Method for accurately quantifying environment DNA (Deoxyribose Nucleic Acid) of starfish on site

Abstract

The invention provides a method for accurately quantifying environment DNA of starfish on site, and belongs to the technical field of quantifying environment DNA of starfish, and the method comprises the following steps: preparing a ZnSe / NHC / Au electrode material, designing a specific primer of starfish, designing a DNA probe, and constructing a biosensor based on a triblock polyA-DNA probe. According to the constructed electrochemical DNA biosensor, a three-block polyA-DNA probe ordered assembly strategy is adopted, the problem that the state of a self-assembly layer of a traditional linear probe is disordered is solved, and the sensitivity, the specificity, the stability and the reproducibility of the electrochemical biosensor for detecting the eDNA of the starfish are further improved.

Description

Technical Field

[0001] The invention relates to the technical field of quantitative long-spined sea star environmental DNA, and in particular to a method for accurately quantifying long-spined sea star environmental DNA on site. Background Art

[0002] Outbreaks of the "coral killer" long-thorns starfish (Acanthaster cf. solaris, Crown-of-Thorns Starfish, COTS) can cause large-scale coral death, thus affecting the structure and function of coral communities, further leading to a reduction in marine fishery resources and biodiversity, and even destroying the stability of coral reef ecosystems. In order to reduce the risk of outbreaks, it is of great significance to implement effective preventive management strategies. However, due to the low visibility and hidden behavior of the larvae and adults of long-thorns starfish, only 5-10% of long-thorns starfish can be found by conventional ecological survey methods such as manta ray trawling. Therefore, it is of great significance to develop practical monitoring tools or methods to conduct effective on-site dynamic monitoring of the density of long-thorns starfish.

[0003] The emergence of environmental DNA (eDNA) technology has provided new ideas and technical solutions for the effective monitoring of long-spined sea stars. eDNA is defined as in vitro genetic material that is shed from large organisms and suspended in environmental samples such as water and sediments through feces, body mucus, blood, and shed tissues or scales. eDNA analysis has rapidly gained popularity in the past decade, mainly because the complexity of DNA signals contained in environmental samples helps to detect a wide range of taxa and more individual species compared to traditional monitoring methods. Therefore, eDNA analysis can conduct large-scale biodiversity assessments and ecosystem assessments, with lower costs and higher time efficiency, specificity and sensitivity, and its sample collection method is a universal, easy-to-implement non-invasive environmental sampling method. Currently, most eDNA detection methods are based on molecular techniques such as polymerase chain reaction (PCR), fluorescent quantitative PCR (qPCR), and droplet data PCR (ddPCR) for identification and quantification. However, in aquatic environments, the detection of eDNA is affected by origin, transportation process, attenuation, and local dynamic diffusion conditions, such as age, food source, water temperature, community structure, etc. These physical and biological variables can cause significant changes in tissue shedding volume and rate. In addition, the effective capture of eDNA from the vast ocean environment also involves huge volumes of water and dynamic ocean physical properties (ocean currents, vertical mixing movements, tides), so the detection of eDNA in the ocean is more challenging. Although the current technology for detecting eDNA has good reliability, it is more important to develop reliable and sensitive analytical tools that can effectively monitor the eDNA of long-spined sea stars on site.

[0004] Electrochemical biosensors are considered to be ideal tools for instant detection of eDNA due to their reliability, ease of miniaturization, low cost and high efficiency. At present, researchers have successfully constructed an electrochemical biosensor based on linear probes, which was first applied to the detection of eDNA in long-spined sea stars. However, the one-dimensional linear probe structure of this work is easily affected by strong background signals due to the presence of unbound probes, which easily produces false positive signals. In addition, the spatial crowding effect produced by the one-dimensional probe structure leads to low sensitivity and specificity of the constructed sensor. Therefore, the development of novel DNA probe nanostructures will help to prepare efficient electrochemical biosensors for reliable and sensitive on-site effective monitoring of long-spined sea star eDNA.

[0005] At present, researchers have successfully constructed an electrochemical biosensor based on linear probes, which was first applied to the detection of eDNA in long-spined sea stars. However, the one-dimensional linear probe structure used in this work is easily affected by strong background signals and produces false positive signals due to the presence of unbound probes. Summary of the invention

[0006] The purpose of the present invention is to provide a method for accurately quantifying the environmental DNA of long-spined sea star on site, so as to solve the technical problems of low sensitivity and poor specificity of biosensors caused by the existing one-dimensional linear DNA probe structure that is prone to false positive signals and spatial crowding effects.

