fragments of Escherichia coli;

[0015] Used to screen resistance gene fragments of Lactobacillus rhamnosus;

[0016] 2,6-p-D-fructan 6-3-D-fructosyltransferase gene fragment;

[0017] The upstream homology arm gene fragment of the target gene;

[0018] Downstream homology arm gene fragment of the target gene.

[0019] The target gene is one of the iunH gene, ABCT gene and pbuX gene in Lactobacillus rhamnosus as described above.

[0020] In the above-mentioned plasmid for constructing the target gene knockout strain of Lactobacillus rhamnosus, the resistance gene fragment used for screening Escherichia coli is a p15a-cm-HA fragment, and its nucleotide sequence is shown in SEQ ID NO.4;

[0021] The resistance gene fragment used for screening Lactobacillus rhamnosus is a scaB fragment, and its nucleotide sequence is shown in SEQ ID NO.5.

[0022] In the above-mentioned plasmid for constructing a target gene knockout strain of Lactobacillus rhamnosus, when the target gene is the iunH gene, the plasmid is a p15A-cm-HAR-HAL-erm-scaB-iunH plasmid, and its nucleotide sequence is shown in SEQ ID NO.1;

[0023] When the target gene is the ABCT gene, the plasmid is the p15A-cm-HAR-HAL-erm-scaB-GABCT plasmid, and its nucleotide sequence is shown in SEQ ID NO.2;

[0024] When the target gene is the pbuX gene, the plasmid is the p15A-cm-HAR-HAL-erm-scaB-GpbuX plasmid, and its nucleotide sequence is shown in SEQ ID NO.3.

[0025] At the same time, the present invention also discloses a method for preparing a target gene knockout strain of Lactobacillus rhamnosus, comprising the following steps:

[0026] Step 1: electrotransform the Lactobacillus rhamnosus according to claim 1 using any of the plasmids described above;

[0027] Step 2: using an antibiotic matching the plasmid to screen the Lactobacillus rhamnosus obtained in step 1 to obtain a recombinant deletion strain L. rhamnosus△Gene;

[0028] Step 3: Use sucrose to screen the recombinant deletion strain L. rhamnosus△Gene to obtain a secondary recombinant gene deletion strain; the gene deletion strain is the target gene knockout strain of Lactobacillus rhamnosus.

[0029] Based on the above method, the present invention also discloses a target gene knockout strain of Lactobacillus rhamnosus, which is prepared by the above method.

[0030] Finally, the present invention also discloses a method for verifying the involvement of a target gene in nucleoside degradation using the target gene knockout strain of Lactobacillus rhamnosus as described above.

[0031] The beneficial effects of this application are:

[0032] 1. The present invention isolates a new strain of Lactobacillus rhamnosus, which has a nucleoside degradation ability comparable to that of Lactobacillus plantarum SQ001 proposed earlier by the applicant; enriches the source of raw materials for preparing medicines and foods for nucleoside degradation;

[0033] 2. The method for preparing the Lactobacillus rhamnosus iunH, ABCT, and pbuX gene knockout strains of the present invention is simple and reliable.

[0034] 3. In order to knock out the iunH, ABCT, and pbuX genes in Lactobacillus rhamnosus, the upstream and downstream homologous arms contained in the plasmid of the present invention are more than 1 kb in length to improve the efficiency of single exchange homologous recombination; Red / ET homologous recombination technology is used to efficiently construct a multi-fragment inserted Lactobacillus rhamnosus gene knockout recombinant plasmid, and the combination of the two realizes the knockout of the nucleoside hydrolase gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a diagram of the predicted analysis of the gene functions of Lactobacillus rhamnosus;

[0036] Figure 2This is an information diagram of genes involved in nucleotide transport and metabolism in LGG;

[0037] Figure 3 This is the peak diagram of adenosine-guanosine-inosine mixed standard liquid phase;

[0038] Figure 4 This is the peak diagram of the liquid phase after Lactobacillus rhamnosus treated adenosine-inosine-guanosine for 180 minutes;

[0039] Figure 5 This is the liquid phase peak diagram after Lactobacillus plantarum 23180 treated with adenosine-inosine-guanosine for 180 minutes;

[0040] Figure 6 It is the peak response area diagram of nucleosides under the treatment of Lactobacillus rhamnosus and standard strain 23180;

[0041] Figure 7 This is a comparison chart of the degradation rates of adenosine-guanosine-inosine by Lactobacillus rhamnosus and the standard strain 23180;

[0042] Figure 8 This is the extracellular metabolome of Lactobacillus rhamnosus;

[0043] Fig. 9 This is the intracellular metabolome of Lactobacillus rhamnosus;

[0044] Fig.10 This is the transcriptional expression level diagram of Lactobacillus rhamnosus ABCT gene;

[0045] Fig.11 This is the transcription expression level diagram of Lactobacillus rhamnosus iunH gene;

[0046] Fig.12 This is the transcriptional expression level diagram of the pbuX gene of Lactobacillus rhamnosus;

[0047] Fig.13A This is a graph showing the results of body weight in the in vivo growth performance test of Lactobacillus rhamnosus;

[0048] Fig. 13B This is a graph showing the average daily weight gain of Lactobacillus rhamnosus in vivo test growth performance;

[0049] Fig. 13C This is a result diagram of the average daily feed intake in the in vivo test growth performance of Lactobacillus rhamnosus;

[0050] Fig.14A This is the result of uric acid in serum biochemical results of Lactobacillus rhamnosus in vivo test;

[0051] Fig. 14B This is the result of xanthine oxidase in serum biochemical results of Lactobacillus rhamnosus in vivo test;

[0052] Fig. 14C This is the result of urea nitrogen in serum biochemical results of Lactobacillus rhamnosus in vivo test;

