Primer pair and probe set for detecting actinobacillus pleuropneumoniae

Abstract

The invention provides a primer pair and a probe group for detecting actinobacillus pleuropneumoniae, and a kit for detecting the actinobacillus pleuropneumoniae based on a real-time fluorescent RAA method prepared by using the primer pair and the probe group, or a kit for detecting the actinobacillus pleuropneumoniae based on a colloidal gold test strip and the colloidal gold test strip. The invention further discloses a corresponding detection method. The screened primer pair and probe are used for a real-time fluorescent RAA kit for detecting serotype 1-18 porcine actinobacillus pleuropneumoniae, reaction can be completed only by 30 min under the constant temperature condition of 42 DEG C, the whole reaction process is low in instrument and equipment requirement, short in time consumption and easy to operate, the result can be visualized through naked eyes, and the method is more suitable for basic-level field diagnosis and instant detection.

Description

Technical Field

[0001] The invention belongs to the technical field of gene detection of pathogenic bacteria, and in particular relates to a primer pair and a probe group for detecting porcine Actinobacillus pleuropneumoniae. Background Art

[0002] Porcine contagious pleuropneumonia is caused by Actinobacillus pleuropneumoniae (APP), a contact infectious disease characterized by acute hemorrhagic fibrinous pleuropneumonia and chronic fibrinous necrotic pleuropneumonia. Since the disease was first reported in my country in 1987, it has been widely prevalent in various pig farms in my country. Pigs of all ages can be infected, but pigs aged 2-4 months are most susceptible because their maternal antibody levels begin to decrease and their immune systems are not fully developed, causing serious economic losses to my country's pig industry. There are many serotypes of APP strains, including 19 serotypes, namely 1-19. The dominant serotypes prevalent in different countries and regions are not the same, and there is a lack of cross-immune protection between the serotypes. Therefore, the diagnosis and prevention of the disease are relatively difficult. With the intensive development of my country's pig industry, frequent introduction of new breeds, and the implementation of "antibiotic-free" measures for feed, the harm of this disease to pig production has shown a trend of aggravation, seriously threatening the sustainable and healthy development of my country's pig farming industry. However, traditional bacterial isolation and identification methods and nucleic acid detection methods are time-consuming, cumbersome, and require high requirements on operators and experimental equipment, which is not conducive to the real-time, simple and rapid detection of APP at the clinical grassroots level. Therefore, it is urgent to establish an efficient, fast, sensitive, specific, accurate and stable APP rapid detection method, which is of great significance for the real-time monitoring and timely prevention and treatment of the disease in my country.

[0003] Recombinase-aided amplification (RAA) can achieve rapid amplification of nucleic acids within 30 minutes at a constant temperature of 37-42°C through recombinase and its auxiliary factors, DNA polymerase, and single-stranded DNA binding protein. It does not require complex thermal cycling instruments and is widely used in primary clinical practice for real-time monitoring and early diagnosis of diseases. It provides a new platform for Chinese researchers to conduct in-depth research on pathogen nucleic acid detection. It is worth noting that by adding FAM fluorescent probes to the reaction system, fluorescence can be generated at the corresponding excitation wavelength, so the reaction products can be visually judged in combination with portable blue light instruments. Not only that, the downstream primers can be labeled with biotin and the probes can be labeled with FAM fluorescent groups. The two can be specifically combined with colloidal gold test strips to achieve rapid detection of pathogens. This technology has strong sensitivity, good specificity, and simple operation. It is suitable for resource-limited environments, primary and on-site instant detection, and has great application prospects in rapid nucleic acid detection.