[0007] An electrochemical biosensor based on a triblock polyA-DNA capture probe was developed to improve the sensitivity and accuracy of long-spined sea star eDNA detection. The special capture probe structure design significantly improved the detection efficiency, specificity, stability and regeneration of the biosensor. More importantly, the sensor showed excellent accuracy in detecting long-spined sea star outbreak sites in the South China Sea after verification in offshore tests. This technological innovation provides a new and effective method for dynamically monitoring the density of long-spined sea stars in the pre-outbreak stage.

[0008] Overcome the problem of low sensitivity and poor specificity caused by one-dimensional linear DNA probe structures that are prone to false positive signals and spatial crowding effects. An efficient electrochemical biosensor based on triblock polyA-DNA capture probes was developed to improve the sensitivity and reliability of long-spined sea star eDNA detection. The special capture probe structure improves the detection efficiency, specificity, stability and regeneration of the biosensor. More importantly, the results of offshore tests in the South China Sea long-spined sea star outbreak area proved that the biosensor has good reliability. This work provides a novel technology for dynamically monitoring the density of long-spined sea stars in the pre-outbreak stage.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0010] A method for accurately quantifying long-spined sea star environmental DNA on site, the method comprising the following steps:

[0011] Step 1: Preparation of ZnSe / NHC / Au electrode materials;

[0012] Step 2: Design of primers specific for long-spined sea star;

[0013] Step 3: Design of DNA probe;

[0014] Step 4: Construction of triblock polyA-DNA probe-based biosensor.

[0015] Further, the specific process of step 1 is:

[0016] Step 1.1: Synthesis of ZIF-8: Dissolve 5.95 g zinc nitrate in 150 mL methanol, pour the resulting solution into 150 mL methanol solution containing 6.16 g 2-methylimidazole, stir at room temperature for 24 h, wash with methanol, collect the sample by centrifugation, and dry at 60 °C;

[0017] Step 1.2: Synthesis of ZnSe / NHC: 100 mg ZIF-8 and 250 mg Se powder were placed in two quartz boats respectively, and the quartz boat containing selenium powder was placed upstream of the tube furnace. The mixture was annealed at 650 °C for 2 h in an inert gas at a heating rate of 5 °C / min. After cooling to room temperature, the ZnSe / NHC powder was collected.

[0018] Step 1.3: Synthesis of ZnSe / NHC / Au. Disperse 5 mg of ZnSe / NHC material in 10 mL of water, add 85 μL of 30 mM chloroauric acid and stir for 30 min. Then, add 32.5 mg of sodium citrate, 0.14 mg of tannic acid and 7 mg of potassium carbonate to 150 mL of water. Mix the two solutions evenly and stir in a 70 °C water bath for 10 min. Finally, collect the material by centrifugation with clean water and dry it in a vacuum oven at 60 °C.

[0019] Further, the specific process of step 2 is:

[0020] The DNA sequence data of the specific primers were obtained from Genbank with the sequence number: NC_007788.1. The range of the primers corresponded to 6584-7271 bp of the long-spined sea star sequence with a length of 390 bp. In addition, PCR amplification of the long-spined sea star genomic DNA was performed on a thermal cycler. The PCR amplification steps were as follows: 95°C, 30 s; 60°C, 30 s; 72°C, 30 s, for 35 cycles. After the PCR was completed, a gel electrophoresis experiment was performed and photographed using a gel electrophoresis imaging system.

[0021] Further, in step 3: perform gene sequencing on specific primers, compare the obtained sequences on the NCBI website, determine the number of bases to be compared based on the probe structure to be designed, subdivide the DNA sequence based on the number of bases, and repeat the comparison until the set result is obtained. The bases obtained have the potential to be DNA probes, and then predict the secondary structure of the designed DNA through the website http: / / www.unafold.org. Finally, use sterile TE solution to prepare all oligonucleotide stock solutions, store at -20°C, and dilute as needed during use.