[0053] Fig.14D This is the result graph of creatinine in serum biochemical results of Lactobacillus rhamnosus in vivo test;

[0054] Fig.15A This is the result of the in vivo test of Lactobacillus rhamnosus on the inflammatory factor interleukin-1β in serum;

[0055] Fig. 15B This is the result of interferon-γ in serum inflammatory factors in the in vivo test of Lactobacillus rhamnosus;

[0056] Fig. 15C This is the result of the in vivo test of Lactobacillus rhamnosus on the level of tumor necrosis factor-α in serum inflammatory factors;

[0057] Fig.16A This is a graph showing the results of CNT2 in the intestinal IPEC-J2 cell experiment with Lactobacillus rhamnosus metabolites;

[0058] Fig. 16B This is a graph showing the results of TJP1 in an experiment of treating intestinal IPEC-J2 cells with Lactobacillus rhamnosus metabolites;

[0059] Fig. 16C This is the result of the Lactobacillus rhamnosus metabolite treatment of ABCG2 in the intestinal IPEC-J2 cell test;

[0060] Fig.16D This is the result of the Lactobacillus rhamnosus metabolite treatment of GLUT9 in the intestinal IPEC-J2 cell experiment;

[0061] Fig.17A This is a graph showing the results of PRPS in a kidney BHK cell test using Lactobacillus rhamnosus metabolites.

[0062] Fig. 17B This is a graph showing the results of PPAT in a kidney BHK cell test using Lactobacillus rhamnosus metabolites.

[0063] Fig. 17C This is a graph showing the results of ADA in a kidney BHK cell test using Lactobacillus rhamnosus metabolites;

[0064] Fig.17D This is a graph showing the results of XOD in a test of Lactobacillus rhamnosus metabolites treating kidney BHK cells;

[0065] Fig.18A This is the result of the experiment of treating liver Hep-G2 cells with Lactobacillus rhamnosus metabolites with ABCG2;

[0066] Fig.18BThis is the result of the Lactobacillus rhamnosus metabolite treatment of OAT1 in the liver Hep-G2 cell test;

[0067] Fig.18C This is the result of the experiment of treating GLUT9 in liver Hep-G2 cells with Lactobacillus rhamnosus metabolites;

[0068] Fig.18D This is the result of the experiment of treating URAT1 in liver Hep-G2 cells with Lactobacillus rhamnosus metabolites;

[0069] Fig.19 This is the plasmid map of p15A-cm-HAR-HAL-erm-scaB-GiunH;

[0070] Fig. 20 It is a schematic diagram of the single exchange recombination process and a diagram of the verification results;

[0071] Fig.21 This is the plasmid map of p15A-cm-HAR-HAL-erm-scaB-GABCT;

[0072] Fig. 22 This is the plasmid map of p15A-cm-HAR-HAL-erm-scaB-GpbuX;

[0073] Fig.23 Inosine standard liquid phase peak diagram;

[0074] Fig.24 Liquid phase peak diagram after Lactobacillus rhamnosus treated with inosine for 1 hour;

[0075] Fig.25 Liquid phase peak diagram after Lactobacillus rhamnosus treated with inosine for 3 hours;

[0076] Fig.26 Liquid phase peak diagram after Lactobacillus rhamnosus treated with inosine for 6 hours;

[0077] Fig. 27 Liquid phase peak diagram of Lactobacillus rhamnosus knocked out iunH after treating inosine for 1 hour;

[0078] Fig.28 Liquid phase peak diagram of Lactobacillus rhamnosus knocked out iunH after treating inosine for 3 hours;

[0079] Fig.29 Liquid phase peak diagram of Lactobacillus rhamnosus knocked out iunH after treating inosine for 6 hours;

[0080] Fig.30 Comparison of the degradation rates of inosine by Lactobacillus rhamnosus and Lactobacillus rhamnosus with iunH knocked out.

[0081] Fig.31Comparison of the degradation rates of inosine by Lactobacillus rhamnosus and Lactobacillus rhamnosus with pbuuX knocked out.

[0082] Fig.32 Comparison of the degradation rates of inosine by Lactobacillus rhamnosus and Lactobacillus rhamnosus with ABCT knocked out. DETAILED DESCRIPTION

[0083] The present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. In the description of the present invention, it should be noted that, if no specific conditions are specified in the embodiments, the conditions are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0084] Part I Reagents and Instruments

[0085] Table 1 Reagents or consumables

[0086]

[0087]

[0088] Table 2 Instruments and equipment

[0089]

[0090]

[0091]

[0092] Part II Isolation and identification of strains

[0093] 2.1. Preparation method of Lactobacillus rhamnosus

[0094] The present invention adopts the traditional plate coating separation method to isolate lactic acid bacteria from the Lactobacillus rhamnosus powder sample. It is identified as Lactobacillus rhamnosus (Lactobacillus Rhamnosus), the preservation number is: CGMCC 28996; the preservation date is: November 14, 2023, and the preservation unit is: General Microbiology Center of China Microbiological Culture Collection Administration. The strain has an optimal growth temperature of 37°C, is facultatively anaerobic, and grows in MRS medium.

[0095] Hereinafter, the wild-type genome of L. rhamnosus refers to the genome of Lactobacillus Rhamnosus isolated in this section;

[0096] LGG hereinafter refers to Lactobacillus Rhamnosus isolated in this section.