[0004] However, in order to achieve rapid amplification of nucleic acids in a short time by the real-time fluorescence RAA detection method and the colloidal gold RAA detection method, the selection and screening of primers and probes are crucial. The design of probes in the conserved region can ensure the specificity of the method, thereby avoiding false negatives caused by the inability of the probe to bind to the target; moreover, if the probe forms a secondary structure, it will not only affect the efficiency of amplification but also lead to nonspecific amplification and false positives. Therefore, the design of the probe is a key factor affecting the specificity of the method. At the same time, the design and screening of primers are also very important for the amplification of the reaction, and the amplification efficiency of the primer pair is a key factor affecting the sensitivity of the method. Primer pairs with high amplification efficiency can detect samples with lower sensitivity in a shorter time, while primers with poor amplification efficiency will cause false positives due to long amplification time. Therefore, the design and screening of primers and probes are the main limiting factors limiting the application of RAA rapid detection methods in the field of pathogen detection. Summary of the invention

[0005] The purpose of the present invention is to provide a primer pair and a probe group for detecting porcine Actinobacillus pleuropneumoniae, a kit for detecting porcine Actinobacillus pleuropneumoniae based on a real-time fluorescence RAA method prepared using the primer probe group, or a kit and a colloidal gold test strip for detecting porcine Actinobacillus pleuropneumoniae based on a colloidal gold test strip, and a corresponding detection method established.

[0006] The present invention first provides a RAA primer pair and probe for detecting serotypes 1-18 of porcine Actinobacillus pleuropneumoniae, and the sequence information thereof is as follows:

[0007] The sequences of the upstream primer APP-F and the downstream primer APP-R are as follows:

[0008] APP-F: 5'-GCCTTAGTGTACTGTTGTAATAAAGCAGCCAACTC-3' (SEQ ID NO: 1);

[0009] APP-R: 5'-TTTTATAGCCGATTTACCGAAGCGTTAAATTT-3' (SEQ ID NO: 2);

[0010] The sequences of the exo probes used to detect the above APP-F and APP-R amplification products are as follows:

[0011] 5'-CCGAACCCGACCGGTGCCGGTTAGATTAATTGTGCGACGTTGTTGCTC-3' (SEQ ID NO: 3).

[0012] The probe has a FAM luminescent group labeled with the 31st base T from the 5' end, a tetrahydrofuran THF substituted with the 32nd base T, a BHQ1 quenching group labeled with the 33rd base T, and a C3-spacer blocking modification performed on the 3' end.

[0013] 5′-CCGAACCCGACCGGTGCCGGTTAGATTAAT(FAM-dT)(THF)(BHQ1-dT)

[0014] GCGACGTTGTTGCTC[C3-Spacer]-3′.

[0015] The above primer-probe combination is suitable for preparing a real-time fluorescent RAA detection kit;

[0016] In another aspect, the present invention provides a primer-probe combination for preparing colloidal gold test strips, wherein the upstream primer is APP-F, and the downstream primer is APP-LFA-R, which is labeled with Biotin at the 5' end, and the sequence thereof is as follows:

[0017] 5'-TTTTATAGCCGATTTACCGAAGCGTTAAATTT-3' (SEQ ID NO: 4);

[0018] The probe APP-nfo-Probe (nfo) used in colloidal gold test strips has the same sequence as the exo probe, except that the probe is labeled with a FAM luminescent group from the 5' end, the 32nd base T is replaced by tetrahydrofuran THF, and the 3' end is modified with a C3-spacer blocking.

[0019] 5'-(FAM)CCGAACCCGACCGGTGCCGGTTAGATTAATT(THF)TGCGACGTTGTTGCTC[C3-Spacer]-3'.

[0020] That is, primer APP-F, primer APP-LFA-R and probe nfo are used to prepare a test strip type RAA kit.

[0021] The present invention further provides a fluorescent RAA detection kit for detecting porcine Actinobacillus pleuropneumoniae, wherein the kit further comprises a reagent system suitable for recombinase-mediated isothermal amplification reaction, a fluorescent basic reaction unit and the above-mentioned upstream primer APP-F, downstream primer APP-R and exo probe.

[0022] In another aspect, the present invention provides a test strip type RAA kit for detecting porcine Actinobacillus pleuropneumoniae, which comprises primer APP-F, primer APP-LFA-R and probe nfo to prepare the test strip type RAA kit.

[0023] The kit also comprises a reagent system suitable for recombinase-mediated isothermal amplification reaction and a fluorescence-based reaction unit;

[0024] The reagent system includes reaction buffer, nuclease-free water and magnesium acetate;

[0025] The fluorescence basic reaction unit comprises a single-stranded DNA binding protein, a recombinase and a polymerase.