[0022] Further, in step 3, the sequence of primer 1 of the probe is: TACAAGACGCATCTTCCCCC, the sequence of primer 2 of the probe is: CCACTTCTAGTAAGCGGGGC, and the sequence of primer 3 of the probe is: 30 The sequence of P-1 is: GGTTTGTTCTGGAGGCACACACACA30CACACACACATTGCCCCTCTAAAAA, the sequence of SP-1 of the probe is: Bio-TGATTGTTCATATGGTTTCT, and the sequence of Target1 of the probe is: CCTCCAGAACAAACCGGTTCTTTTTAGAGGGGCAAGGACTAGAAACCATATGAACAATCA.

[0023] Further, the specific process of step 4 is:

[0024] First, add 20 μL of 2 mg / mL ZnSe / NHC / Au chitosan dispersion onto the polished glassy carbon electrode. After air drying, add 20 μL of 0.5 μM PA to the electrode surface. 30 The P-1 DNA probe solution was reacted at room temperature for 8 h, and then 10 μL of 1 nM 6-mercapto-1-hexanol was added as a nonspecific signal masking agent. The reaction time was 30 min, and then it was rinsed with sterile water. The prepared electrode was stored at -4 °C for subsequent use;

[0025] Then, a solution of 100 nM biotin-modified signal probe and fixed concentration target DNA was heated to 95°C in a water bath for 10 min, and then rapidly cooled in an ice water bath for 20 min. Then, 20 μL of the premix was added to the assembled electrode and incubated at room temperature for 1.5 h. After the DNA hybridization reaction, 10 μL 1 mg / μL avidin-HRP was added to the electrode surface and incubated for 30 minutes. Finally, it was washed with flushing buffer and electrochemical tests were performed under TMB. The experiment used a ZAHNER electrochemical workstation and a traditional three-electrode system, including an Ag / AgCl reference electrode, a Pt counter electrode and a GCE working electrode. The test methods included the following three: electrochemical impedance spectroscopy, cyclic voltammetry and chronoamperometry. The electrochemical impedance spectroscopy was measured in 5 mM potassium ferrocyanide and potassium ferrocyanide and 0.1 M potassium chloride as electrolytes, an AC voltage of 5 mV, and a voltage frequency of 0.1 Hz to 100 kHz. The scan rate of the cyclic voltammetry method was 50 mV / s, the potential was 0 to 0.5 V, the scan rate of the chronoamperometry method was 30 mV / s, the test time was 120 s, and the value was recorded after the current stabilized.

[0026] It also includes steps such as electrode material characterization, biosensor construction verification, and biosensor performance testing.

[0027] The present invention has the following beneficial effects due to the adoption of the above technical solution:

[0028] (1) The present invention aims to overcome the problem of low sensitivity and poor specificity caused by the one-dimensional linear DNA probe structure that is prone to false positive signals and spatial crowding effects. The present invention has developed an efficient electrochemical biosensor based on a triblock polyA-DNA capture probe to improve the sensitivity and reliability of long-spined sea star eDNA detection. The special capture probe structure improves the detection efficiency, specificity, stability and regeneration of the biosensor. More importantly, the results of offshore tests at the outbreak site of long-spined sea stars in the South China Sea proved that the biosensor has good reliability, providing a novel technology for dynamically monitoring the density of long-spined sea stars in the pre-outbreak stage.

[0029] (2) The constructed electrochemical DNA biosensor adopts an orderly assembly strategy of triblock polyA-DNA probes, which solves the problems of disordered self-assembly layer state of traditional linear probes and further improves the sensitivity, specificity, stability and regeneration of the electrochemical biosensor for the detection of long-spined sea star eDNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 It is a characterization data diagram of the electrode material of the present invention;

[0031] Figure 2It is the electrophoresis analysis diagram of the triblock PAP probe self-assembly and the EIS diagram of the biosensor construction steps of the present invention;

[0032] Figure 3 Graph showing characteristics of the biosensor of the present invention. Figure 4 This is a picture of the on-site distribution monitoring and ecological investigation of the long-spined sea star of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and preferred embodiments. However, it should be noted that many details listed in the specification are only for the purpose of enabling the reader to have a thorough understanding of one or more aspects of the present invention, and these aspects of the present invention can be implemented even without these specific details.

[0034] A method for accurately quantifying the environmental DNA of long-spined sea star on site, comprising the following steps:

[0035] Step 1: ZnSe / NHC / Au electrode material preparation

[0036] 1.1 Synthesis of ZIF-8

[0037] 5.95 g zinc nitrate (Zn(NO 3 ) 2 6H 2 O) was dissolved in 150 mL of methanol, and the resulting solution was poured into 150 mL of 6.16 g of 2-methylimidazole (C 4 H 6 N 2 ) in methanol solution, stirred at room temperature for 24 h, washed with methanol, collected by centrifugation, and dried at 60 °C.

