Complete set of reagent and kit for LayV virus

Abstract

The invention discloses a complete set of reagents and a kit for LayV viruses. The complete set reagent for the LayV virus disclosed by the invention consists of two single-stranded DNAs (Deoxyribose Nucleic Acid) of LayV-F and LayV-R respectively and a probe with the name of LayV-P, wherein the sequences of the LayV-F, the LayV-R and the LayV-P are respectively shown as SEQ ID No.1-3 in a sequence table. The complete set reagent for the LayV virus can be used for successfully detecting the LayV virus, has good sensitivity and specificity, and fills the blank in the field of LayV virus detection. According to the complete set of reagent, high-sensitivity, high-specificity and high-flux rapid and accurate detection of the LayV virus can be realized, the related kit is simple to operate and convenient to use, few types of reagents are added, and pollution is avoided to a certain extent. The kit can be widely applied to detection of LayV in clinic and laboratories.

Description

Technical Field

[0001] The present invention relates to a complete set of reagents and a test kit for LayV virus in the technical field of molecular biology. Background Art

[0002] Paramyxoviridae viruses can cause disease in humans and a variety of animals. Among them, measles virus and mumps virus are the main ones that infect humans; Newcastle disease virus and rinderpest virus are the main ones that infect animals; and Hendra virus (HeV) and Nipah virus (NiV) are zoonotic viruses. Henipavirus is an enveloped single-stranded RNA virus and an important member of the Paramyxoviridae family. Its representative species are HeV and NiV. HeV infection is a new infectious disease discovered in Australia in the 1990s. It is a zoonosis that can cause disease and death in animals and humans. HeV has attracted widespread attention because it may be used in biological terrorist attacks. Nipah virus disease first became prevalent in Malaysia in Southeast Asia in 1998, and then became prevalent in Singapore in Southeast Asia, Bangladesh in South Asia, and India. Although there are not many reports of Nipah virus disease, the mortality rate of the disease can reach 40% to 75%, which seriously affects human health. In recent years, new Henniviruses have continued to emerge, such as Cedar virus isolated from bats. Recently, a new Hennivirus was found in patients with fever in my country, named Langya virus (LayV). LayV virus can cause infection in humans and other mammals, seriously threatening the health of humans and animals. At present, there is no report on the detection method of LayV virus. How to quickly detect LayV virus has become a major problem that needs to be solved urgently. Therefore, qRT-PCR technology is used to detect the zoonotic virus LayV virus, so as to achieve the purpose of rapid detection of LayV virus. It is necessary to invent a method for rapid detection of LayV. Summary of the invention

[0003] The technical problem to be solved by the present invention is how to detect the LayV virus.

[0004] In order to solve the above technical problems, the present invention first provides a set of reagents, the set of reagents includes a primer pair, the primer pair is composed of two single-stranded DNAs named LayV-F and LayV-R;

[0005] The LayV-F is as follows (a1) or (a2);

[0006] (a1) a single-stranded DNA molecule shown in SEQ ID No. 1 of the sequence listing;

[0007] (a2) a single-stranded DNA molecule having the same function as SEQ ID No. 1 after one or more nucleotides are substituted and / or deleted and / or added;

[0008] The LayV-R is as follows (a3) ​​or (a4);

[0009] (a3) a single-stranded DNA molecule shown in SEQ ID No. 2 of the sequence listing;

[0010] (a4) A single-stranded DNA molecule having the same function as SEQ ID No. 2 after one or more nucleotides are substituted and / or deleted and / or added.

[0011] The above kit may further include a probe named LayV-P, the sequence of which is as follows (a5) or (a6);

[0012] (a5) SEQ ID No. 3 of the sequence listing;

[0013] (a6) A sequence having the same function as SEQ ID No. 3 after one or more nucleotides are substituted and / or deleted and / or added.

[0014] Both ends of the probe may be labeled with a fluorescent group and a fluorescent quenching group, respectively.

[0015] The substitution and / or deletion and / or addition of one or several nucleotides may be a substitution and / or deletion and / or addition of 1, 2, 3, 4 or 5 nucleotides.

[0016] The complete set of reagents may be only the primer pair, or may be composed of the primer pair and the probe. In the primer pair, the molar ratio of LayV-F to LayV-R may be 1:1. In the complete set of reagents, the molar ratio of LayV-F, LayV-R and LayV-P may be 1:1:2.