[0026] In another aspect, the present invention also provides a method for using a RAA kit for detecting Actinobacillus pleuropneumoniae, comprising the following steps:

[0027] 1) Extracting DNA from the sample to be tested by conventional methods;

[0028] 2) Using the extracted DNA as a template, perform RAA amplification, control the amplification at a constant temperature of 42°C, and determine the results;

[0029] The fluorescent RAA kit can directly determine the results through a fluorescent quantitative detection instrument or a convenient blue light detection instrument; the quality control standard is: if the negative control has no amplification curve or the visualization result is colorless, and the positive control has an amplification curve or the visualization result is green, then the experimental data is valid, otherwise the experimental result is invalid and needs to be re-tested;

[0030] Result description and judgment: If there is no amplification curve or the visualization result is colorless, the sample is judged to be negative; if there is an amplification curve or the visualization result is green, the sample is judged to be positive.

[0031] The following steps are required for the RAA test strip kit:

[0032] 1) Take 5-10 μL of nucleic acid amplification product and dilute it 20 times with sterile ddH2O in a centrifuge tube and mix well;

[0033] 2) Take 50 μL of the diluted reaction product and drop it into the sample well of the test strip;

[0034] 3) Result determination after 5 minutes,

[0035] The quality control standard is: if no band appears in the quality control area (C line) of the test strip, the experimental data is invalid;

[0036] If a band appears in the quality control area (line C) of the test strip, the experimental data is valid;

[0037] Result description and judgment: If two red strips appear on the test strip, one in the quality control area (C line) and the other in the detection area (T line), it indicates that the experimental result is positive; if a red strip appears in the quality control area (C line) of the test strip and there is no strip in the detection area (T line), it indicates that the experimental result is negative.

[0038] The primer pairs and probes screened by the present invention are used for the real-time fluorescent RAA kit for detecting serotypes 1-18 of porcine Actinobacillus pleuropneumoniae. It only needs to react for 30 minutes at a constant temperature of 42°C to complete. The entire reaction process has low requirements for instruments and equipment, is short in time, and is simple to operate. The results can be visualized with the naked eye, and are more suitable for grassroots on-site diagnosis and instant detection. In addition, the test strip type RAA kit for detecting porcine Actinobacillus pleuropneumoniae of the present invention can be completed on the test strip for 5 minutes after reacting for 30 minutes at a constant temperature of 42°C. It can also complete the rapid detection of porcine Actinobacillus pleuropneumoniae, and has the characteristics of being simple, rapid, sensitive, and having good specificity. The above method truly realizes portable rapid nucleic acid detection, and can provide technical support for the rapid diagnosis, real-time monitoring, and prevention and control of porcine contagious pleuropneumoniae. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 : Alignment of apxⅣA gene of Actinobacillus pleuropneumoniae type 1-18, in which the upstream primer and downstream primer regions are covered with green and red backgrounds respectively, and the probe region is covered with a yellow background.

[0040] Figure 2 : Screening flow chart of RAA primers for Actinobacillus pleuropneumoniae, wherein (A): a schematic diagram of the first round of primer screening; (B): a diagram of the first round of upstream primer screening results; (C): a diagram of the first round of downstream primer screening results; (D): a schematic diagram of the second round of primer screening; (E): a diagram of the second round of upstream primer screening results; (F): a diagram of the second round of downstream primer screening results; (G): a schematic diagram of the third round of primer screening; (H): a diagram of the third round of upstream primer screening results; (I): a diagram of the third round of downstream primer screening results.

[0041] Figure 3 :Porcine pleuropneumoniae Actinomycetemcomitans RAA specificity validation diagram, among which Figure 3 A: Real-time fluorescence APP-RAA amplification results, Figure 3 B: APP-RAA visualization results, Figure 3 C: Results of the test strip type APP-RAA; 1: Actinobacillus pleuropneumoniae, 2: Streptococcus suis, 3: Glasserella suis, 4: Mycoplasma hyopneumoniae, 5: Klebsiella, 6: Pseudomonas aeruginosa, 7: Staphylococcus aureus, 8: Salmonella typhimurium, 9: Escherichia coli, 10: negative control group.