[0038] 1.2 Synthesis of ZnSe / NHC

[0039] 100 mg ZIF-8 and 250 mg Se powder were placed in two quartz boats respectively. The quartz boat containing selenium powder was placed upstream of the tube furnace and annealed at 650 °C for 2 h in an inert gas with a heating rate of 5 °C / min. After cooling to room temperature, the ZnSe / NHC powder was collected.

[0040] 1.3 Synthesis of ZnSe / NHC / Au

[0041] Disperse 5 mg of ZnSe / NHC material in 10 mL of water, add 85 μL of 30 mM chloroauric acid and stir for 30 min. Then, add 32.5 mg of sodium citrate, 0.14 mg of tannic acid and 7 mg of potassium carbonate to 150 mL of water, mix the two solutions evenly, and stir in a 70°C water bath for 10 min. Finally, collect the material by centrifugation with clean water and dry it in a vacuum oven at 60°C.

[0042] Step 2: Design of primers specific for long-spined sea star

[0043] DNA sequence data of specific primers (Table 1, prim1 and prim2) were obtained from Genbank with the sequence number: NC_007788.1. The range of primers corresponds to 6584-7271 bp of the long-spined sea star sequence with a length of 390 bp. In addition, PCR amplification of long-spined sea star genomic DNA was performed on a thermal cycler. The PCR amplification steps were as follows: 95°C, 30 s; 60°C, 30 s; 72°C, 30 s, for 35 cycles. After the PCR was completed, gel electrophoresis experiments were performed and photographed using a gel electrophoresis imaging system.

[0044] Step 3: Design of DNA probe

[0045] First, perform gene sequencing on the specific primers designed above, and compare the obtained sequences on the NCBI website. Determine the number of bases to be compared based on the probe structure you want to design. Subdivide the DNA sequence based on the number of bases, and repeat the comparison until a satisfactory result is obtained. In this case, this segment of bases has the potential to be a DNA probe. Then use the http: / / www.unafold.org website to predict the secondary structure of the designed DNA. The oligonucleotide chain sequence is shown in Table 1 below. Finally, use sterile TE solution to prepare all oligonucleotide stock solutions (100μM), store at -20℃, and dilute as needed during use.

[0046] Table 1 Oligonucleotide sequences

[0047]

[0048] Step 4: Construction of triblock polyA-DNA probe-based biosensor

[0049] First, add 20 μL of 2 mg / mL ZnSe / NHC / Au chitosan dispersion onto the polished glassy carbon electrode. After it is naturally air-dried, add 20 μL of 0.5 μM PA to the electrode surface. 30The P-1 DNA probe solution was reacted at room temperature for 8 h, and then 10 μL 1 nM 6-mercapto-1-hexanol (MCH) was added as a nonspecific signal masking agent for 30 min. It was then rinsed with sterile water and the prepared electrode was stored at low temperature (-4 °C) for subsequent use.

[0050] Then, the solution of 100nM biotin-modified signal probe (SP-1) and a certain concentration of target DNA (Target-1) was heated to 95℃ in a water bath for 10min, and then quickly cooled in an ice water bath for 20min. Then, 20μL of the premix was added to the assembled electrode and incubated at room temperature for 1.5h. After DNA hybridization reaction, 10μL of 1mg / μL avidin-HRP was added to the electrode surface and incubated for 30min. Finally, after washing with rinse buffer, electrochemical testing was performed under TMB (containing hydrogen peroxide). The experiment used a ZAHNER electrochemical workstation and a traditional three-electrode system, including an Ag / AgCl reference electrode, a Pt counter electrode, and a GCE working electrode. The test methods include the following three: electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV), and chronoamperometry (It) for measurement. EIS was measured with 5 mM potassium ferrocyanide and potassium ferrocyanide and 0.1 M potassium chloride as electrolyte, AC voltage of 5 mV, voltage frequency of 0.1 Hz to 100 kHz. The scan rate of CV was 50 mV / s, and the potential was 0 to 0.5 V. The scan rate of IT was 30 mV / s, the test duration was 120 s, and the value was recorded after the current stabilized.