[0097] 1.3 Identification of lactic acid bacteria

[0098] The strain to be tested was streaked on an MRS solid plate (10.0 g of peptone, 5.0 g of beef extract powder, 4.0 g of yeast extract powder, 20.0 g of glucose, 1.0 mL of Tween-80, 2.0 g of dipotassium hydrogen phosphate, 5.0 g of sodium acetate, 2.0 g of triammonium citrate, 0.2 g of magnesium sulfate (MgSO4·7H2O), 0.05 g of manganese sulfate (MnSO4·4H2O), 15.0 g of agar, final pH 6.2±0.2, 1000 ml of distilled water. Adjust the pH to 6.4, sterilize at 121°C for 15 min, cool and pour the plate), and a single colony was inoculated into 5 ml of liquid MRS culture medium, and cultured at 37°C for 24 h as the first-generation activated strain; the first-generation strain was then transferred to 5 ml of liquid MRS culture medium at a 4% inoculation amount, and cultured at 37°C for 24 h as the second-generation activated strain, and the second-generation activated strain was used for subsequent experiments.

[0099] The activated lactic acid strain was inoculated into MRS liquid culture medium at a ratio of 1% by mass and cultured at 37° C. for 24 h.

[0100] Strain identification based on 16s rDNA: Using the genomic DNA of Lactobacillus rhamnosus as a PCR amplification template, a 25μL reaction system was used for PCR amplification. Template DNA 0.5ul, 10mmol upstream and downstream primers (27f / 1492r) 0.5μl each, 2×taq enzyme 12.5μL, supplemented to 25μl with ddH2O. PCR cycle parameters are: 95℃ pre-denaturation 5min; 95℃ denaturation 3min, 57℃ annealing 30s, 72℃ extension 2min, 30 cycles; 72℃ extension 10min. The PCR amplification product was sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing, and the sequence obtained by sequencing was subjected to homology comparison analysis with the GenBank database of NCBI. The results showed that the strain of the present invention is Lactobacillus rhamnosus, and the 16s rDNA sequence is shown in SEQ ID NO.6.

[0101] Gene function analysis

[0102] The protein sequences of species with completed genome sequencing are compared with the COG database to obtain the corresponding functional annotation information. Figure 1 , 97 genes were involved in nucleotide transport and metabolism. Further analysis revealed that Figure 2 , three genes are involved in purine nucleoside metabolism.

[0103] Part III Evaluation of the ability of Lactobacillus rhamnosus to degrade nucleosides in vitro

[0104] 3.1 Evaluation of the ability of Lactobacillus rhamnosus to degrade nucleosides using guanosine-inosine-adenosine phosphate buffer

[0105] Guanosine-inosine-adenosine phosphate buffer: Accurately weigh 0.02 g guanosine, 0.02 g inosine and 0.02 g adenosine, dilute to 100 ml with 20 mmol / l K3PO4 solution (pH 7.0) and adjust the pH to 7.0. The final guanosine concentration in the buffer is 0.2 g / l (0.706 mmol / l), the inosine concentration is 0.2 g / l (0.746 mmol / l), and the adenosine concentration is 0.2 g / l (0.746 mmol / l).

[0106] Take an appropriate amount of activated second-generation Lactobacillus rhamnosus culture fluid, centrifuge at room temperature at 4500r / min for 3 minutes, discard the supernatant, collect the bacteria, wash the bacteria twice with sterile physiological saline (NaCl solution with a mass concentration of 0.9%), add 1ml of guanosine-inosine-adenosine phosphate buffer to the washed bacteria, mix well, and incubate at 37°C for 180 minutes. After incubation, take the bacterial solution and centrifuge it at 4°C and 4500r / min for 3 minutes, take 810μl of the supernatant, add 90μl of the reaction terminator 0.1mol / l perchloric acid solution, mix well and centrifuge at 4500r / min for 3 minutes, take the supernatant and filter it with 0.22μl aqueous phase filter membrane for HPLC detection, and analyze the reduction of guanosine, adenosine and inosine in the reaction solution. Figure 3-7 The degradation rate of Lactobacillus rhamnosus reached 48% at 180 min, which was higher than that of the control commercial strain LP23180.

[0107] Referring to ZL202211437854.7, the degradation capacity of Lactobacillus plantarum SQ001 provided in this case under the same conditions is 46.99%;

[0108] That is to say, the Lactobacillus plantarum SQ001 proposed earlier by the present applicant and the Lactobacillus rhamnosus newly discovered by the present applicant have similar nucleoside degradation capabilities, and the nucleoside degradation capability of the Lactobacillus rhamnosus in this case is slightly better than that of the Lactobacillus plantarum SQ001.

[0109] 3.2 Microbial metabolomics further verifies the absorption and degradation effect of Lactobacillus rhamnosus

[0110] Take an appropriate amount of activated second-generation Lactobacillus rhamnosus culture medium, centrifuge at 4500r / min at room temperature for 3min, discard the supernatant, collect the bacteria, wash the bacteria twice with sterile saline (NaCl solution with a mass concentration of 0.9%), add 1ml of guanosine-inosine-adenosine phosphate buffer to the washed bacteria, mix well, and incubate at 37°C for 3h.

[0111] Extracellular metabolite extraction

[0112] The culture medium was shaken, a certain amount of culture medium was quickly taken out from the culture bottle, and centrifuged at 4°C (1000g, 10min); 500μL of the supernatant was transferred to a new centrifuge tube, and quickly placed in liquid nitrogen for quenching for 30s; after quenching, it was stored at -80°C.

[0113] Intracellular metabolite extraction

[0114] Measure bacterial OD and calculate 1*10 7 The volume of culture medium required for each bacterial cell; quickly collect the bacterial culture medium, and quickly centrifuge at 4°C (1000g, 10min) to separate the bacteria from the culture medium; remove the supernatant culture medium, and quickly immerse the bacteria in liquid nitrogen for quenching for 30s; after quenching, thaw on ice, wash off the residual culture medium with 1xPBS buffer (precooled at 4°C or -20°C), and then centrifuge (1000g, 4°C, 10min) to remove the PBS buffer; store at -80°C.