[0017] Both single-stranded DNAs in the primer pair can be packaged independently.

[0018] The two single-stranded DNAs and the probe in the reagent set can be packaged independently.

[0019] The set of reagents and the primer pair can be used to detect or assist in detecting the LayV virus.

[0020] The application of (b1) or (b2) or (b3) or (b4) of the kit also falls within the scope of protection of the present invention:

[0021] (b1) detecting or assisting in detecting whether the virus to be detected is LayV virus;

[0022] (b2) preparing a kit for detecting or assisting in detecting whether the virus to be tested is LayV virus;

[0023] (b3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus;

[0024] (b4) preparing a kit for detecting or assisting in detecting whether a sample to be tested contains LayV virus.

[0025] The primer pair also belongs to the protection scope of the present invention.

[0026] The application of (b1) or (b2) or (b3) or (b4) of the primer pair also falls within the protection scope of the present invention:

[0027] (b1) detecting or assisting in detecting whether the virus to be detected is LayV virus;

[0028] (b2) preparing a kit for detecting or assisting in detecting whether the virus to be tested is LayV virus;

[0029] (b3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus;

[0030] (b4) preparing a kit for detecting or assisting in detecting whether a sample to be tested contains LayV virus.

[0031] The present invention also provides a kit, which contains the set of reagents or the primer pair.

[0032] The kit may also contain other non-primer probe reagents required for real-time fluorescence quantitative qRT-PCR.

[0033] The other reagents required for the real-time fluorescence quantitative qRT-PCR may include 2×One Step RT-PCR Buffer and RT-PCR enzyme mixture, and the 2×One Step RT-PCR Buffer and RT-PCR enzyme mixture are from the One Step PrimeScript RT-PCR Kit (Perfect Real Time) (DRR064A) of Takara Biotechnology (Dalian) Co., Ltd.

[0034] The other reagents required for the real-time fluorescence quantitative qRT-PCR may also include a plasmid or DNA fragment of the target gene of the LayV virus. The plasmid may specifically be pUC57-LayV, which is a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 4 in the sequence table into the multiple cloning site of the pUC57 vector (Beijing Qingke Biotechnology Co., Ltd.) and keeping the sequences of other parts of the vector unchanged.

[0035] Other reagents required for real-time fluorescence quantitative qRT-PCR may further include water.

[0036] The kit can be used to detect or assist in detecting the LayV virus.

[0037] The application of (d1) or (d2) or (d3) or (d4) of the kit also falls within the protection scope of the present invention:

[0038] (d1) detecting or assisting in detecting whether the virus to be detected is LayV virus;

[0039] (d2) preparing products for detecting or assisting in detecting whether the virus to be detected is LayV virus;

[0040] (d3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus;

[0041] (d4) Preparing products for detecting or assisting in detecting whether a sample contains LayV virus.

[0042] The reaction system for detecting whether the virus to be tested is LayV virus and detecting whether the sample to be tested contains LayV virus can be as follows: 10 μL 2×One Step RT-PCR Buffer; 0.4 μL RT-PCR enzyme mixture; 0.4 μL LayV-F; 0.4 μL LayV-R; 0.8 μL LayV-R; 2.0 μL template RNA; 6.0 μL DNase / RNase-free H2O supplemented to 20 μL.

[0043] The reaction can be: 42°C for 5 min; pre-denaturation at 95°C for 10 s, 1 cycle; denaturation at 95°C for 5 s, annealing at 50°C for 30 s, extension at 50°C for 30 s, 40 cycles of reaction and collection of fluorescence signals.

[0044] The complete set of reagents and kits for detecting LayV virus of the present invention can successfully detect LayV virus and have good sensitivity and specificity. The present invention fills the gap in the field of LayV virus detection. The detection method involved is based on the effective combination of specific primer pairs and fluorescent probes, and can achieve rapid and accurate detection of LayV virus with high sensitivity, high specificity and high throughput. The kit involved is simple to operate, easy to use, and requires few types of reagents, which can avoid contamination to a certain extent. It can be widely used in the detection of LayV in clinics and laboratories.

[0045] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 Shows the amplification curve of the sensitivity test of the LayV virus fluorescent quantitative PCR kit.

[0047] Figure 2 Shows the amplification curve of the specific test of the LayV virus fluorescent quantitative PCR kit.

