An mRNA vaccine for porcine delta coronavirus and its construction method and application

Abstract

The present invention discloses an mRNA vaccine for porcine delta coronavirus and a construction method and application thereof, belonging to the field of biomedicine technology. The mRNA vaccine includes at least one of the sequences described in SEQ ID NO: 1-2. Also disclosed is an mRNA vaccine encapsulated by lipid nanoparticles, which includes the mRNA vaccine and lipids for encapsulating the mRNA vaccine, wherein the lipids are a mixture of ionizable liposomes, distearoyl phosphatidylcholine, cholesterol and PEG-liposomes. The mRNA vaccine prepared by the present invention can quickly respond to the currently popular porcine delta coronavirus and reduce the research and development production cycle of new vaccine development. The mRNA vaccine prepared by the present invention has high production efficiency, can produce a high level of neutralizing antibodies and binding antibodies of porcine delta coronavirus in the body, can effectively reduce the occurrence of diarrhea, dehydration and vomiting in piglets, and provides an important means for the prevention and control of porcine delta coronavirus.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an mRNA vaccine for porcine delta coronavirus and a construction method and application thereof. Background Art

[0002] Porcine deltacoronavirus (PDCoV) is a new type of enteropathogenic coronavirus in pigs, belonging to the newly discovered genus deltacoronavirus of the Coronaviridae family, which causes diarrhea, vomiting, dehydration and even death in pigs. The full-length genome of PDCoV is about 25.4kb, encoding 15 mature non-structural proteins (nsp2-16), 4 structural proteins (S, E, M, N) and 3 auxiliary proteins (NS6, NS7, NS7a). Among them, the S protein has been identified as the most immunogenic antigen of PDCoV, playing an important role in inducing neutralizing antibodies and antiviral T cell responses.

[0003] PDCoV can cause diarrhea and vomiting in suckling piglets aged 5-15 days. The autopsy changes after PDCoV infection are similar to those of porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV). Vaccination remains the most effective method for preventing and controlling infectious diseases. At present, there is no commercial vaccine for PDCoV. Further research and development of vaccines that can safely and effectively control PDCoV is needed, which is of great significance for the prevention and control of PDCoV. If the PDCoV genome continues to mutate and co-infects other viruses, an effective vaccine needs to be developed in a very short development cycle. mRNA vaccines introduce mRNA containing encoded antigen proteins into the human body, directly translate them, and form corresponding antigen proteins, thereby inducing the body to produce specific immune responses and achieve preventive immunity. mRNA vaccines use the gene sequence of the virus instead of the virus itself. Therefore, mRNA vaccines have the characteristics of no viral components and no risk of infection. At the same time, the development cycle of mRNA vaccines is short, and new candidate vaccines can be quickly developed to deal with viral mutations. Therefore, mRNA vaccines help to develop vaccines against emerging infectious disease pandemics in a short period of time. Summary of the invention

[0004] The purpose of the present invention is to provide an mRNA vaccine for porcine delta coronavirus and a construction method and application thereof to solve the problems existing in the above-mentioned prior art. The mRNA vaccine has a short research and development time and high safety, can produce immune protection against the current prevention and control of PDCoV, and can provide technical support for the prevention and control of PDCoV.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides an mRNA vaccine for porcine delta coronavirus, wherein the mRNA vaccine comprises at least one of the sequences described in SEQ ID NO: 1-2.

[0007] The present invention also provides a method for preparing the mRNA vaccine, comprising the following steps:

[0008] DNA sequences for synthetic mRNA vaccines;

[0009] The DNA sequence is constructed into a vector, and then subjected to enzyme digestion, transcription and purification to obtain the mRNA vaccine.

[0010] The present invention also provides a lipid nanoparticle-encapsulated mRNA vaccine for porcine delta coronavirus, wherein the lipid nanoparticle-encapsulated mRNA vaccine comprises the mRNA vaccine according to claim 1, and lipids for encapsulating the mRNA vaccine, wherein the lipids are a mixture of ionizable liposomes, distearoylphosphatidylcholine, cholesterol and PEG-liposomes.

[0011] Preferably, the molar ratio of the ionizable liposome, the distearoylphosphatidylcholine, the cholesterol and the PEG-liposome is 55:(5-15):(30-40):(1-2).

