Bacillus with mdr gene knocked out and application thereof

Abstract

The invention provides bacillus with a knockout mdr gene and application of the bacillus with the knockout mdr gene, the bacillus with the knockout mdr gene is obtained by guiding a knockout vector into original bacillus to knock out the mdr gene, and the original bacillus is bacillus amyloliquefaciens XH7 or bacillus licheniformis XZ3; the amino acid sequence of the mdr gene encoded in bacillus amyloliquefaciens is as shown in SEQ ID NO. 1, and the amino acid sequence of the mdr gene encoded in bacillus licheniformis is as shown in SEQ ID NO. 2. The recombinant plasmid with the mdr gene knocked out is designed and synthesized for the first time, the recombinant plasmid is transferred into bacillus to promote production of inosinic acid, and a new strategy is provided for increasing the yield of inosinic acid. Compared with bacillus amyloliquefaciens XH7 or bacillus licheniformis XZ3, the inosinic acid yield of the recombinant bacillus XH7 mdr or XZ3 mdr constructed by the invention is at least increased by 75.47% or above.

Description

Technical Field

[0001] The invention belongs to the technical field of biological gene engineering, and in particular relates to a mdr gene knocked out bacillus and application thereof. Background Art

[0002] Inosine 5'-monophosphate (IMP), also known as inosine nucleotide or inosinic acid, is a nucleotide found in ribonucleic acid (RNA). IMP is an aromatic heterocyclic compound, consisting of a heterocyclic structure of a 6-hydroxypurine nucleus, a ribose group and a phosphate group. Its chemical structure is: Inosinic acid is unstable at room temperature, so it is generally stored at -20°C. However, disodium inosinate is relatively stable, a colorless or white fine crystalline powder, odorless, containing about 7.5 molecules of crystal water, not easy to absorb moisture, easily soluble in water, starts to lose crystal water at 40°C, and becomes anhydrous above 120°C. IMP in the crystalline state has good stability and is stable in aqueous and alkaline solutions, but has poor stability in acidic solutions (pH < 4), is easily degraded by heating, is slightly soluble in ethanol, and has very low solubility in ethanol or other organic solvents.

[0003] As the core molecule of purine biosynthesis, inosinic acid is the substrate for conversion into other purine nucleotides and is also an important flavor substance. IMP is an important flavor substance in livestock and poultry meat and can be used as a flavor enhancer for food. If used as a food additive together with sodium glutamate, the flavor will be several times stronger. In medicine, inosinic acid can also be used to treat various leukopenia, liver cirrhosis, and heart disease.

[0004] So far, several methods have been developed to produce IMPs, mainly including: ① RNA fragmentation and nucleotide extraction; ② chemical phosphorylation of inosine; ③ production of IMPs by fermentation. The most widely used method is the third method of producing IMPs by microbial fermentation, but this method not only depends on the ability of microorganisms to synthesize IMPs, but more importantly, it evaluates their ability to secrete IMPs into the culture medium, so it also has certain limitations.

[0005] The major facilitator superfamily (MFS) is ubiquitous in eukaryotes, bacteria and archaea, and its sequence is conservative. The MFS family can promote the transport of small molecules such as drug molecules, nucleotides, polypeptides and oligosaccharides. They are not only involved in a variety of physiological activities such as material exchange and signal transduction, but are also inseparable from the resistance caused by the active efflux of various toxic compounds (including drugs such as antibiotics and bactericides and secondary metabolites). The gene mdr in Bacillus encodes the MFS superfamily transporter, but the direction of the protein transport material is uncertain and there is no literature report. Therefore, the present invention has carried out research in this regard, and finally found that after knocking out the gene mdr in Bacillus, the inosinic acid production of Bacillus can be greatly increased. Summary of the invention

[0006] The purpose of the present invention is to explore a method for producing a large amount of inosinic acid by fermentation, and further provide a recombinant plasmid and its application in preparing inosinic acid.

[0007] In order to achieve the above technical objectives, the technical solutions adopted in this application are as follows:

[0008] In a first aspect, the present invention provides a mdr gene knocked out Bacillus, wherein the mdr gene knocked out Bacillus is obtained by introducing a knockout vector into an original Bacillus to knock out the mdr gene, and the original Bacillus is Bacillus amyloliquefaciens XH7 or Bacillus licheniformis XZ3; the amino acid sequence encoded by the mdr gene in Bacillus amyloliquefaciens is shown in SEQ ID NO.1, and the amino acid sequence encoded by the mdr gene in Bacillus licheniformis is shown in SEQ ID NO.2.