[0051] Step 5: Electrode material characterization

[0052] like Figure 1 As shown in (a), the crystal structure of the ZnSe / NHC / Au electrode material was analyzed by XRD. The main characteristic diffraction peaks of the material correspond well to the characteristic diffraction peaks of ZnSe (JCPDS No.

[0053] 37-1463), and the characteristic peak of face-centered cubic Au (JCPDS No.04-0784) appears near 38°, corresponding to the Au (111) crystal plane. In addition, the EDS element distribution and energy spectrum ( Figure 1 bg) show that the material is composed of Zn, Se, N, C and Au elements, with ZnSe as the core and the remaining elements evenly distributed on the octahedron. The above characterization proves that the ZnSe / NHC / Au electrode material is successfully synthesized. Figure 1 ZnSe / NHC / Au (a) XRD pattern, (b) TEM image, (cg) elemental energy spectra of Zn, Se, N, C and Au.

[0054] Step 6: Biosensor Construction Verification

[0055] First, the self-assembly of polyA-DNA probes was verified by gel electrophoresis. Figure 2 As shown in (a), lanes 1-5 represent PAP, Reporter Probe (RP), Target, Target+RP, and PAP+Target+RP, respectively. Each lane has a different migration rate, which is opposite to the number of their bases. The results show that the triblock polyA-DNA probe structure has been successfully assembled. Subsequently, the preparation process of the biosensor was characterized by EIS. The electrode material ZnSe / NHC / Au was added to the surface of the clean glassy carbon electrode. Figure 2 As shown in (b), ZnSe / NHC / Au exhibits a smaller charge transfer resistance, which is due to the excellent conductivity of the material itself. When the PAP probe is fixed on the electrode, the probe and [Fe(CN) 6 ] 3- / 4- The increase in the electrostatic repulsion between anions increases the negative charge density, resulting in an increase in the EIS signal. When MCH and target DNA / reporter probes are gradually added to the electrode, the negative charge density gradually increases and the impedance gradually increases. The above experimental results show that the biosensor has been successfully prepared. Figure 2 (a) Electrophoresis analysis of triblock PAP probe self-assembly, (b) EIS graph of the biosensor construction steps.

[0056] Step 7: Biosensor Performance Testing

[0057] The analytical performance of the constructed biosensor was evaluated. The current value gradually increased with the increase of target DNA concentration ( Figure 3 a). In the target DNA concentration range of 10fM to 1nM, the current value shows a nonlinear relationship with the target DNA concentration ( Figure 3 b). The nonlinear equation is shown below, and the limit of detection (LOD) is calculated to be 0.32 fM and the LOQ is 1.1 fM (x = x 0 +3δ is used to calculate LOD, x=x 0 +10δ is used to calculate LOQ. 0 is the background signal, δ is x 0 standard deviation of ).

[0058] y=300.9×(x+10.1) 0.47

[0059] In order to verify the stability and regeneration of the biosensor, four electrodes were assembled at one time and stored at 4°C. 1 nM target DNA was measured on the 1st, 3rd, 5th and 10th days, and the relative standard deviation (RSD) of the current values ​​obtained was used to evaluate its stability ( Figure 3 c). The RSD was 2.4%, indicating that the constructed biosensor had good stability and could be prepared in batches and stored at 4°C for further use, thereby simplifying the experimental operation and improving the efficiency of on-site sample detection.

[0060] The probe assembly structure based on polyA is stable and can withstand multiple hybridization melting processes. Therefore, after the electrode test is completed, it is treated with 8M urea to completely denature and melt the double-stranded DNA, and then the electrode surface is rinsed and air-dried before electrochemical testing. Figure 3 As shown in (d), when the modified electrode detects the target DNA, the current value does not change significantly, and a very low blank signal can be obtained after treatment with urea. When the analysis is repeated again, the same level of current signal results can be obtained. The RSDs are 2.8% and 3.5%, respectively, indicating that the biosensor has good reproducibility.

[0061] like Figure 3 As shown in (e), a series of genomic DNA of different species at the same concentration in the habitat of long-spined sea star were selected for control experiments. Compared with the long-spined sea star samples, the detection current values ​​of non-long-spined sea star samples were at low values ​​and had significant differences. It is worth noting that the constructed biosensor can also accurately identify the target DNA in the interfering DNA mixture, and its current intensity is not significantly different from the target DNA detection current intensity. This shows that the method has good selectivity. Figure 3 (a) It curves for detecting a series of target DNA concentrations, (b) calibration curve between current and target DNA concentration, (c) biosensor stability, (d) biosensor reproducibility, (e) biosensor specificity, *<0.05; **<0.01; ***<0.001; NS: Not Significant.