[0048] Figure 3 Shows the amplification standard curve of the LayV virus fluorescence quantitative PCR kit.

[0049] Figure 4 Shows the detection results of the LayV virus fluorescent quantitative PCR kit in actual samples. DETAILED DESCRIPTION

[0050] The LayV virus in the following embodiment (Zhang XA, Li H, Jiang FC, Zhu F, et al. A Zoonotic Henipavirus in Febrile Patients in China. N Engl J Med. 2022; 387(5): 470-472.) can be obtained by the public from the applicant in accordance with relevant national biosafety regulations. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0051] The influenza A virus in the following examples (Tiveljung-Lindell A, Rotzen-Ostlund M, Gupta S, et al. Development and implementation of a molecular diagnostic platform for daily rapid detection of 15 respiratory viruses. Journal of medical virology 2009; 81(1): 167-75.) can be obtained from the applicant by the public in accordance with the relevant provisions of national biosafety. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0052] Enterovirus 71 (Zhang X, Wang H, Ding S, et al. Prevalence of enteroviruses in children with and without hand, foot, and mouth disease in China. BMC Infect Dis. 2013; 13: 606.) in the following examples can be obtained from the applicant by the public in accordance with the relevant provisions of national biosafety. The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0053] The fever with thrombocytopenia syndrome bunyavirus in the following example (Liu W, Lu QB, Cui N, et al. Case-fatality ratio and effectiveness of ribavirin therapy among hospitalized patients in china who had severe fever with thrombocytopenia syndrome. Clin Infect Dis. 2013; 57(9): 1292-9.) can be obtained from the applicant by the public in accordance with the relevant provisions of national biosafety. The biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0054] The human parechovirus (Benschop K, Molenkamp R, Ham AVD, Wolthers K, Beld MJJoCVtOPotPASfCV. Rapid detection of human parechoviruses in clinical samples by real-time PCR. 2008; 41(2): 0-74.) in the following examples can be obtained from the applicant by the public in accordance with the relevant national biosafety regulations. The biological material can only be used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0055] Example 1. Preparation of a set of reagents for detecting LayV virus

[0056] This embodiment provides a set of reagents for detecting LayV virus, which consists of a primer pair for detecting LayV virus (composed of two single-stranded DNAs named LayV-F and LayV-R) and a probe (named LayV-P), wherein the 5' end of the probe is labeled with a FAM fluorescent group and the 3' end is labeled with an MGB quenching group, as follows:

[0057] LayV-F: 5'-GTTTACACTTGGGCGTTTGG-3' (SEQ ID No. 1 in the sequence listing);

[0058] LayV-R: 5'-CCTATCTCGCAACCTATGAGC-3' (SEQ ID No. 2 in the sequence listing);

[0059] LayV-P: 5'-FAM-ARGCATGGTATCTAGCGTCACAAAGAG-MGB-3' (SEQ ID No. 3 in the sequence listing).

[0060] In this set of reagents, LayV-F, LayV-R, and LayV-P are all packaged independently, and the molar ratio of LayV-F, LayV-R, and LayV-P is 1:1:2.

[0061] Example 2: Preparation of a kit for detecting LayV virus

[0062] This example provides a real-time fluorescence quantitative qRT-PCR kit for detecting LayV virus (stored at -20°C), which contains the following components:

[0063] (1)2×One Step RT-PCR Buffer;

[0064] (2) RT-PCR enzyme mixture;

[0065] (3) LayV-F;

[0066] (4) LayV-R;

[0067] (5) LayV-P;

[0068] (6) Positive control: plasmid containing LayV target gene (pUC57-LayV);

[0069] (7) Negative control: plasmid without LayV (pUC57);

[0070] (8) DNase / RNase-free H2O.

[0071] Among them, 2×One Step RT-PCR Buffer and RT-PCR enzyme mixture were from the One Step PrimeScript RT-PCR Kit (Perfect Real Time) (DRR064A) of Takara Biotechnology (Dalian) Co., Ltd. pUC57-LayV is a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID No. 4 in the sequence table into the multiple cloning site of the pUC57 vector (Beijing Qingke Biotechnology Co., Ltd.) and keeping the other sequences of the vector unchanged.