[0009] Preferably, the mdr gene sequence knocked out in Bacillus amyloliquefaciens XH7 is shown as SEQ ID NO.3, and the mdr gene sequence knocked out in Bacillus licheniformis XZ3 is shown as SEQ ID NO.4.

[0010] Preferably, the knockout vector is T2(2)-ori.

[0011] In a second aspect, the present invention provides a method for preparing the mdr gene-knocked Bacillus according to the first aspect, comprising:

[0012] Step 1, using genomic DNA of Bacillus amyloliquefaciens or Bacillus licheniformis as a template, respectively using an upstream homology arm amplification primer pair and a downstream homology arm amplification primer pair to perform PCR amplification to obtain an upstream homology arm fragment and a downstream homology arm fragment;

[0013] Step 2, connecting the upstream homology arm fragment with the downstream homology arm fragment to obtain complete upstream and downstream homology arms;

[0014] Step 3, performing inverse PCR amplification on the gene knockout plasmid to obtain a linear plasmid fragment;

[0015] Step 4, recombining the complete upstream and downstream homology arms and the linear plasmid fragment by seamless cloning enzyme to obtain a recombinant product;

[0016] Step 5, the recombinant product is transformed into Escherichia coli DH5α, kanamycin is used as a resistance screening marker, and colony PCR is performed to obtain positive transformants and extract the knockout plasmid;

[0017] Step 6, the knockout plasmid is transferred into Bacillus amyloliquefaciens XH7 or Bacillus licheniformis XZ3, and kanamycin is used as a resistance screening marker to screen and obtain positive transformant 2, and further single-double exchange homologous recombination is performed to obtain the Bacillus with the mdr gene knocked out.

[0018] Preferably, in the step 1, the sequences of the upstream homology arm amplification primer pair using the genomic DNA of Bacillus amyloliquefaciens XH7 as a template are shown as SEQ ID NO.11 and SEQ ID NO.12, respectively, and the downstream homology arm amplification primer pair are shown as SEQ ID NO.13 and SEQ ID NO.14, respectively; preferably, the nucleotide sequences of the upstream homology arm fragment and the downstream homology arm fragment are shown as SEQ ID NO.5 and SEQ ID NO.6;

[0019] Alternatively, in step 1, the sequences of the upstream homology arm amplification primer pair using the genomic DNA of Bacillus licheniformis XZ3 as a template are respectively shown as SEQ ID NO.21 and SEQ ID NO.22, and the sequences of the downstream homology arm amplification primer pair are respectively shown as SEQ ID NO.23 and SEQ ID NO.24; preferably, the nucleotide sequences of the upstream homology arm fragment and the downstream homology arm fragment are shown as SEQ ID NO.8 and SEQ ID NO.9.

[0020] Preferably, in step 2, the upstream homology arm and the downstream homology arm are connected by SOE-PCR; preferably, the primer pair sequences used by the SOE-PCR method for Bacillus amyloliquefaciens XH7 are shown in SEQ ID NO.11 and SEQ ID NO.14, and the obtained complete upstream and downstream homology arm sequences are shown in SEQ ID NO.7;

[0021] Alternatively, the primer pair sequences used in the SOE-PCR method for Bacillus licheniformis XZ3 are shown in SEQ ID NO.19 and SEQ ID NO.22, and the obtained complete upstream and downstream homology arm sequences are shown in SEQ ID NO.10.

[0022] In a third aspect, the present invention provides use of the mdr gene knocked out Bacillus described in the first aspect in preparing inosinic acid.

[0023] In a fourth aspect, the present invention provides a method for preparing inosinic acid, comprising the following steps:

[0024] Step 1), activating and culturing the mdr gene-knocked Bacillus, and then performing seed culture;

[0025] Step 2), fermenting the bacterial solution after the seed culture to obtain inosinic acid.

[0026] Preferably, the activation culture comprises: inoculating the mdr gene knocked-out Bacillus into LB culture medium at a volume percentage of 1-5%, and culturing at 200-250 r / min and a temperature of 37±1° C. for 10-15 h; and / or,

[0027] The seed culture comprises: inoculating the activated bacterial solution into the seed culture medium at a volume percentage of 1-5% and then culturing at 200-250 r / min and a temperature of 37±1° C. for 10-15 hours;

[0028] Further preferably, the culture medium used for the seed culture comprises the following components: 1.0-2.0% tryptone, 0.5-1.0% yeast extract, 0.5-1.0% NaCl, 2.5-3.0% glucose, and the remainder is sterile water.