[0115] like Figure 8 and 9 Metabolomics analysis showed that after Lactobacillus rhamnosus treated nucleosides, the three nucleosides in the supernatant (LGGTNS) were significantly reduced, while they were significantly increased in the bacteria (NSTLGG), indicating that Lactobacillus rhamnosus can absorb nucleosides. This result also verified the results of HPLC. Nucleosides are the raw materials for purine metabolism. The reduction of nucleosides means that the production of uric acid is reduced from the source. At the same time, the increase of purines, nucleotides, and deoxynucleotides in the bacteria indicates that it may use nucleosides for its own growth and reproduction.

[0116] 3.3. RT-qPCR test to verify the expression of nucleoside transporter gene ABCT, nucleoside hydrolase gene iunH, and purine permease gene pbuX

[0117] Bacteria collection

[0118] After the Lactobacillus rhamnosus was treated with the above nucleosides, it was centrifuged at 4500 r / min for 3 min at room temperature, the supernatant was discarded, the bacteria were collected, and the bacteria were washed twice with sterile saline (NaCl solution with a mass concentration of 0.9%), and RNA was extracted according to the TIANGEN RNAprep BacteriaKit kit.

[0119] Gene expression assay

[0120] Fluorescence quantitative PCR was performed according to the SYBR Green Realtime PCR Master Mix (TOYOBO, Japan) kit method. The reaction conditions were: pre-denaturation at 95°C for 30s, denaturation at 95°C for 5s, annealing at the corresponding annealing temperature for 30s, extension at 72°C for 30s, 40 cycles, and finally storage at 4°C. Eight parallels were made for each sample, and the relative expression of the gene was calculated using 2-ΔΔCt.

[0121] The relevant primers used in fluorescence quantitative PCR are shown in Table 3;

[0122] Table 3 Primer information of target gene

[0123]

[0124] Test results

[0125] like Fig.10 , 11, 12. After nucleoside treatment, the expression of nucleoside transporter gene ABCT, nucleoside hydrolase gene iunH, and purine permease gene pbuX of Lactobacillus rhamnosus was upregulated.

[0126] Part IV Evaluation of the ability of Lactobacillus rhamnosus to degrade nucleosides in vivo

[0127] Application cases of Lactobacillus plantarum

[0128] Test 1

[0129] Application of Lactobacillus plantarum in in vitro tests

[0130] Trial Design and Grouping

[0131] In Experiment 1, 240 one-day-old male Magang geese were selected and divided into four treatments (Groups A, B, C, and D), with six replicates in each treatment and ten geese in each replicate.

[0132] From the 1st day to the 14th day, group A was fed with a basic diet (CP16.81%, Ca1.00%), and groups B, C, and D were all fed with a high-calcium and high-protein diet (CP24.03%, Ca3.04%). They were allowed to drink tap water freely, and their feed intake was recorded every day. The average daily feed intake and average daily weight gain were calculated based on the replicates. From the 15th day to the 28th day, the geese were selected and regrouped after successful modeling.

[0133] Group A was fed with a basic diet (CP 16.81%, Ca 1.00%), while groups B, C, and D were all fed with a high calcium and high protein diet (CP 24.03%, Ca 3.04%). 10CFU), treatment group D was gavaged with Lactobacillus rhamnosus + metabolites (unsuspended Lactobacillus rhamnosus, LGG content>1×10 10 CFU), and the rest of the groups were gavaged with PBS, 2 ml per gavage, and free access to tap water. Blood was drawn at 29 days of age in each of the A, B, C, and D groups, and two geese were slaughtered for sampling. All participating geese were free to eat and drink. Infrared lamps were used to control the temperature, continuous lighting, and the trough and feces were cleaned once a day. The health of the geese was observed every day, and the number of dead geese was recorded. Feeding and management were carried out according to routine procedures.

[0134] Serum sample collection

[0135] After the experiment, two geese with a weight close to the average were selected from each replicate, and their live weight was measured before blood collection. 10 mL of blood was collected from the jugular vein of the goose, and after standing for 45 minutes, the blood was centrifuged at 3000 r / min for 10 minutes. The supernatant was taken as serum, which was divided into 1.5 mL centrifuge tubes and stored in a -20℃ refrigerator for subsequent index determination.

[0136] Growth indicators

[0137] The daily feed intake and actual number of experimental geese were recorded in replicate groups, and the final body weight (Final Weight), average daily feed intake (Average Daily Feed Intake, ADFI), and average daily gain (Average Daily Gain, ADG) were calculated.

[0138] Data processing and analysis

[0139] Data are expressed as mean ± SEM. Statistical analysis was performed using a statistical analysis system (Graph Pad Prism 8; Graph Pad Software Inc, San Diego, CA, USA). Statistical differences between groups were analyzed using one-way analysis of variance (ANOVA) followed by multiple comparisons (Fisher's Least Significant Difference test). Data involving only two groups were analyzed using t-tests. The statistical significance level was P < 0.05.

[0140] Test results

[0141] Depend on Figures 13A to 13C , FIG. 14A to FIG. 14D , Figures 15A to 15C It can be known that Figures 13A to 15CIn each chart, the first column is CON (group A), the second column is HCP (group B), the third column is LGG+PBS (group C), and the fourth column is LGG+Metabolites (group D). After oral administration of Lactobacillus rhamnosus, the decline in final body weight (Final Weight), average daily feed intake (Average Daily Feed Intake, ADFI) and average daily gain (Average Daily Gain, ADG) caused by high calcium and high protein diet was alleviated. At the same time, the levels of xanthine oxidase (XOD), uric acid (UA), creatinine (Cr), urea nitrogen (BUN) in the blood and the levels of inflammatory factors interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ) caused by high calcium and high protein diet were significantly reduced.