[0062] In order to verify the practicality of the developed biosensor in field detection, field detection of long-spined sea star eDNA samples was carried out at seven sites in the Xisha Islands in the South China Sea ( Figure 4a). The results showed that long-spined sea star eDNA was detected in the surface water samples (5m) of the five coral reefs, with a concentration range of 200 to 3268pM. The highest concentration (3268pM) was at the YY site, where the long-spined sea star ecological survey density was 100ind / ha, higher than the 20ind / ha of GQ (1747pM) and LD (1538pM). This is due to the difference in the abundance of the long-spined sea star population, which caused the difference in eDNA concentration ( Figure 4 b). In addition, according to the results of traditional ecological surveys, no long-spined sea star was observed at the two sites of QF and YL. However, the constructed biosensor can still detect trace amounts of long-spined sea star eDNA concentrations (QF 471pM, YL 200pM). In addition, ZH2, ZH3, and ZH7, as sites without long-spined outbreak records, did not detect long-spined sea star eDNA. All the results were verified by ddPCR technology, indicating that the technology has good accuracy and reliability in practical applications.

[0063] By adopting the orderly assembly strategy of triblock polyA-DNA probes, an accurate and portable electrochemical DNA biosensor was successfully constructed. This sensor solves the problems of disordered self-assembly layer state of traditional linear probes, further improves the sensitivity, specificity, stability and regeneration of electrochemical biosensors for long-spined sea star eDNA detection, and realizes on-site dynamic monitoring of long-spined sea star.

[0064] The constructed electrochemical DNA biosensor adopts an ordered assembly strategy of triblock polyA-DNA probes, which solves problems such as the disordered state of the self-assembly layer of traditional linear probes, and further improves the sensitivity, specificity, stability and regeneration of the electrochemical biosensor for the detection of long-spined sea star eDNA.

[0065] The triblock polyA-DNA probe orderly assembly strategy is adopted to assemble an orderly probe structure in the electrode material ZnSe / NHC / Au, thereby solving the problem of disordered state of the self-assembled layer of the traditional linear probe. However, the electrode material ZnSe / NHC / Au can be replaced by any gold-doped nanomaterial with good conductivity and good biocompatibility (such as MoO 2 / Au, rGO / Au). Therefore, the use of gold-doped nanomaterials with good conductivity and biocompatibility is an alternative.

[0066] The triblock polyA-DNA probe consists of a polyadenine sequence in the middle and flanking capture probes (PAP) at both ends. First, the polyA fragment is anchored on the surface of the electrode material through the strong adsorption force between it and the Au nanoparticles. Then, by adding MCH solution, nonspecific adsorption is prevented. At the same time, the capture probe binds to the target DNA through specific hybridization on the electrode surface. The biotin-labeled signal probe (SP) then binds to the target DNA and captures avidin-HRP in the presence of H 2 O 2 The electrochemical catalytic signal was generated in the TMB solution.

[0067] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for accurately quantifying the environmental DNA of long-spined sea star on site, characterized in that: The method comprises the following steps: Step 1: Preparation of ZnSe / NHC / Au electrode materials; Step 2: Design of primers specific for long-spined sea star; Step 3: Design of DNA probe; Step 4: Construction of triblock polyA-DNA probe-based biosensor.

2. The method for accurately quantifying the environmental DNA of long-spined sea star on site according to claim 1, characterized in that: The specific process of step 1 is: Step 1.1: Synthesis of ZIF-8: Dissolve 5.95 g zinc nitrate in 150 mL methanol, pour the resulting solution into 150 mL methanol solution containing 6.16 g 2-methylimidazole, stir at room temperature for 24 h, wash with methanol, collect the sample by centrifugation, and dry at 60 °C; Step 1.2: Synthesis of ZnSe / NHC: 100 mg ZIF-8 and 250 mg Se powder were placed in two quartz boats respectively, and the quartz boat containing selenium powder was placed upstream of the tube furnace. The mixture was annealed at 650 °C for 2 h in an inert gas at a heating rate of 5 °C / min. After cooling to room temperature, the ZnSe / NHC powder was collected. Step 1.3: Synthesis of ZnSe / NHC / Au. Disperse 5 mg of ZnSe / NHC material in 10 mL of water, add 85 μL of 30 mM chloroauric acid and stir for 30 min. Then, add 32.5 mg of sodium citrate, 0.14 mg of tannic acid and 7 mg of potassium carbonate to 150 mL of water. Mix the two solutions evenly and stir in a 70 °C water bath for 10 min. Finally, collect the material by centrifugation with clean water and dry it in a vacuum oven at 60 °C.