[0072] SEQ ID No.4:

[0073] GTTTACACTTGGGCGTTTGGTGATGATGATGAGTCATGGTTAGAGGCATGGTATCTAGCGTCACAAAGAGTCAAT ATAGATCTTGAGGTACTGAAAGCAATAACACCGATATCCACATCAAATAATCTTGCTCATAGGTTGCGAGATAGG

[0074] Example 3: Real-time fluorescence quantitative qRT-PCR detection of LayV virus

[0075] This example provides a method for detecting LayV virus using the kit of Example 2, and the specific steps are as follows:

[0076] (1) extracting RNA from the sample to be tested, i.e., template RNA;

[0077] (2) Real-time fluorescence quantitative qRT-PCR was performed using the kit of Example 2, with three replicates;

[0078] Reaction system (20 μL): 10 μL 2×One Step RT-PCR Buffer; 0.4 μL RT-PCR enzyme mixture; 0.4 μL LayV-F; 0.4 μL LayV-R; 0.8 μL LayV-R; 2.0 μL template RNA; 6.0 μL DNase / RNase-free H2O to 20 μL. The concentrations of LayV-F, LayV-R and LayV-R in the reaction system were 10 μM, 10 μM and 20 μM, respectively.

[0079] Reaction conditions: 42°C for 5 min; pre-denaturation at 95°C for 10 s, 1 cycle; denaturation at 95°C for 5 s, annealing at 50°C for 30 s, extension at 50°C for 30 s, 40 cycles of reaction and collection of fluorescence signals.

[0080] (3) Result determination: If the Ct value of the sample to be tested is ≤35 and an obvious amplification curve appears, it is determined to be positive; if there is no Ct value or the Ct value is greater than 35 and no obvious amplification curve appears, it is determined to be negative.

[0081] Example 4: Sensitivity of the kit for detecting LayV virus

[0082] 1. Materials

[0083] pUC57-LayV of Example 2.

[0084] 2. Methods

[0085] The concentration of plasmid nucleic acid of pUC57-LayV in step 1 was measured by spectrophotometer and then diluted in multiples. 7 gradients (1×10 8 copies / μL-1×10 2 The 7 groups of diluted pUC57-LayV solutions to be tested were named 1×10 8 copies / μL of pUC57-LayV solution, 1×10 7 copies / μL of pUC57-LayV solution, 1×10 6 copies / μL of pUC57-LayV solution, 1×10 5 copies / μL of pUC57-LayV solution, 1×10 4 copies / μL of pUC57-LayV solution, 1×10 3 copies / μL of pUC57-LayV solution and 1×10 2 copies / μL of pUC57-LayV solution.

[0086] Using the kit of Example 2 and the method of Example 3, the template RNA in the reaction system was replaced with the above-mentioned pUC57-LayV solutions to be tested, and other steps remained unchanged, and real-time fluorescence quantitative qRT-PCR was performed. The template RNA was replaced with a plasmid (pUC57) without LayV as a negative control.

[0087] 3. Results

[0088] The results are as follows Figure 1 As shown, the lowest concentration detected for PCR amplification was 1×10 2 copies / μL, indicating that the kit of the present invention has high sensitivity.

[0089] Example 5: Specificity of the kit for detecting LayV virus

[0090] 1. Samples to be tested

[0091] RNA samples positive for LayV virus, and RNA samples positive for four viruses (RNA of influenza A virus, enterovirus 71, fever with thrombocytopenia syndrome bunyavirus, and human double echovirus). All samples came from the Institute of Microbiology and Epidemiology, Academy of Military Medical Sciences, Academy of Military Sciences.

[0092] Among them, the LayV virus positive RNA sample is the cDNA obtained by reverse transcription of RNA extracted from the patient's serum. The sample was detected as LayV virus positive by fluorescent quantitative RT-PCR (primers and probes are from the literature: Zhang XA, Li H, Jiang FC, Zhu F, et al. AZoonotic Henipavirus in Febrile Patients in China. N Engl J Med. 2022; 387(5): 470-472.), and the primer and probe sequences are as follows:

[0093] LayV-F:TAAGCGACAAACCACAAGATAAT;

[0094] LayV-R:AGACCACCTCACCCCAGAAAT;

[0095] LayV-probe:FAM-AGATTTTCTGCATTCCC-MGB.