[0142] Test 2

[0143] IPEC-J2 cells were seeded into 6-well plates, with 4 groups and 6 wells in each group (n=6). IPEC-J2 cells were treated with 3mM nucleoside solution (inosine-guanosine-adenosine, NS) and 5% LGG at the same time for 12h. After treatment, cells were collected using Trizol, total RNA was extracted using the traditional method (chloroform extraction), and cDNA was obtained by reverse transcription. The relative expression of genes CNT2 / TJP1 / ABCG2 / GLUT9 was measured by RT-qPCR.

[0144] Test 3

[0145] Hep-G2 cells were inoculated into 6-well plates, with 4 groups and 6 wells in each group (n=6). Hep-G2 cells were treated with 300 μM hypoxanthine (HX) and 5% LGG for 12 h. After treatment, cells were collected using Trizol, total RNA was extracted using the traditional method (chloroform extraction), and cDNA was obtained by reverse transcription. The relative expression of genes PPAT / PRPS / ADA / XOD was measured by RT-qPCR.

[0146] Test 4

[0147] BHK cells were inoculated into 6-well plates, with 4 groups and 6 wells in each group (n=6). BHK cells were treated with 100 μM sodium urate (MSU) and 5% LGG at the same time for 12 hours. After treatment, cells were collected using Trizol, total RNA was extracted using the traditional method (chloroform extraction), and cDNA was obtained by reverse transcription. The relative expression of genes OAT1 / ABCG2 / URAT1 / GLUT9 was measured by RT-qPCR.

[0148] Test results

[0149] Depend on FIG. 16A to FIG. 16D , FIG. 17A to FIG. 17D , FIG. 18A to FIG. 18D It can be seen that we verified that Lactobacillus rhamnosus metabolites can downregulate the gene expression of intestinal condensing nucleoside transporter 2 (CNT2) and glucose transporter 9 (GLUT9), upregulate the gene expression of tight junction protein (TJP1) and ATP-binding cassette transporter G2 (ABCG2), reduce the transport of nucleosides, promote the excretion of uric acid, and inhibit the reabsorption of uric acid; Lactobacillus rhamnosus metabolites reduce the production of uric acid in the liver. Further exploration of the mechanism may be related to the downregulation of phosphoribosyl pyrophosphate amidotransferase (PPAT) / phospholipid pyrophosphate synthase (PRPS) / adenosine deaminase (ADA) / xanthine oxidase (XOD), which are related to the purine metabolism uric acid synthesis pathway. Lactobacillus rhamnosus metabolites downregulate the gene expression of renal urate transporter 1 (URAT1) and GLUT9, upregulate the gene expression of ABCG2 and organic anion transporter 1 (OAT1), promote the excretion of uric acid, and inhibit the reabsorption of uric acid.

[0150] The strain of the present invention has the characteristics of absorbing and degrading purine nucleosides in vitro, and in vivo tests also show that it can reduce the levels of xanthine oxidase and serum uric acid as well as the levels of inflammatory factors interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ). The metabolites produced by it have the effects of inhibiting genes related to intestinal and kidney uric acid reabsorption, promoting genes related to uric acid excretion, and inhibiting liver uric acid production.

[0151] Part V Construction of target gene deletion strains

[0152] 5.1 Construction of iunH gene deletion strain

[0153] Step 1: Preparation of p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid

[0154] Using p15A-cm-tetR-tetO-hyg-ccdB plasmid as template and p15a-HA-1 and p15a-HA-2 as primers, PCR amplification was performed to obtain the p15a-cm-HA fragment (as shown in SEQ ID NO. 4);

[0155] The Gi-HAR fragment (shown in SEQ ID NO. 7) was obtained by PCR amplification using the wild-type genome of L. rhamnosus as a template and Gi-HAR-1 / 2 as primers;

[0156] Using the wild-type genome of L. rhamnosus as a template and Gi-HAL-1 / 2 as primers, PCR amplification was performed to obtain the Gi-HAL fragment (as shown in SEQ ID NO. 8);

[0157] Using the erythromycin gene erm as a template and erm-HA-1 / 2 as primers, PCR amplification was performed to obtain the erm-HA fragment (as shown in SEQ ID NO.9);

[0158] The scaB fragment (shown in SEQ ID NO. 5) was obtained by PCR amplification using RK2-pBAD-Cre-Dre-sacB plasmid as template and scaB-1 / 2 as primers;

[0159] The p15a-cm-HA, Gi-HAR, Gi-HAL, erm-HA and scaB fragments were recombined by LLHR in Escherichia coli GB05-dir to construct the p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid. After the plasmid was extracted, it was identified with pvuⅡ enzyme.

[0160] The plasmid map of p15A-cm-HAR-HAL-erm-scaB-GiunH is as follows Fig.19 The nucleotide sequence is shown in SEQ ID NO.1:

[0161] Step 2: Design primers at any position on the L. rhamnosus genome and the p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid. Design the check-LGiunH-1 / check-LGiunH-2 primer pair, electroporate the successfully constructed p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid into the wild-type L. rhamnosus, and screen the Lactobacillus rhamnosus that has successfully transformed with the plasmid by erythromycin, such as Fig. 20 As shown in c;

[0162] The relevant process parameters of electroporation into L. rhamnosus refer to Table 4:

[0163] Table 4 Electroporation process parameters

[0164]

[0165]

[0166] Step 3: The Lactobacillus rhamnosus that was successfully transformed with the erythromycin-screened plasmid in step 2 was verified by colony PCR using the check-LGiunH-1 / check-LGiunH-2 primer pair. The results are as follows: Fig. 20 Primers shown in middle d: iunH-1 / iunH-2 lanes are shown to obtain the recombinant deletion strain L. rhamnosus△iunH;