[0012] The present invention also provides a method for preparing the mRNA vaccine encapsulated by lipid nanoparticles, comprising the following steps:

[0013] The ionizable liposomes, distearoylphosphatidylcholine, cholesterol and PEG-liposomes are dissolved in ethanol to prepare a lipid ethanol solution;

[0014] Diluting the mRNA vaccine with citrate buffer to prepare an mRNA aqueous solution;

[0015] The lipid ethanol solution is mixed with the mRNA aqueous solution to prepare the mRNA vaccine encapsulated by lipid nanoparticles.

[0016] Preferably, the volume ratio of the lipid ethanol solution to the mRNA aqueous solution is 1:(2-5).

[0017] The present invention also provides the use of the mRNA vaccine or the mRNA vaccine encapsulated by lipid nanoparticles in the preparation of a vaccine for preventing and controlling porcine delta coronavirus infection diseases.

[0018] The present invention discloses the following technical effects:

[0019] RNA vaccines are obtained through gene synthesis, in vitro transcription, and lipid nanoparticle encapsulation, which can quickly respond to the current epidemic PDCoV and reduce the research and development and production cycle of new vaccine development. The RNA vaccine prepared by the present invention has high production efficiency, can produce high levels of neutralizing antibodies and binding antibodies to PDCoV in the body, can effectively reduce the occurrence of diarrhea, dehydration and vomiting in piglets, has great promotion value for the prevention and control of pig diarrhea, and provides an important means for the prevention and control of PDCoV. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The expression results of the mRNA vaccine in Example 2 of the present invention in 293T cells;

[0022] Figure 2 The figure is the Western blotting electrophoresis diagram of Example 2 of the present invention; M: standard DNA molecule; S1: mRNA-S1; S2: mRNA-S2; C: negative control;

[0023] Figure 3 The results of the test for IgG antibody levels in mouse serum in Example 3 of the present invention;

[0024] Figure 4 The results of the mouse neutralizing antibody level test in Example 3 of the present invention are as follows;

[0025] Figure 5 The results of the IFN-γ level test in mouse lymphocytes in Example 3 of the present invention are as follows;

[0026] Figure 6 The results of the IL-4 level test in mouse lymphocytes in Example 3 of the present invention;

[0027] Figure 7 The present invention adopts flow cytometry to detect lymphocyte subtype ratio;

[0028] Figure 8 The results of the lymphocyte proliferation test of the present invention are as follows;

[0029] Fig. 9 Detection of cytokine expression in mouse cells induced by the mRNA vaccine of Example 3 of the present invention;

[0030] Fig.10The IgG antibody level test result in the sow of Example 4 of the present invention;

[0031] Fig.11 The results of the IgA antibody level test in sows according to Example 4 of the present invention are as follows;

[0032] Fig.12 is the neutralizing antibody level of the sow in Example 4 of the present invention;

[0033] Fig.13 is the neutralizing antibody level of the piglets in Example 5 of the present invention;

[0034] Fig.14 The results of the IgG antibody level test in the piglet serum of Example 5 of the present invention are as follows;

[0035] In the above figure, PBS represents PBS solution; mRNA-S1 represents mRNA-S1 vaccine; Inactivated PDCoV+GEL01 represents PDCoV inactivated vaccine. DETAILED DESCRIPTION

[0036] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0037] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0038] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0039] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0040] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0041] Example 1 Construction of an RNA vaccine for PDCoV

[0042] The S glycoprotein of PDCoV CZ2020 / 12 (GenBank: OK546242.1) was used as the reference amino acid sequence for mRNA vaccine design. The DNA sequence shown in SEQ ID NO: 1-2 was synthesized by gene synthesis, and then T7 RNA polymerase and the linearized plasmid DNA template of the sequence shown in SEQ ID NO: 1-2 were used to transcribe and synthesize mRNA in vitro, named S1 and S2 respectively (this part of the experiment was synthesized by Suzhou Huiliao Biopharmaceutical Technology Co., Ltd.).