[0042] Figure 4 :Porcine pleuropneumoniae Actinomycetemcomitans RAA sensitivity verification chart, Figure 4 A: APP-qPCR sensitivity test results and statistical analysis results, Figure 4 B: Real-time fluorescence RAA sensitivity test results and statistical analysis results, Figure 4 C: Visualization of RAA sensitivity test results and statistical analysis results, Figure 4 D: Test strip type RAA sensitivity test results and statistical analysis results; 1:10 6 copies / μL APC, 2:10 5 copies / μL APC, 3:10 4 copies / μL APC, 4:10 3 copies / μL APC, 5:10 2 copies / μL APC, 6:10 1 copies / μL APC, 7:10 0 copies / μL APC, 8: negative control. DETAILED DESCRIPTION

[0043] The present invention is described in detail below in conjunction with embodiments and drawings.

[0044] Example 1: Screening of primer pairs and probe combinations

[0045] First, the apxⅣA genes of APP representative strains of different serotypes from serotype 1 to 18 were compared, and their conserved regions were selected as detection targets ( Figure 1 ). The selected target sequence can meet the requirements of detecting porcine pleuropneumoniae serotypes 1-18 without cross-reaction with other pathogens. Then, the probe was designed in the target region, and the design principles of exo probe and nfo probe were combined for comprehensive analysis, and the probe design sequence suitable for both exo probe and nfo probe was found. Among them, the length of nfo probe should be 46-52 nucleotides, of which at least 30 are located at the 5′ end of the THF site, and at least 15 are located at the 3′ end of THF. The length of exo probe should be 46-52 nucleotides, of which at least 30 are located at the 5′ end of the THF site, and at least 15 are located at its 3′ end. The number of nucleotides between dT-fluorophore and dT-quencher and THF is 0, 1 or 2, and C3-Spacer is used to block the 3′ end of the probe. In addition, the probe must meet the GC% between 40-60%, there are no 5 or more consecutive repeat sequences, and avoid the generation of complex stem-loop structures and palindromic sequences.

[0046] In order to obtain the RAA primer pair sequence of porcine Actinobacillus pleuropneumoniae, 44 candidate primers were designed in the target region. Each primer must meet the basic RAA primer design requirements. In addition to the conventional design requirements, the 3′ end of the candidate primer must be a conservative base, and the presence of 5 or more repeat sequences, forward / reverse repeats, palindromic sequences, etc. must be avoided.

[0047] The above candidate primers were screened for three rounds before the most suitable primer pair was determined. The purpose of the first round of screening was to roughly determine the position of the primers. After determining the appropriate target region, seven upstream (F768-797, F783-812, F798-827, F813-842, F828-857, F843-872, F858-887) and seven downstream candidate primers (R926-955, R938-967, R964-993, R977-1006, R1017-1046, R1032-1061, R1049-1078) were designed in the first round of screening. Figure 2 A). Each candidate primer is 30 nt in length. The first round of candidate primers designed together with the probe cover the entire amplification target. In order to ensure the optimal amplification efficiency of the primers, a systematic screening was adopted: first fix the upstream primers, and then screen all the downstream primers R926-955, R938-967, R964-993, R977-1006, R1017-1046, R1032-1061, and R1049-1078. Then the most suitable first round downstream primer R926-955 was obtained, and then the downstream primer was used to screen all the upstream primers F768-797, F783-812, F798-827, F813-842, F828-857, F843-872, and F858-887, and the first round of the most suitable primer pair F813-842, R926-955 ( Figure 2 B,C).