[0167] in Fig. 20 Figure a shows the process of constructing the p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid; Fig. 20 Middle b is the restriction enzyme map of p15A-cm-HAR-HAL-erm-scaB-GiunH plasmid;

[0168] With reference to Table 5, the sequence information of the above primers is listed in Table 5, as follows:

[0169] Table 5 Primer sequence list

[0170] Serial number Sequence (5'-3') p15a-HA-1 CTGTTGTTTGTCGGTGAACG p15a-HA-2 GACGTCGATATCTGGCGAAA Gi-HAR-1 TTTGAACACTCATGTTTAAC Gi-HAR-2 GATGGATGTTCAACTAATTTGTCCGATTGCCGGGAA Gi-HAL-1 GACATTCCCGGCAATCGGAC Gi-HAL-2 AAGGCAAGATGATTTTGGGG erm-HA-1 GTTCTATGCTTTCTTTTTGTAGCCGGCTAAACGGATA erm-HA-2 CCTTTTAATCACAATTCAGAAAATATCATAATATCT scaB-1 GTTCACTATTATTTAGTGAA scaB-2 AGTGTGACTCTAGTAGAGAGCGTTCACCGACAAACA p15a-sacB-2 TGTTAGTCATTTTCTTTCTCAACCTCGTCATTGGCAC check-LGiunH-1 CCAATCCAGCAGTAAAATGA check-LGiunH-2 AATTCCGGAACCGCTCATAT

[0171] Step 4: Perform the second screening recombination. First, prepare MRS solid medium (modified MRS medium base) containing 15wt% sucrose, take 5μl of the bacterial solution of the recombinant deletion strain L. rhamnosus△iunH and transfer it to the above medium. In the presence of sucrose, the host with the iunH gene will die (commit suicide). Under such pressure, the second recombination occurs, and the intermediate without the second recombination dies. Then, the clone with the iunH gene deletion can be obtained, which is the Lactobacillus rhamnosus iunH gene knockout strain.

[0172] 5.2 Construction of ABCT gene deletion strain

[0173] Step 1: Preparation of p15A-cm-HAR-HAL-erm-scaB-GABCT plasmid

[0174] Using the wild-type genome of L. rhamnosus as a template and GA-HAR--1 / 2 as primers, PCR amplification was performed to obtain the GA-HAR fragment (as shown in SEQ ID NO. 10);

[0175] Using the wild-type genome of L. rhamnosus as a template and GA-HAL-1 / 2 as primers, PCR amplification was performed to obtain the GA-HAL fragment (as shown in SEQ ID NO. 11);

[0176] The p15a-cm-HA, GA-HAR, GA-HAL, erm-HA and scaB fragments were subjected to line-by-line LLHR recombination in Escherichia coli GB05-dir to construct the p15A-cm-HAR-HAL-erm-scaB-GABCT (SEQ ID NO.2) plasmid. After the plasmid was extracted, it was identified using pvuⅡ enzyme.

[0177] The plasmid map of p15A-cm-HAR-HAL-erm-scaB-GABCT is as follows Fig.21 As shown:

[0178] With reference to Table 6, the sequence information of the above primers is listed in Table 6 as follows:

[0179] Table 6 Primer sequence list

[0180]

[0181]

[0182] Step 2: Design primers at any position on the L. rhamnosus genome and the p15A-cm-HAR-HAL-erm-scaB-GABCT plasmid to design the check-LGABCT-1 / check-LGABCT-2 primer pair, electro-transform the successfully constructed p15A-cm-HAR-HAL-erm-scaB-GABCT plasmid into the wild-type L. rhamnosus, and screen the Lactobacillus rhamnosus that has been successfully transformed with the plasmid using erythromycin;

[0183] The relevant process parameters for electroporation into L. rhamnosus refer to 5.1:

[0184] Step 3: The Lactobacillus rhamnosus that was successfully transformed with the erythromycin-screened plasmid in step 2 was verified by colony PCR using the check-LGABCT-1 / check-LGABCT-2 primer pair. The results are as follows: Fig. 20 Primers in middle d: As shown in the ABCT-1 / ABCT-2 lane, the recombinant deletion strain L. rhamnosus△ABCT was obtained;

[0185] Step 3: Prepare MRS solid culture medium (modified MRS culture medium base) containing 15wt% sucrose, take 5μl of the bacterial solution of the recombinant deletion strain L.rhamnosus△ABCT and transfer it to the above culture medium. In the presence of sucrose, the host with the ABCT gene will die (commit suicide). Under such pressure, the second recombination occurs, and the intermediate that does not undergo the second recombination dies. Then, a clone with the ABCT gene deleted can be obtained, which is the rhamnosus Lactobacillus ABCT gene knockout strain.

[0186] 5.3 Construction of pbuX gene deletion strain

[0187] Step 1: Preparation of p15A-cm-HAR-HAL-erm-scaB-GpbuX plasmid

[0188] Using the wild-type genome of L. rhamnosus as a template and Gp-HAR-1 / 2 as primers, PCR amplification was performed to obtain the Gp-HAR fragment (as shown in SEQ ID NO. 12);

[0189] Using the wild-type genome of L. rhamnosus as a template and Gp-HAL-1 / 2 as primers, PCR amplification was performed to obtain the Gp-HAL fragment (as shown in SEQ ID NO. 13);

[0190] The p15a-cm-HA, Gp-HAR, Gp-HAL, erm-HA and scaB fragments were subjected to line-by-line LLHR recombination in Escherichia coli GB05-dir to construct the p15A-cm-HAR-HAL-erm-scaB-GpbuX (SEQ ID NO.3) plasmid. After the plasmid was extracted, it was identified by double digestion with pvuⅡ and speI.