[0043] The ionizable liposome Dlin-MC3-DMA, distearoylphosphatidylcholine (DSPC), cholesterol and DMG-PEG2000 liposome were dissolved in ethanol at a molar ratio of 55:10:38.5:1.2 (nitrogen-phosphorus ratio of 5.67), and S1 and S2 were diluted in 50mM citrate buffer (pH=4). The lipid ethanol solution and the mRNA aqueous solution were mixed in a volume ratio of 1:3 by microfluidic equipment to prepare LNPs, named mRNA-S1 and mRNA-S2. The ethanol in the sample solution was removed by ultrafiltration, and the lipid nanoparticles were filtered through a 0.22μm sterile filter, and the prepared lipid nanoparticles were stored in a 4°C refrigerator for use. In subsequent experiments, the DPBS buffer was adjusted to a suitable concentration for use.

[0044] Sequence of S1 (SEQ ID NO: 1):

[0045] ATGCAGAGAGCTCTATTGATTATGACCTTACTTTGTCTCGTTCGAGCAAAGTTTGCTGATGATCTACTCGATTTGCTCAC

[0046] CTTCCCGGGTGCACATCGCTTCTTACATAAACTCACGAGTAATTCCAGCAGTCTCTACTCGCGGGCTAATAACTTTGATG

[0047] TTGGCGTTCTTCCTGGCTACGCCACTAAGAACGTTAACCTCTTCTCACCACTTACTAACTCTACTTTGCCAATTAATGGC

[0048] CTTCATCGGAGTTATCAACCACTCATGCTGAATTGTTTTACTAAAATAACTAACCACACTCTCAGCATGTATCTCCTACC

[0049] TAGTGATGTACAAACTTATAGCTGCGGCGGTGCCATGGTTAAATACCAGACACATGATGCAGTTCGTATCATTTTAGACC

[0050] TCACTGCCACTGACCACATCTCTGTTGAAGTCGTTGGCCAGCATGGTGAAAATTATGTGTTTGTTTGTAGTGAGCAGTTT

[0051] ACCTACACCACTGCACTACACAAATCTACTTTCTTCTCACTTAATTCTGAGCTTTATTGCTTTACTAATAACACCTACTT

[0052] AGGTATTCTTCCACCTGATTTAACTGACTTTACGGTCTACCGTACTGGTCAGTTCTATGCTAATGGTTACCTTTTAGGTA

[0053] CTTTACCTATTACGGTTAACTATGTTAGGTTGTATCGGGGTCAATTGGCTGCCAATAGTGCCCACTTTGCCCTAGCAAAC

[0054] CTAACCGATACACTTATAACACTTACCAATACCACTATATCGCAAATCACCTATTGTGATAAGTCAGTAGTTGATTCAAT

[0055] AGCATGCCAGCGCTCTTCTCACGAAGTGGAGGATGGGTTTTACTCTGACCCTAAATCTGCCGTTAGAGCTAGGCAACGT

[0056] ACTATTGTTACACTACCTAAGCTCCCTGAGCTTGAAGTAGTGCAGTTAAATATTTCTGCACACATGGATTTTGGCGAAGC

[0057] CAGACTTGACAGTGTTACCATTAATGGTAACACATCCTATTGTGTCACTAAGCCTTACTTCAGGCTTGAAACTAACTTTAT

[0058] GTGTACAGGTTGCACTATGAATCTGCGCACTGATACCTGTAGTTTTGACCTGTCAGCAGTAAACAATGGCATGTCATTCT

[0059] CTCAATTCTGTCTAAGCACTGAATCTGGTGCTTGTGAGATGAAAATTATTGTTACCTATGTATGGAATTACTTGCTAAGG

[0060] CAGCGTTTGTATGTTACTGCTGTAGAAGGCCAGACTCACACTGGAACCACTTCAGTACATGCAACAGACACTTCTAGTG

[0061] TAATCACTGATGTCTGCACTGACTACACTATCTATGGAGTCTCTGGTACTGGCATTATTAAGCCATCAGATCTCTTATTGC