[0048] The purpose of the second round of screening was to further determine the precise position of the primers based on the first round of screening. The optimal primers obtained in the first round of screening were used as the standard, the primer length was kept at 30 nt, and the position was continuously moved forward or backward by 1 nt. Eleven second round upstream primers (F808-837, F809-838, F810-839, F811-840, F812-841, F813-842, F814-843, F815-844) were designed. , F816-845, F817-846, F818-847) and 11 downstream primers (R921-950, R922-951, R923-952, R924-953, R925-954, R926-955, R927-956, R928-957, R929-958, R930-959, R931-960) ( Figure 2D). First, the upstream primer F813-842 was fixed, and all the downstream primers R921-950, R922-951, R923-952, R924-953, R925-954, R926-955, R927-956, R928-957, R929-958, R930-959, and R931-960 were screened. Then the optimal second round downstream primer R927-956 was obtained, and then all the upstream primers were screened using the downstream primer F808-837, F809-838, F810-839, F811-840, F812-841, F813-842, F814-843, F815-844, F816-845, F817-846, F818-847, and finally the optimal second round primer pair F808-837, R927-956 ( Figure 2 E, Figure 2 F).

[0049] The purpose of the final third round of screening was to determine the length of the primers. The position of the best primers obtained from the second screening was fixed, and the bases were increased or decreased one by one at the 3′ end, and the primer length was 30-36 nt. Seven upstream primers (F808-837, F808-838, F808-839, F808-840, F808-841, F808-842, F808-843) and five downstream primers (R923-956, R924-956, R925-956, R926-956, R927-956) were designed respectively. Figure 2 G). First, the upstream primer F808-837 was fixed, and all the downstream primers R923-956, R924-956, R925-956, R926-956, and R927-956 were screened. Then, the most suitable third round downstream primer R925-956 was obtained, and then the downstream primer was used to screen all the upstream primers F808-837, F808-838, F808-839, F808-840, F808-841, F808-842, and F808-843, and the most suitable upstream primer F808-842 was obtained.

[0050] In summary, after three rounds of screening of 44 candidate primers, the optimal primer pair F808-842, R925-956 (APP-F, APP-R) for RAA reaction was finally obtained. Figure 2 H, Figure 2I). The principle of each round of screening is to select candidate primers corresponding to the curve with short amplification start time and strong total fluorescence signal intensity. Short amplification start time means that the candidate primers can detect the same sample in a shorter time, and strong total fluorescence signal intensity means that the candidate primers can detect samples with lower concentrations under the same conditions. Therefore, the primer pairs obtained by screening according to the above principles have faster amplification efficiency and better sensitivity.

[0051] The sequences of the upstream primer APP-F and the downstream primer APP-R are as follows:

[0052] APP-F: 5'-GCCTTAGTGTACTGTTGTAATAAAGCAGCCAACTC-3';

[0053] APP-R: 5'-TTTTATAGCCGATTTACCGAAGCGTTAAATTT-3';

[0054] The sequences of the exo probes used to detect the above APP-F and APP-R amplification products are as follows:

[0055] 5′-CCGAACCCGACCGGTGCCGGTTAGATTAATTGTGCGACGTTGTTGCTC-3′.

[0056] The probe has a FAM luminescent group labeled with the 31st base T from the 5' end, a tetrahydrofuran THF substituted with the 32nd base T, a BHQ1 quenching group labeled with the 33rd base T, and a C3-spacer blocking modification performed on the 3' end.

[0057] 5′-CCGAACCCGACCGGTGCCGGTTAGATTAAT(FAM-dT)(THF)(BHQ1-dT)

[0058] GCGACGTTGTTGCTC[C3-Spacer]-3′.

[0059] The above primer-probe combination is suitable for preparing a real-time fluorescent RAA detection kit.

[0060] On the basis of obtaining the upstream primer, the primer-probe combination suitable for preparing colloidal gold test strips and thus performing test strip type RAA kit detection was screened, wherein the upstream primer was still APP-F, and the downstream primer was the 5' end labeled with Biotin primer APP-LFA-R, and its sequence was as follows:

[0061] 5'-(Biotin)TTTTATAGCCGATTTACCGAAGCGTTAAATTT-3';

[0062] The probe APP-nfo-Probe (nfo) used in colloidal gold test strips has the same sequence as the exo probe, except that the probe is labeled with a FAM luminescent group from the 5' end, the 32nd base T is replaced by tetrahydrofuran THF, and the 3' end is modified with a C3-spacer blocking.