[0029] Preferably, the control conditions of the fermentation culture include: the bacterial liquid of the seed culture is inoculated into the fermentation medium at an inoculation rate of 2-4%, and the fermentation culture is carried out at 200-250r / min and a temperature of 37±1°C for 70-75h;

[0030] Further preferably, the fermentation medium consists of: 0.5% yeast powder, 0.08-0.2% sodium citrate, 1.5-2.0% ammonium sulfate, 0.2-0.3% potassium dihydrogen phosphate, 0.2-0.3% magnesium sulfate heptahydrate, 0.0004-0.0005% manganese sulfate, 2-3% glucose, 1.5-2.0% calcium carbonate, and the balance is sterile water.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention is the first to design and synthesize a recombinant plasmid with the mdr gene knocked out, and transfer the recombinant plasmid into Bacillus to promote inosinic acid production, providing a new strategy for increasing the inosinic acid yield. Compared with Bacillus amyloliquefaciens XH7 or Bacillus licheniformis XZ3, the inosinic acid yield of the recombinant Bacillus XH7△mdr or XZ3△mdr constructed by the present invention is at least increased by 75.47%. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 The figure is an agarose gel image of the upstream homology arm, downstream homology arm, upstream and downstream homology arms and linear plasmid fragment obtained in steps (1), (2) and (3) in Example 1; wherein lane 1 is the upstream homology arm, lane 2 is the downstream homology arm, lane 3 is the upstream and downstream homology arms, lane 4 is the linearized plasmid, and lane 5 is the DNA marker.

[0034] Figure 2 This is a colony PCR verification diagram of the knockout plasmid T2-△mdr(Ba) obtained in step (4) of Example 1; wherein lane 1 is the band of colony PCR verification of the knockout plasmid T2-△mdr(Ba), and lane 2 is a DNA marker.

[0035] Figure 3 The figure shows the colony PCR verification of the positive transformant XH7 / T2-△mdr(Ba) obtained in step (5) of Example 1, the recombinant strain XH7△mdr after single-double exchange homologous recombination, and the control strain XH7; wherein lane 1 is the band of colony PCR verification of the positive transformant XH7 / T2-△mdr(Ba), lane 2 is the band of colony PCR verification of the recombinant strain XH7△mdr after single-double exchange homologous recombination, lane 3 is the band of colony PCR verification of the control strain XH7, and lane 4 is a DNA marker.

[0036] Figure 4 The figure is an agarose gel image of the upstream homology arm, downstream homology arm, upstream and downstream homology arms and linear plasmid fragment obtained in steps (1), (2) and (3) in Example 2; wherein lane 1 is the upstream homology arm, lane 2 is the downstream homology arm, lane 3 is the upstream and downstream homology arms, lane 4 is the linearized plasmid, and lane 5 is the DNA marker.

[0037] Figure 5 This is a colony PCR verification diagram of the knockout plasmid T2-△mdr (Bl) obtained in step (4) of Example 2; wherein lane 1 is the band of colony PCR verification of the knockout plasmid T2-△mdr (Bl), and lane 2 is a DNA marker.

[0038] Figure 6The colony PCR verification diagram of the positive transformant XZ3 / T2-△mdr (Bl) obtained in step (5) of Example 2, the recombinant strain XZ3△mdr after single-double exchange homologous recombination, and the control strain XZ3; wherein, lane 1 is the band of colony PCR verification of the positive transformant XZ3 / T2-△mdr (Bl), lane 2 is the band of colony PCR verification of the recombinant strain XZ3△mdr after single-double exchange homologous recombination, lane 3 is the band of colony PCR verification of the control strain XZ3, and lane 4 is a DNA marker;

[0039] Figures 1 to 6 In the figure, the molecular weights of the bands from top to bottom in the DNA marker lane are: 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, and 100bp. DETAILED DESCRIPTION

[0040] In the description of the present invention, it should be noted that, if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0041] To facilitate understanding of the present invention, the present invention will be described more comprehensively and in detail below in conjunction with embodiments, but the protection scope of the present invention is not limited to the following specific embodiments.

[0042] Unless otherwise defined, all professional terms used below have the same meanings as those generally understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0043] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, which are intended to explain the present invention rather than to limit it.