[0062] ACAATGGCATAGCATTCACCTCTCCAACAGGTGAGCTCTATGCATTTAAAAATATAACCACTGGCAAAACCCTCCAGGTC

[0063] TTACCGTGTGAAACCCCTTCTCAACTGATTGTGATAAACAACACCGTTGTCGGTGCTATCACATCCAGTAACTCAACTGA

[0064] AAATAATAGGTTTACTACTACTATTGTCACACCTACTTTCTTTTATTCCACAAATGCCACCACCTTTAACTGCACCAAGC

[0065] CTGTTTTGTCCTATGGACCCATCAGCGTGTGTAGTGATGGTGCAATTGTGGGAACATCTACATTACAGAATACTCGACCA

[0066] TCCATAGTTTCACTATACGATGGCGAAATTGAAATACCATCTGCATTTTCCCTTTCTGTTCAGACAGAGTATTTGCAAGT

[0067] TCAAGCAGAGCAAGTTATAGTTGATTGTTCTCAGTATGTATGCAATGGCAACAGCCGTTGTCTACAATTACTGGCACAAT

[0068] ACACCTCAGCTTGCTCTAACATTGAAGCAGCTCTGCATTCCTCTGCACAGTTGGATAGCAGAGAGATTATAAATATGTTT

[0069] CAAACATCAACACAGTCCTTGCAGTTGGCTAATATTACCAACTTCAAGGGTGACTACAATTTTAGCAGCATAATAACCCC

[0070] CAGAATTGGTGGCAGATCTGCTATTGAAGACCTTCTTTTTAATAAAGTTGTTACTAGTGGCCTTGGCACTGTTGATCAGG

[0071] ACTACAAAGCCTGCTCTAGAGACATGGCCATCGCTGACTTAGTTTGTTCCCAGTATTACAATGGCATCATGGTTCTACCT

[0072] GGTGTTGTTGATGCTGAGAAAATGGCAATGTATACTGGCTCTCTTACTGGAGCTATGGTATTTGGGGGACTGACTGCTGC

[0073] AGCGGCAATACCATTCGCCACGGCAGTACAAGCCCGTCTCAATTATGTCGCACTGCAAACAAATGTACTACAAGAAAAC

[0074] CAGAAAATTCTTGCAGAATCATTTAACCAAGCAGTTGGCAATATATCACTTGCACTATCTTCTGTTAATGATGCCATCCAG

[0075] CAAACTTCTGAGGCTCTTAGCACCGTAGCTATTGCTATTAAAAAGATTCAAACAGTTGTTAATCAGCAGGGTGAGGCATT

[0076] ATCACACCTGACTGCACAGCTGTCAAACAATTTCCAAGCAATTTCGACTTCTATTCAAGACATTTATAACCGTCTTGAGG

[0077] AAGTAGAGGCTAACCAGCAAGTTGACCGTCTCATCACAGGACGGTTGGCTGCACTTAATGCATATGTTACTCAGTTACTC

[0078] AATCAGATGTCTCAGATTAGACAATCTCGATTGTTAGCTCAGCAAAAGATTAATGAGTGTGTCAAATCTCAGTCGTCCAG

[0079] ATACGGTTTCTGTGGAAATGGCACACATATCTTCTCACTTACACAGACTGCACCAAATGGCATATTTTTCATGCATGCAG

[0080] TACTTGTACCCAACAAATTCACACGTGTCAACGCTTCTGCGGGTATTTGTGTGGATAATACGAAAGGCTACTCATTGCAG

[0081] CCTCAACTTATACTCTACCAGTTTAATAACTCCTGGAGAGTTACACCTAGAAATATGTATGAACCCAGATTGCCCCGGCA

[0082] AGCTGATTTCATACAATTAACTGATTGCAGCGTTAATTTTTACAATACCACCGCTGCTAATCTTCCCAATATTATCCCTG

[0083] ACGTTATAGATGTCAATCAAACAGTCAGTGATATTATTGACAATTTACCTACAGCAACACCTCCTCAGTGGGATGTTGGT

[0084] ATCTATAACAACACTATTCTCAACCTCACCGTTGAGATTAATGATCTACAAGAGCGGTCTAAAAATCTCTCACAGATTGC

[0085] AGATCGTTTACAAAATTATATTGACAATCTTAACAATACTCTAGTTGACCTTGAATGGCTCAACAAAGTGGAGACTTACC

[0086] TTAAATGGCCGTGGTATGTATGGCTTGCCATAGCCCTGGCTCTTATTGCATTTGTGACAATCCTCATAACAATCTTTCTC

[0087] TGTACTGGTTGTTGTGGTGGTTGTTTTGGTTGTTGTGGCGGTTGTTTTGGCCTTTTCTCTAAGAAGAAAAGGTATACCGACGACCAACCAACACCGTCCTTTAAGTTTAAGGAATGGTAG。