[0063] 5'-(FAM)CCGAACCCGACCGGTGCCGGTTAGATTAATT(THF)TGCGACGTTGTTGCTC[C3-Spacer]-3'.

[0064] That is, primer APP-F, primer APP-LFA-R and probe nfo are used to prepare a paper strip type RAA kit.

[0065] The present invention designs primer pairs and probes suitable for real-time fluorescence RAA and primer pairs and probe sequences for test strip type RAA for apxⅣA gene of APP serotypes 1-18. Upstream primers APP-F, downstream primers APP-R, APP-LFA-R and probes APP-exo-Probe and APP-nfo-Probe suitable for rapid detection of RAA are screened out. The primer pairs and probes can realize rapid detection of porcine pleuropneumoniae of serotypes 1-18, and verify the specificity, sensitivity and clinical samples of the detection method.

[0066] Example 2: Specific detection of Actinobacillus pleuropneumoniae RAA

[0067] In order to investigate the specificity of the primer probe designed by the present invention, this example uses porcine Actinobacillus pleuropneumoniae, Streptococcus suis, Glaseria suis, Mycoplasma hyopneumoniae, Klebsiella, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhimurium and Escherichia coli as reaction templates, and sets a negative control.

[0068] Figure 3 The results in AC show that except for the test group corresponding to porcine Actinobacillus pleuropneumoniae DNA, which has a specific fluorescence detection curve, the visualization results show a specific green fluorescence result and a red band appears on both the C line and T line of the test paper. No amplification curves appear in other bacteria and the negative control group, and the visualization results are colorless, and the C line of the test paper has a red band and the T line has no band. The results show that the real-time fluorescence RAA rapid detection method and the test strip type RAA rapid detection method used in the present invention can achieve specific detection of porcine Actinobacillus pleuropneumoniae, and there is no cross reaction with other related bacterial pathogens, and the specificity is good.

[0069] Example 3: Verification of RAA sensitivity of Actinobacillus pleuropneumoniae

[0070] In order to detect the sensitivity of the method of the present invention, 10 6 -10 0 copies / reaction APP-apxⅣA positive standard plasmid (artificial positive control, APC), and perform RAA nucleic acid amplification according to the above-mentioned sample addition method.

[0071] A positive standard plasmid named pEASY-Blunt-APP-apxⅣA was constructed. 6 copies / μL, and then diluted 10-fold to 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 2 μL of each copy / μL was taken as the reaction template, and a negative control was set up. RAA nucleic acid amplification was performed according to the above-mentioned sample addition method. At the same time, the qPCR method in the published literature (Tobias et al., 2012) was used for comparison. The test results are shown in Figure 4 shown.

[0072] pass Figure 4 The results in AD show that the RAA primer and probe combination screened by the present invention can ensure the sensitivity of detection. The detection sensitivity of APP-qPCR is 100 copies / μL, while the real-time fluorescence RAA detection method, the visual RAA detection method and the test strip RAA detection method established by the present invention can all detect 10 copies / μL. The 8 repetitions were calculated and analyzed by SPSS software. The sensitivity of the real-time fluorescence RAA and the test strip RAA detection methods was equivalent, both reaching 18 copies / μL (95% confidence interval), and the sensitivity of the visual RAA detection method could also reach 203 copies / μL (95% confidence interval).

[0073] Example 4: Detection and verification of clinical samples

[0074] A total of 33 clinical tissue samples were collected, and the 33 clinical samples to be tested were extracted according to the instructions of the DNA extraction reagent, and the extracted DNA was stored at -20°C.

[0075] RAA nucleic acid amplification was performed according to the sample addition method in the aforementioned Examples 1 and 2, and the clinical sample was simultaneously detected by the qPCR method in the published literature (Tobias et al., 2012) for comparison. The detection results are shown in Table 1 below.

[0076] The results showed that 12 of the 33 clinical samples tested were positive by real-time fluorescence RAA, 12 by qPCR, 12 by visual RAA, and 12 by test strip RAA. The Kappa value of clinical sample detection by the three RAA methods and the qPCR method was 1.0, P < 0.001.