[0096] The influenza A virus positive RNA sample was cDNA obtained by reverse transcription of RNA extracted from the patient's throat swab. The sample was detected as influenza A virus positive using fluorescent quantitative RT-PCR (primers and probes from the literature: Tiveljung-Lindell A, Rotzen-Ostlund M, Gupta S, et al. Development and implementation of a molecular diagnostic platform for daily rapid detection of 15 respiratory viruses. Journal of medical virology 2009; 81(1): 167-75.). The primer and probe sequences are as follows:

[0097] Influenza AF:CATGGAATGGCTAAAGACAAGACC;

[0098] Influenza AR:AAGTGCACCAGCAGAATAACTGAG;

[0099] Influenza A-probe:FAM-CTGCAGCGTAGACGCTTTTGTCCAAAATG-BHQ1.

[0100] The enterovirus 71 positive RNA sample was a cDNA obtained by reverse transcription of RNA extracted from the patient's stool specimen. The sample was detected as enterovirus 71 positive using fluorescent quantitative RT-PCR (primers and probes from the literature: Zhang X, Wang H, Ding S, et al. Prevalence of enteroviruses in children with and without hand, foot, and mouth disease in China. BMC Infect Dis. 2013; 13: 606.). The primer and probe sequences are as follows:

[0101] EV71-F:CCCTGAATGCGGCTAATCC;

[0102] EV71-R:ATTGTCACCATAAGCAGCCA;

[0103] EV71-P:FAM-AACCGACTACTTTGGGTGTCCGTGTTTC-BHQ1.

[0104] The positive RNA sample of HFTS Bunyavirus was cDNA obtained by reverse transcription of RNA extracted from the patient's serum specimen. The sample was detected as positive for HFTS Bunyavirus by fluorescence quantitative RT-PCR (primers and probes were from the literature: Liu W, Lu QB, Cui N, et al. Case-fatality ratio and effectiveness of ribavirin therapy among hospitalized patients in china who had severe fever with thrombocytopenia syndrome. Clin Infect Dis. 2013; 57(9): 1292-9.). The primer and probe sequences are as follows:

[0105] SFTSV-F:TTCACAGCAGCATGGAGAGG;

[0106] SFTSV-R:GATGCCTTCACCAAGACTATCAATG;

[0107] SFTSV-P:FAM-AACTTCTGTCTTGCTGGCTCCGC-BHQ1.

[0108] The human parechovirus-positive RNA sample is a cDNA obtained by reverse transcription of RNA extracted from a patient's throat swab specimen. The sample is detected as positive for human parechovirus using fluorescent quantitative PCR (primers and probes are from the literature: Benschop K, Molenkamp R, Ham AVD, Wolthers K, Beld MJ JoCVtOPotPASfCV. Rapid detection of human parechoviruses in clinical samples by real-time PCR. 2008; 41(2): 0-74.). The primer sequences and probes are as follows:

[0109] HPeV-F:CTGGGGCCAAAAGCCA;

[0110] HPeV-R:GGTACCTTCTGGGCATCCTTC;

[0111] HPeV-P:FAM-AAACACTAGTTGTAWGGCCC-BHQ1.

[0112] 2. Methods

[0113] Using the kit of Example 2 and the method of Example 3, the template RNA in the reaction system was replaced with the above-mentioned samples to be tested, and other steps remained unchanged to perform real-time fluorescence quantitative qRT-PCR. Water was used to replace the template RNA as a negative control.

[0114] 3. Results

[0115] The results showed that the test results of the RNA samples known to be positive for LayV virus were positive, and the test results of the four viral RNA samples of influenza A virus, enterovirus 71, fever with thrombocytopenia syndrome bunyavirus, and human double echovirus were all negative, indicating that the kit of the present invention has no cross reaction to the above viruses and has good specificity (such as Figure 2 shown).

[0116] Example 6: Amplification efficiency of a set of reagents for detecting LayV virus

[0117] 1. Materials

[0118] pUC57-LayV of Example 2.

[0119] 2. Methods

[0120] The pUC57-LayV of Example 2 was used as the standard, and a 10-fold serial dilution was performed to set up 7 gradients (1×10 8 copies / μL-1×10 2 The 7 groups of diluted pUC57-LayV solutions to be tested were named 1×10 8 copies / μL of pUC57-LayV solution, 1×10 7 copies / μL of pUC57-LayV solution, 1×10 6 copies / μL of pUC57-LayV solution, 1×10 5 copies / μL of pUC57-LayV solution, 1×10 4 copies / μL of pUC57-LayV solution, 1×10 3 copies / μL of pUC57-LayV solution, 1×10 2 Three replicates were set for each concentration of template solution.