[0088] Sequence of S2 (SEQ ID NO: 2):

[0089] ATGAAATTCTTAGTCAACGTTGCCCTTGTTTTTATGGTCGTGTACATTTCTTACATCTATGCGGCTGATGATCTACTCGA

[0090] TTTGCTCACCTTCCCGGGTGCACATCGCTTCTTACATAAACTCACGAGTAATTCCAGCAGTCTCTACTCGCGGGCTAATA

[0091] ACTTTGATGTTGGCGTTCTTCCTGGCTACGCCACTAAGAACGTTAACCTCTTCTCACCACTTACTAACTCTACTTTGCCA

[0092] ATTAATGGCCTTCATCGGAGTTATCAACCACTCATGCTGAATTGTTTTACTAAAATAACTAACCACACTCTCAGCATGTA

[0093] TCTCCTACCTAGTGATGTACAAACTTATAGCTGCGGCGGTGCCATGGTTAAATACCAGACACATGATGCAGTTCGTATCA

[0094] TTTTAGACCTCACTGCCACTGACCACATCTCTGTTGAAGTCGTTGGCCAGCATGGTGAAAATTATGTGTTTGTTTGTAGT

[0095] GAGCAGTTTACCTACACCACTGCACTACACAAATCTACTTTCTTCTCACTTAATTCTGAGCTTTATTGCTTTACTAATAA

[0096] CACCTACTTAGGTATTCTTCCACCTGATTTAACTGACTTTACGGTCTACCGTACTGGTCAGTTCTATGCTAATGGTTACC

[0097] TTTTAGGTACTTTACCTATTACGGTTAACTATGTTAGGTTGTATCGGGGTCAATTGGCTGCCAATAGTGCCCACTTTGCC

[0098] CTAGCAAACCTAACCGATACACTTATAACACTTACCAATACCACTATATCGCAAATCACCTATTGTGATAAGTCAGTAGT

[0099] TGATTCAATAGCATGCCAGCGCTCTTCTCACGAAGTGGAGGATGGGTTTTACTCTGACCCTAAATCTGCCGTTAGAGCTA

[0100] GGCAACGTACTATTGTTACACTACCTAAGCTCCCTGAGCTTGAAGTAGTGCAGTTAAATATTTCTGCACACATGGATTTT

[0101] GGCGAAGCCAGACTTGACAGTGTTACCATTAATGGTAACACATCCTATTGTGTCACTAAGCCTTACTTCAGGCTTGAAAC

[0102] TAACTTTATGTGTACAGGTTGCACTATGAATCTGCGCACTGATACCTGTAGTTTTGACCTGTCAGCAGTAAACAATGGCA

[0103] TGTCATTCTCTCAATTCTGTCTAAGCACTGAATCTGGTGCTTGTGAGATGAAAATTATTGTTACCTATGTATGGAATTAC

[0104] TTGCTAAGGCAGCGTTTGTATGTTACTGCTGTAGAAGGCCAGACTCACACTGGAACCACTTCAGTACATGCAACAGACA

[0105] CTTCTAGTGTAATCACTGATGTCTGCACTGACTACACTATCTATGGAGTCTCTGGTACTGGCATTATTAAGCCATCAGATC

[0106] TCTTATTGCACAATGGCATAGCATTCACCTCTCCAACAGGTGAGCTCTATGCATTTAAAAATATAACCACTGGCAAAACC

[0107] CTCCAGGTCTTACCGTGTGAAACCCCTTCTCAACTGATTGTGATAAACAACACCGTTGTCGGTGCTATCACATCCAGTAA

[0108] CTCAACTGAAAATAATAGGTTTACTACTACTATTGTCACACCTACTTTCTTTTATTCCACAAATGCCACCACCTTTAACT

[0109] GCACCAAGCCTGTTTTGTCCTATGGACCCATCAGCGTGTGTAGTGATGGTGCAATTGTGGGAACATCTACATTACAGAAT

[0110] ACTCGACCATCCATAGTTTCACTATACGATGGCGAAATTGAAATACCATCTGCATTTTCCCTTTCTGTTCAGACAGAGTA

[0111] TTTGCAAGTTCAAGCAGAGCAAGTTATAGTTGATTGTTCTCAGTATGTATGCAATGGCAACAGCCGTTGTCTACAATTAC

[0112] TGGCACAATACACCTCAGCTTGCTCTAACATTGAAGCAGCTCTGCATTCCTCTGCACAGTTGGATAGCAGAGAGATTATA

[0113] AATATGTTTCAAACATCAACACAGTCCTTGCAGTTGGCTAATATTACCAACTTCAAGGGTGACTACAATTTTAGCAGCAT

[0114] AATAACCCCCAGAATTGGTGGCAGATCTGCTATTGAAGACCTTCTTTTTAATAAAGTTGTTACTAGTGGCCTTGGCACTG