[0077] Table 1: Clinical sample test results

[0078]

[0079] It can be seen that the method of the present invention can realize simple, rapid, sensitive and visual detection of porcine Actinobacillus pleuropneumoniae. The method is time-saving, simple to operate, suitable for real-time detection in resource-limited environments, grassroots and on-site, and can truly realize portable rapid nucleic acid detection, providing technical support for the early diagnosis of porcine contagious pleuropneumoniae.

Claims

1. A primer pair and probe for detecting serotypes 1-18 of porcine Actinobacillus pleuropneumoniae, characterized in that: The upstream primer of the primer pair is SEQ ID NO: 1, the downstream primer is SEQ ID NO: 2, and the probe is SEQ ID NO:

3.

2. The primer pair and probe according to claim 1, characterized in that: When the probe is used for fluorescent RAA detection, the 31st base T at the 5' end is labeled with a FAM luminescent group, the 32nd base T is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ1 quenching group, and the 3' end is modified with a C3-spacer blocking.

3. The primer pair and probe according to claim 1, characterized in that: When the probe is used for colloidal gold test strip detection, the 5' end of the probe is labeled with a FAM luminescent group, the 32nd base T is replaced by tetrahydrofuran THF, and the 3' end is subjected to C3-spacer blocking modification.

4. The primer pair and probe according to claim 3, characterized in that: The sequence of the downstream primer is SEQ ID NO:

4.

5. Use of the primer pair and probe according to any one of claims 1 to 4 in the preparation of a preparation for detecting serotypes 1 to 18 of Actinobacillus pleuropneumoniae.

6. A fluorescent RAA detection kit for detecting serotypes 1-18 of porcine Actinobacillus pleuropneumoniae, characterized in that: The kit comprises the primer pair and probe according to claim 1.

7. A fluorescent colloidal gold test strip kit for detecting serotypes 1-18 of porcine Actinobacillus pleuropneumoniae, characterized in that: The kit comprises the upstream primer according to claim 1, the downstream primer according to claim 4 and the probe according to claim 3.

8. The kit according to claim 6 or 7, characterized in that The kit also comprises a reagent system suitable for recombinase-mediated isothermal amplification reaction and a fluorescence-based reaction unit, wherein the reagent system comprises a reaction buffer, nuclease-free water and magnesium acetate; and the fluorescence-based reaction unit comprises a single-stranded DNA binding protein, a recombinase and a polymerase.

9. The method for using the kit according to claim 6 or 7, characterized in that: The method comprises the following steps: 1) Extracting DNA from the sample to be tested by conventional methods; 2) Using the extracted DNA as a template, perform RAA amplification, control the amplification at a constant temperature of 42°C, and determine the results.

10. The method of claim 9, wherein the fluorescent RAA kit directly determines the result by a fluorescent quantitative detection instrument or a portable blue light detection instrument; the quality control standard is: if the negative control has no amplification curve or the visualization result is colorless, and the positive control has an amplification curve or the visualization result is green, then the experimental data is valid, otherwise the experimental result is invalid and needs to be re-tested; Result description and judgment: If there is no amplification curve or the visualization result is colorless, the sample is judged as negative; if there is an amplification curve or the visualization result is green, the sample is judged as positive; The following steps are required for the RAA test strip kit: 1) Take 5-10 μL of nucleic acid amplification product and dilute it 20 times with sterile ddH2O in a centrifuge tube and mix well; 2) Take 50 μL of the diluted reaction product and drop it into the sample well of the test strip; 3) Result determination after 5 minutes, The quality control standard is: if there is no band on the C line of the quality control area of ​​the test strip, the experimental data is invalid; if there is a band on the C line of the quality control area of ​​the test strip, the experimental data is valid; Result description and judgment: If two red strips appear on the test strip, one on the C line of the quality control area and the other on the T line of the detection area, it indicates that the experimental result is positive; if a red strip appears on the C line of the quality control area of ​​the test strip and there is no strip on the T line of the detection area, it indicates that the experimental result is negative.

Images