[0121] The kit of Example 2 was used according to the method of Example 3, and the template RNA in the reaction system was replaced with the above-mentioned pUC57-LayV solutions to be tested, and the other steps remained unchanged, and real-time fluorescence quantitative qRT-PCR was performed.

[0122] 3. Results

[0123] Standard curve see Figure 3 , where the X-axis represents the logarithm of the number of template copies added, and the Y-axis represents the fluorescence threshold, R 2 =0.9985, and the amplification efficiency (Eff%) was 99.6%. Figure 3 The amplification curves of each point are shown in Figure 1 The results show that the real-time fluorescence quantitative qRT-PCR detection of the set of reagents for detecting LayV virus of the present invention has a good amplification efficiency.

[0124] Example 7: Use of a kit for detecting LayV virus in LayV-positive nucleic acid samples

[0125] 1. Materials

[0126] 6 RNA samples confirmed by the inventors to be positive for LayV virus.

[0127] 2. Methods

[0128] Using the kit of Example 2 and the method of Example 3, the template RNA in the reaction system was replaced with the above RNA samples, and other steps remained unchanged to perform real-time fluorescence quantitative qRT-PCR. The template RNA was replaced with water as a negative control.

[0129] 3. Results

[0130] The results showed that among the 6 LayV virus-positive RNA samples, 6 positive samples were detected using the kit of the present invention, and the detection rate reached 100% (e.g. Figure 4 shown).

[0131] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A set of reagents, including a primer pair, wherein the primer pair is composed of two single-stranded DNAs named LayV-F and LayV-R; The LayV-F is as follows (a1) or (a2); (a1) a single-stranded DNA molecule shown in SEQ ID No. 1 of the sequence listing; (a2) a single-stranded DNA molecule having the same function as SEQ ID No. 1 after one or more nucleotides are substituted and / or deleted and / or added; The LayV-R is as follows (a3) ​​or (a4); (a3) a single-stranded DNA molecule shown in SEQ ID No. 2 of the sequence listing; (a4) A single-stranded DNA molecule having the same function as SEQ ID No. 2 after one or more nucleotides are substituted and / or deleted and / or added.

2. The reagent set according to claim 1, characterized in that: The kit also includes a probe named LayV-P, and the sequence of the LayV-P is as follows (a5) or (a6); (a5) SEQ ID No. 3 of the sequence listing; (a6) A sequence having the same function as SEQ ID No. 3 after one or more nucleotides are substituted and / or deleted and / or added.

3. The reagent set according to claim 2, characterized in that: The two ends of the probe are respectively labeled with a fluorescent group and a fluorescent quenching group.

4. Use of (b1) or (b2) or (b3) or (b4) of any one of the kits of claim 1 to 3: (b1) detecting or assisting in detecting whether the virus to be detected is LayV virus; (b2) preparing a kit for detecting or assisting in detecting whether the virus to be tested is LayV virus; (b3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus; (b4) preparing a kit for detecting or assisting in detecting whether a sample to be tested contains LayV virus.

5. The primer pair according to claim 1.

6. Use of (b1) or (b2) or (b3) or (b4) of the primer pair according to claim 5: (b1) detecting or assisting in detecting whether the virus to be detected is LayV virus; (b2) preparing a kit for detecting or assisting in detecting whether the virus to be tested is LayV virus; (b3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus; (b4) preparing a kit for detecting or assisting in detecting whether a sample to be tested contains LayV virus.

7. A kit comprising the reagent set according to any one of claims 1 to 3 or the primer pair according to claim 5.

8. The kit according to claim 7, characterized in that: The kit also contains other non-primer probe reagents required for real-time fluorescence quantitative qRT-PCR.

9. Use of (d1) or (d2) or (d3) or (d4) of the kit according to claim 7 or 8: (d1) detecting or assisting in detecting whether the virus to be detected is LayV virus; (d2) preparing products for detecting or assisting in detecting whether the virus to be detected is LayV virus; (d3) Detecting or assisting in detecting whether the sample to be tested contains LayV virus; (d4) Preparing products for detecting or assisting in detecting whether a sample contains LayV virus.

Images