[0115] TTGATCAGGACTACAAAGCCTGCTCTAGAGACATGGCCATCGCTGACTTAGTTTGTTCCCAGTATTACAATGGCATCATG

[0116] GTTCTACCTGGTGTTGTTGATGCTGAGAAAATGGCAATGTATACTGGCTCTCTTACTGGAGCTATGGTATTTGGGGGACT

[0117] GACTGCTGCAGCGGCAATACCATTCGCCACGGCAGTACAAGCCCGTCTCAATTATGTCGCACTGCAAACAAATGTACTA

[0118] CAAGAAAACCAGAAAATTCTTGCAGAATCATTTAACCAAGCAGTTGGCAATATATCACTTGCACTATCTTCTGTTAATGA

[0119] TGCCATCCAGCAAACTTCTGAGGCTCTTAGCACCGTAGCTATTGCTATTAAAAAGATTCAAACAGTTGTTAATCAGCAGG

[0120] GTGAGGCATTATCACACCTGACTGCACAGCTGTCAAACAATTTCCAAGCAATTTCGACTTCTATTCAAGACATTTATAAC

[0121] CGTCTTGAGGAAGTAGAGGCTAACCAGCAAGTTGACCGTCTCATCACAGGACGGTTGGCTGCACTTAATGCATATGTTA

[0122] CTCAGTTACTCAATCAGATGTCTCAGATTAGACAATCTCGATTGTTAGCTCAGCAAAAGATTAATGAGTGTGTCAAATCT

[0123] CAGTCGTCCAGATACGGTTTCTGTGGAAATGGCACACATATCTTCTCACTTACACAGACTGCACCAAATGGCATATTTTT

[0124] CATGCATGCAGTACTTGTACCCAACAAATTCACACGTGTCAACGCTTCTGCGGGTATTTGTGTGGATAATACGAAAGGCT

[0125] ACTCATTGCAGCCTCAACTTATACTCTACCAGTTTAATAACTCCTGGAGAGTTACACCTAGAAATATGTATGAACCCAGAT

[0126] TGCCCCGGCAAGCTGATTTCATACAATTAACTGATTGCAGCGTTAATTTTTACAATACCACCGCTGCTAATCTTCCCAATA

[0127] TTATCCCTGACGTTATAGATGTCAATCAAACAGTCAGTGATATTATTGACAATTTACCTACAGCAACACCTCCTCAGTGG

[0128] GATGTTGGTATCTATAACAACACTATTCTCAACCTCACCGTTGAGATTAATGATCTACAAGAGCGGTCTAAAAATCTCTC

[0129] ACAGATTGCAGATCGTTTACAAAATTATATTGACAATCATCATCATCATCACAGAATGAAGCAAATTGAAGATAAGATTGAAGAAATTGAATCCAAGCAAAAGAAGATTGAAAATGAAATTGCTAGAATTAAGAAGTAG.

[0130] Example 2 mRNA expression and formulation characterization

[0131] To detect the expression of LNP-delivered mRNA, HEK293T cells were seeded in 24-well plates. After 18 h, the cells were treated with LNPs encapsulating mRNA (1 μg per well) and incubated for another 24 h. Untreated cells served as the control group. Indirect immunofluorescence (IFA) and Western blotting were used to detect the expression of mRNA using anti-PDCoV-S polyclonal antibodies (prepared in the laboratory, diluted 1:1000; this polyclonal antibody has been published in the literature: Zhang Baotai et al. "Expression of porcine delta coronavirus structural proteins and preparation of their polyclonal antibodies"). The IFA results are shown in Figure 2. Figure 1 As shown in Figure 2, mRNA vaccine can be efficiently expressed in 293T cells. Western blotting results are shown in Figure 2 Figure 2 As shown, it indicates that the relevant proteins can be effectively expressed.