[0191] The plasmid map of p15A-cm-HAR-HAL-erm-scaB-GpbuX is as follows Fig. 22 As shown:

[0192] With reference to Table 7, the sequence information of the above primers is listed in Table 7, as follows:

[0193] Table 7 Primer sequence list

[0194] Serial number Sequence (5'-3') Gp-HAR-1 GCTGCAGCAATTGTTTGGCA Gp-HAR-2 TCGGTTCAGTGTTGGTGCCGATTTTGATTGGGGCA Gp-HAL-1 GTAAAGTGCAACGATGCCCC Gp-HAL-2 CAATTGTTGAGCAAAAATGTCTTTTTACGATAAAATG P15A-GPHAR-2 GTTGCTGGCAACCCCGGCGGATGTCGATCGTGCCAA check-LGpbux-1 TACAATTTTGGCCCCGGGAA check-LGpbux-2 CGGTTGTGTTGGGGTGTGCA

[0195] Step 2: Design primers at any position on the L. rhamnosus genome and the p15A-cm-HAR-HAL-erm-scaB-GpbuX plasmid to design the check-LGpbuX-1 / check-LGpbuX-2 primer pair, electro-transform the successfully constructed p15A-cm-HAR-HAL-erm-scaB-GpbuX plasmid into the wild-type L. rhamnosus, and screen the Lactobacillus rhamnosus that has been successfully transformed with the plasmid using erythromycin;

[0196] Step 3: The Lactobacillus rhamnosus that was successfully transformed with the erythromycin-screened plasmid in step 1 was verified by colony PCR using the primer pair check-LGpbuX-1 / check-LGpbuX-2. The results are as follows: Fig. 20 Primers in middle d: pbuX-1 / pbuX-2 lanes are shown to obtain the recombinant deletion strain L. rhamnosus△pbuX;

[0197] Step 3: Prepare MRS solid medium (modified MRS medium base) containing 15wt% sucrose, take 5μl of the bacterial solution of the recombinant deletion strain L.rhamnosus△pbuX and transfer it to the above medium. In the presence of sucrose, the host with the pbuX gene will die (commit suicide). Under such pressure, the second recombination occurs, and the intermediate that does not undergo the second recombination dies, and a clone with a pbuX gene deletion can be obtained, which is a Lactobacillus rhamnosus pbuX gene knockout strain.

[0198] 5.4 Comparative Example

[0199] The linear SSAP LGG-iunH gene knockout of LGG was performed using the CRISPR-Cas system, including the following steps:

[0200] Step 1: First, prepare a single-stranded recombinant fragment erm-del-LGiunH with a homology arm of 100 bp, then use m-erm-del-LGiunH-1-S / 2-P as a primer to phosphorylate and modify the dsDNA, and after recovering the fragment, use Lamda Exo enzyme to degrade it into ssDNA;

[0201] Using the erythromycin gene erm as a template and erm-del-LGiunH-1-1 / erm-del-LGiunH-2-1 as primers, PCR amplification was performed to obtain the erm-del-LGiunH1 fragment; then, the recovered erm-del-LGiunH1 fragment was used as a template and erm-del-LGiunH-1-2 / erm-del-LGiunH-2-2 as primers to PCR amplify the erm-del-LGiunH2 fragment (extended homology arm); then, using the recovered erm-del-LGiunH2 fragment as a template and erm-del-LGiunH-1-S / erm-del-LGiunH-2-P as primers, PCR amplification of phosphorylated-modified dsDNA was performed to obtain the erm-del-LGiunH3 fragment; after recovery, LamdaExo enzyme was used to degrade it into ssDNA.

[0202] Step 2: Design an appropriate sgRNA sequence for the LGG-iunH gene to be knocked out through the CHOPCHOP website. sgRNA is a small RNA sequence used to guide Cas9 protein to cut DNA to achieve the purpose of knocking out the target gene.

[0203] The LGG endogenous recombinase Pgenta-RecTLR fragment and the linear iunHLR-Cas9-sgRNA fragment combined with Cas9 protein and guide RNA were prepared respectively; iunHLR-Cas9-sgRNA and Pgenta-RecTLR were used as templates, and Cas9-1-S and RecTLR-2-S were used as primers overlap to obtain iunHLR-cas9-RecTLR.

[0204] The Pgenta fragment was obtained by PCR amplification using the gentamicin gene Pgenta as a template and tacRNA-Pgenta-1 / RecTLR-Pgenta-2 as primers;

[0205] The RecTLR fragment was obtained by PCR amplification using the synthetic RecTLR gene as a template and RecTLR-1 / RecTLR-2-S as primers;

[0206] Then, the Pgenta fragment and RecTLR were used as common templates and RecTLR-Pgenta-1 / / RecTLR-2-S were used as primers to obtain the Pgenta-RecTLR fragment by PCR amplification;

[0207] Two long primers iunHLR-sgRNA-1 / Cas-sgRNA-2 were used as templates to anneal to form a double-stranded DNA fragment sgRNA-tacRNA; the J233-Cas9 synthetic gene was used as a template and J233-Cas9-1 / iunHLR-Cas9-2 were used as primers to obtain the J233-Cas9 fragment by PCR amplification; the sgRNA-tacRNA fragment and the J233-Cas9 fragment were used as a common template and Cas9-1-S / Cas9-sgRNA-2 were used as primers to obtain the iunHLR-Cas9-sgRNA fragment by PCR amplification;

[0208] Finally, iunHLR-Cas9-sgRNA and Pgenta-RecTLR were used as common templates, and Cas9-1-S and RecTLR-2-S were used as primers for PCR amplification to obtain the iunHLR-cas9-RecTLR fragment.

[0209] Step 3: Add LGG endogenous single-chain binding protein to prepare Pgenta-RecTLR-SSB fragment, and use this fragment to replace the Pgenta-RecTLR fragment in the above scheme, while keeping other unchanged, to enhance the recombination efficiency.