3. The method for accurately quantifying the environmental DNA of long-spined sea star on site according to claim 1, characterized in that: The specific process of step 2 is: The DNA sequence data of the specific primers were obtained from Genbank with the sequence number: NC_007788.

1. The range of the primers corresponded to 6584-7271 bp of the long-spined sea star sequence with a length of 390 bp. In addition, PCR amplification of the long-spined sea star genomic DNA was performed on a thermal cycler. The PCR amplification steps were as follows: 95°C, 30 s; 60°C, 30 s; 72°C, 30 s, for 35 cycles. After the PCR was completed, a gel electrophoresis experiment was performed and photographed using a gel electrophoresis imaging system.

4. The method for accurately quantifying the environmental DNA of long-spined sea star on site according to claim 1, characterized in that: In step 3: perform gene sequencing on specific primers, compare the obtained sequences on the NCBI website, determine the number of bases to be compared based on the probe structure you want to design, subdivide the DNA sequence based on the number of bases, and repeat the comparison until the set result is obtained. The bases obtained have the potential to be DNA probes, and then predict the secondary structure of the designed DNA through the website http: / / www.unafold.org. Finally, use sterile TE solution to prepare all oligonucleotide stock solutions, store them at -20°C, and dilute them as needed during use.

5. The method for accurately quantifying the environmental DNA of long-spined sea star on site according to claim 1, characterized in that: In step 3, the sequence of primer 1 of the probe is: TACAAGACGCATCTTCCCCC, the sequence of primer 2 of the probe is: CCACTTCTAGTAAGCGGGGC, and the sequence of primer 2 of the probe is: 30 The sequence of P-1 is: GGTTTGTTCTGGAGGCACACACACA30CACACACACATTGCCCCTCTAA AAA, the sequence of SP-1 of the probe is: Bio-TGATTGTTCATATGGTTTCT, and the sequence of Target1 of the probe is: CCTCCAGAACAAACCGGTTCTTTTTAGAGGGGCAAGGACTAGAAACCAT ATGAACAATCA.

6. The method for accurately quantifying the environmental DNA of long-spined sea star on site according to claim 1, characterized in that: The specific process of step 4 is: First, add 20 μL of 2 mg / mL ZnSe / NHC / Au chitosan dispersion onto the polished glassy carbon electrode. After air drying, add 20 μL of 0.5 μM PA to the electrode surface. 30 The P-1 DNA probe solution was reacted at room temperature for 8 h, and then 10 μL of 1 nM 6-mercapto-1-hexanol was added as a nonspecific signal masking agent. The reaction time was 30 min, and then it was rinsed with sterile water. The prepared electrode was stored at -4 °C for subsequent use; Then, a solution of 100 nM biotin-modified signal probe and fixed concentration target DNA was heated to 95°C in a water bath for 10 min, and then rapidly cooled in an ice water bath for 20 min. Then, 20 μL of the premix was added to the assembled electrode and incubated at room temperature for 1.5 h. After the DNA hybridization reaction, 10 μL 1 mg / μL avidin-HRP was added to the electrode surface and incubated for 30 minutes. Finally, it was washed with flushing buffer and electrochemical tests were performed under TMB. The experiment used a ZAHNER electrochemical workstation and a traditional three-electrode system, including an Ag / AgCl reference electrode, a Pt counter electrode and a GCE working electrode. The test methods included the following three: electrochemical impedance spectroscopy, cyclic voltammetry and chronoamperometry. The electrochemical impedance spectroscopy was measured in 5 mM potassium ferrocyanide and potassium ferrocyanide and 0.1 M potassium chloride as electrolytes, an AC voltage of 5 mV, and a voltage frequency of 0.1 Hz to 100 kHz. The scan rate of the cyclic voltammetry method was 50 mV / s, the potential was 0 to 0.5 V, the scan rate of the chronoamperometry method was 30 mV / s, the test time was 120 s, and the value was recorded after the current stabilized.

Images