[0132] The particle size (Size), polydispersity index (PDI) and zeta potential (Zeta P) of the particles were determined by dynamic light scattering using a Malvern nanoparticle size tester. The encapsulation efficiency of the lipid nanoparticles was determined using the Quant-it Ribogreen RNA quantitative analysis kit (Thermo Fisher Scientific, UK). The results are shown in Table 1: The size of mRNA-S1 and mRNA-S2 lipid nanoparticles was mostly around 80 nm, the potential of most lipid nanoparticles was around 0 mv, the polydispersity index varied around 0.1, and the encapsulation efficiency was mostly above 95%.

[0133] Table 1 Characterization of lipid nanoparticles

[0134]

[0135] Example 3 Immunization of mice with lipid nanoparticle-encapsulated RNA vaccine and detection of antibody levels

[0136] In the mouse immunization experiment, 15 6-week-old BALB / c mice were randomly divided into 3 groups, 5 mice in each group. Both groups of mice were subcutaneously injected with mRNA vaccine at a dose of 30μg per mouse. The control group of mice was subcutaneously injected with PBS. The vaccinated mice received a booster dose 14 days after vaccination. All mice were killed on the 28th day. Serum was collected on days 0, 14, and 28, and antibodies in the serum were detected by indirect ELISA and neutralization methods. Flow cytometry was used to separate spleen cells for lymphocyte subtype ratio detection, lymphocyte proliferation test, and cytokine detection.

[0137] Indirect ELISA method:

[0138] (1) The purified S protein was coated at a concentration of 4 ng / μL using carbonate buffer (pH 9.6) and added to a polystyrene microtiter plate at 100 μL / well at 4°C overnight.

[0139] (2) The next day, discard the liquid, add 200 μL PBST to each well, and wash three times, each time for 5 minutes.

[0140] (3) Prepare 5% skim milk with PBS, 200 μL / well, and block at 37°C for 2 h. After discarding the blocking solution, wash three times with PBST, 5 min each time.

[0141] (4) Dilute the serum with PBS, take the serum collected after three immunizations, and the negative serum is the serum collected after the mouse is immunized with PBS, at a ratio of 1:50, 100 μL / well, incubate at 37°C for 1 h, discard the primary antibody and wash three times with PBST, each time for 5 min.

[0142] (5) Dilute goat anti-mouse HRP-IgG with PBS at a ratio of 1:5000, 100 μL / well, incubate at 37°C for 1 h, discard the secondary antibody and wash three times with PBST, each time for 5 min.

[0143] (6) Add 100 μL / well of TMB and incubate at room temperature in the dark for 10 min.

[0144] (7) Add 50 μL / well of stop solution (2M H2SO4) to terminate the reaction and read the OD with a microplate reader. 450nm value.

[0145] Neutralizing antibody method:

[0146] (1) All serum was aliquoted and placed in a water bath at 56°C for 30 min for inactivation;

[0147] (2) In a 96-well cell culture plate, the inactivated serum was diluted in multiples to 2-1, 2-2, 2-3, 2-4, 2-5, 2-6, 2-7, and 2-8, respectively, with a final volume of 50 μL per well, and two replicate wells were prepared for each dilution;

[0148] (3) PDCoV virus solution was diluted to 100 TCID using DMEM medium. 50 / 50μL;

[0149] (4) Take 50 μL of virus solution and add it to the above serum dilution plate, and neutralize it in a 37°C 5% CO2 incubator for 1 h;

[0150] (5) When the 96-well plate is fully grown with a monolayer of LLC-PK 1 cells, the cell culture medium is discarded, the plate is washed twice with DMEM, 100 μL of a mixture of serum and virus is added to each well, and the plate is cultured in a 37°C 5% CO2 incubator for 2.5 h;

[0151] (6) Wash twice with DMEM, replace with pure DMEM maintenance medium containing 7.5 μg / mL trypsin, place in an incubator for culture, and begin daily observation and recording after 12 hours.

[0152] Negative and positive serum controls were set up at the same time. The maximum dilution of serum that completely inhibited the cytopathic effect (CPE) was taken as the neutralizing titer of the serum.