[0210] The wild-type genome of L. rhamnosus was used as a template and SSB-1 / SSB-2 were used as primers to obtain the SSB fragment by PCR amplification. The Pgenta-RecTLR fragment and the SSB fragment were used as a common template and RecTLR-Pgenta-1 / SSB-2 were used as primers to obtain the Pgenta-RecTLR-SSB fragment by PCR amplification.

[0211] Step 4: CRISPR / Cas9-based gene editing tools introduce Cas9 and sgRNA into wild-type L. rhamnosus strains. Use the following protocol (as shown in the table below) to ensure that enough Cas9 and sgRNA reach the target gene to achieve effective gene knockout. Once Cas9 and sgRNA successfully enter the cell, Cas9 will bind to the sgRNA and cut the DNA sequence of the target gene. Cas9 usually cuts DNA around the primer sequence specified in the sgRNA.

[0212] Table 8 Fragment recombination scheme

[0213]

[0214]

[0215] The sequence of erm-del-LGiunH is shown in SEQ ID NO.14;

[0216] The sequence of Pgenta-RecTLR is shown in SEQ ID NO. 15;

[0217] The sequence of iunHLR-Cas9-sgRNA is shown in SEQ ID NO.16;

[0218] Results: After the corresponding fragments were electroporated into L. rhamnosus according to the above scheme, they were spread on MRS solid medium containing 15 μg / ml erythromycin after recovery. The antibiotic resistance gene screening marker was used to help screen the clones that successfully knocked out the target gene. After that, the potential knockout clones needed to be verified to ensure that the target gene had been successfully knocked out. That is, colony PCR was used to amplify the DNA sequence of the target gene, and gel electrophoresis or sequencing technology was used to detect whether there was a mutation or deletion. The result was that the single colonies grown on the plate were identified by colony PCR, and no corresponding bands were amplified. The reason for the failure may be that the efficiency of the recombinase in L. rhamnosus bacteria was too low, resulting in off-target effects.

[0219] It can be seen from the experiment of Comparative Example 1 that the method of linear SSAP LGG-iunH gene knockout of LGG using the CRISPR-Cas system cannot knock out the iunH gene very well, further proving the specificity of the gene knockout method of the present invention.

[0220] Part VI Evaluation of the ability of Lactobacillus rhamnosus iunH, ABCT, and pbuX knockout strains to degrade nucleosides

[0221] Inosine phosphate buffer: Accurately weigh 0.02 g of inosine, dilute to 100 ml with 20 mmol / l K3PO4 solution (pH 7.0) and adjust the pH to 7.0. The final inosine concentration in the buffer is 0.2 g / l (0.746 mmol / l).

[0222] A phosphate buffer system was used to preliminarily screen Lactobacillus rhamnosus that has the ability to degrade inosine. Take an appropriate amount of culture medium of the second-generation activated Lactobacillus rhamnosus and the iunH gene knockout strain, centrifuge at room temperature at 4500r / min for 3 minutes, discard the supernatant, collect the bacteria, wash the bacteria twice with sterile saline (NaCl solution with a mass concentration of 0.9%), add 1ml of inosine phosphate buffer to the washed bacteria, mix well, and incubate at 37°C for 1h, 3h, and 6h. After incubation, take the bacterial solution and centrifuge it at 4°C, 4500r / min for 3min, take 810μl of the supernatant, add 90μl of the reaction terminator 0.1mol / l perchloric acid solution, mix well and centrifuge at 4500r / min for 3min, take the supernatant and filter it with a 0.22μl aqueous phase filter membrane for HPLC detection, and analyze the reduction of inosine in the reaction solution. The specific results can be seen. Figure 23-32 The degradation rate of the target gene knockout strain of Lactobacillus rhamnosus was significantly lower than that of Lactobacillus rhamnosus without the target gene knockout.

[0223] In summary, the iunH gene, ABCT gene, and pbuX gene of Lactobacillus rhamnosus play a key role in the nucleoside degradation function of Lactobacillus rhamnosus.

Claims

1. A strain of Lactobacillus rhamnosus, It is characterized in that Category name Lactobacillus Rhamnosus , the deposit number is: CGMCC NO.28996; the deposit date is November 14, 2023, the deposit unit is: General Microbiology Center of China Microbiological Culture Collection Administration, the deposit address is: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

2. Use of the Lactobacillus rhamnosus as claimed in claim 1 to prepare a medicament for degrading nucleosides outside an organism or inside an organism; the nucleosides are guanosine, inosine or adenosine.

3. Use of the Lactobacillus rhamnosus as claimed in claim 1 in preparing a food or feed additive added with the Lactobacillus rhamnosus.

4. A method for preparing a target gene knockout strain of Lactobacillus rhamnosus, It is characterized in that The steps include: Step 1: electrotransform the Lactobacillus rhamnosus according to claim 1 using a plasmid; Step 2: using an antibiotic matching the plasmid to screen the Lactobacillus rhamnosus obtained in step 1 to obtain a recombinant deletion strain L. rhamnosus△Gene; Step 3: using sucrose to screen the recombinant deletion strain L. rhamnosus△Gene to obtain a secondary recombinant gene deletion strain; the gene deletion strain is the target gene knockout strain of Lactobacillus rhamnosus; The plasmid contains the following fragments: Used to screen for resistance gene fragments of Escherichia coli; Used to screen resistance gene fragments of Lactobacillus rhamnosus; 2,6-p-D-fructan 6-3-D-fructosyltransferase gene fragment; The upstream homology arm gene fragment of the target gene; Downstream homology arm gene fragment of the target gene; The target gene is one of the iunH gene, ABCT gene and pbuX gene in the Lactobacillus rhamnosus according to claim 1.

Images