[0153] The results are as follows Figure 3 As shown in the figure, the IgG antibody response was higher in the serum of mice on day 14. At day 28, the immunized mice produced high levels of IgG antibodies. Figure 4 As shown in the figure, the titer of neutralizing antibodies was 1:128 and 1:256 after the second immunization. The results showed that mRNA-S1 and mRNA-S2 vaccines can induce mice to produce a strong humoral immune response. Figure 5-Figure 6 As shown in the figure, the levels of IFN-γ and IL-4 produced by lymphocytes of mice vaccinated with mRNA vaccines were significantly higher than those of control mice. To detect the cellular immune response induced by mRNA vaccines, mouse spleen lymphocytes were isolated, and the characteristics and counts of T cell, B cell and NK cell subsets were analyzed by flow cytometry. Figure 7 The results showed that the percentages of T cells and B cells in the mRNA group were higher than those in the PBS control group. Figure 8 As shown, the lymphocyte proliferation in the mRNA group was higher than that in the PBS control group. Fig. 9 As shown in Figure 2, the expression of cytokines IFN-γ and IL-4 in the mRNA group was higher than that in the PBS control group. These data indicate that mRNA vaccines can induce humoral and cellular immune responses.

[0154] Example 4 Immunization of sows with lipid nanoparticle-encapsulated RNA vaccine and detection of antibody levels

[0155] The sows were divided into three groups and vaccinated with mRNA-S1 vaccine, PDCoV inactivated vaccine and PBS respectively. Then the sow sera were collected to detect the anti-PDCoV antibody levels. Figure 10-11 As shown in the results, the mRNA-S1 vaccine can induce high titers of IgG and IgA antibodies in the serum, which are higher than those in the inactivated vaccine group. The neutralization capacity of serum against PDCoV was measured. After 14 days, Fig.12 As shown, the neutralizing antibody titer of the serum was approximately 1:1024.

[0156] Example 5 Detection of passive immunity level provided by colostrum of immune sows for suckling piglets

[0157] To evaluate the protective effect of the vaccine, the level of passively transferred antibodies in the piglet serum was detected. Fig.13 As shown in the figure, the neutralizing antibody level of 5-day-old suckling piglets immunized with mRNA vaccine can reach above 1:256, and the overall neutralizing antibody level is higher than that of the inactivated vaccine group. Fig.14 As shown in the results, the level of PDCoV-S binding IgG in piglet sera was high, and the mRNA-S1 vaccine induced good mucosal immunity in suckling piglets. Antibodies were detected in the sera of piglets born to immunized sows, but not in the sera of piglets born to control sows, indicating that antibodies were transferred through colostrum. In summary, mRNA vaccines can provide effective passive immunity to newborn piglets and protect them against PDCoV infection.

[0158] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A lipid nanoparticle-encapsulated mRNA vaccine for porcine delta coronavirus, characterized in that: The mRNA vaccine encapsulated by the lipid nanoparticles includes an mRNA vaccine and a lipid for encapsulating the mRNA vaccine, wherein the lipid is a mixture of ionizable liposomes Dlin-MC3-DMA, distearoylphosphatidylcholine, cholesterol and DMG-PEG2000 liposomes; The molar ratio of the ionizable liposome Dlin-MC3-DMA, the distearoyl phosphatidylcholine, the cholesterol and the DMG-PEG2000 liposome is 55:10:38.5:1.2; The nucleotide sequence of the mRNA vaccine is shown in SEQ ID NO:

1.

2. A method for preparing a lipid nanoparticle-encapsulated mRNA vaccine according to claim 1, characterized in that: The following steps are involved: Ionizable liposome Dlin-MC3-DMA, distearoylphosphatidylcholine, cholesterol and DMG-PEG2000 liposome were dissolved in ethanol to prepare lipid ethanol solution; Diluting the mRNA vaccine with citrate buffer to prepare an mRNA aqueous solution; The lipid ethanol solution is mixed with the mRNA aqueous solution to prepare an mRNA vaccine encapsulated by lipid nanoparticles.

3. The preparation method according to claim 2, wherein The volume ratio of the lipid ethanol solution to the mRNA aqueous solution is 1:(2-5).

4. Use of the lipid nanoparticle-encapsulated mRNA vaccine as claimed in claim 1 in the preparation of a vaccine for preventing and controlling porcine delta coronavirus infection diseases.

Images