[0044] Embodiment 1:

[0045] The method for constructing a recombinant Bacillus amyloliquefaciens XH7△mdr with knockout gene mdr comprises:

[0046] (1) Based on the gene mdr and its upstream and downstream gene sequences in the genomic DNA sequence of Bacillus amyloliquefaciens XH7, an upstream homology arm amplification primer pair (△mdr-F1, △mdr-R1) and a downstream homology arm amplification primer pair (△mdr-F2, △mdr-R2) for knocking out the gene mdr were designed; and using the genomic DNA of Bacillus amyloliquefaciens XH7 as a template, PCR amplification was performed using the upstream homology arm amplification primer pair and the downstream homology arm amplification primer pair to obtain the upstream homology arm and downstream homology arm fragments (549 bp and 613 bp, respectively, the upstream homology arm DNA sequence is shown in SEQ ID NO.5, and the downstream homology arm DNA sequence is shown in SEQ ID NO.6);

[0047] The amino acid sequence encoded by the mdr gene in Bacillus amyloliquefaciens is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.3;

[0048] SEQ ID NO.1:

[0049]

[0050] SEQ ID NO.3:

[0051]

[0052] SEQ ID NO.5:

[0053] CCATAATGTCCGTCACTTTTTTGAGAAAATCGAATATCAGATGCAGTTCTTCTTCTTTATATTGCCGGCAAAGGCTGACCGTGGACTGGGATAAGGAGCTGAACAATTGCTTCACATTCGCTTTTCCCGCTGTCATCGGCACAATGATCACCCGCCGTTTGTCTTCGGGATCTTTTTTCCTCATGACATATCCCGCTTTTTCAAGCCGGTCAATGAGCGCCGTTACCGAGCCTGTGCTGAGGCCGGTTTTTTTCCCAAGCTCACCCGCGGTCATCGGGCCTGCTTCATTTAAAATATCAGCTGATTTCAAATCGGTCGGAAACAGACCGAGAGATTGAGCGGCCGCCTGATGAAAAAGGATCGTCCTTGTGGCCATCTTCCGGAATAACTGTATGGCGGTTTCCTCCGTCTCGCTTCTGGTATTTCTTGTTGACAACTGACAGGCCTCCCTATAAAATCAATTTATCTTGACGATCAAGATAATTTTCGGCAAATCTAATATGATCATAGCAAATTTAATGATCAAAAGTAAGTATAGGAGGAAAAAGC;

[0054] SEQ ID NO.6:

[0055] TTACTCTGCAAAATGCGGAGCGAGAATATCTTTCAGCACGTTTGCGCTGCGGCTGAATTGAGCCTGTTCTGTTTCATTCAGCTCAAGTTCCGCCACACCGGCGATGCCGTTCCGATTGACGATGGCCGGAATGCCGATAAAGACGTCGTTGACTCCGTATTGCCCGTCCAAATATGTGCTGACGGTTAGAATGCTGTTTTCATTACGCAAAATCGCTTTTGTGATGCGGGCGAGGCTCATCGCCACTCCGTAATATGTCGCGCCTTTTTTCTCAATAATATGGTAGGCCGCGTTTTTCACATCTTCAACGATCTGATCCAGCTCGTCCTGCTTGTAAGCTGCATTTTTCTCCAGTAATTGCTGCACCGGCACTCCGCCGATATTGGCGTGGCTCCATACAGGAAGCTCGGTATCTCCGTGCTCGCCGATAATGTGGGCGTGTACGTTTTGCGGGGCGGCGCCGAAGTATTCACTCAGCATATAACGGAATCTCGCAGAATCAAGTGTCGTACCGCTGCCGATGACGCGTTCTTTCGGCAGGCCGCTGAATTTCCACGTCGCATAAGTAAGAATATCGACCGGGTTTGTGGCAACGAGGAAGATGCCGTCAAAT;

[0056] The sequences of △mdr-F1, △mdr-R1 and △mdr-F2, △mdr-R2 are as follows:

[0057] △mdr-F1: CTGCAGCCCGGGGGATCCCCATAATGTCCGTCACTT (SEQ ID NO.11),

[0058] △mdr-R1: CCGCATTTTGCAGAGTAAGCTTTTTCCTCCTATACT (SEQ ID NO.12),

[0059] △mdr-F2: AGTATAGGAGGAAAAAGCTTACTCTGCAAAATGCGG (SEQ ID NO.13),

[0060] △mdr-R2:GATCTTTTCTACGAGCTCATTTGACGGCATCTTCCT (SEQ ID NO. 14);

[0061] (2) The upstream homology arm and the downstream homology arm were then connected together by SOE-PCR (the primers used were △mdr-F1 and △mdr-R2) to obtain the complete upstream and downstream homology arms for knockout (1162 bp, the sequence is shown in SEQ ID NO.7);

[0062] SEQ ID NO.7:

[0063]

[0064] (3) Performing inverse PCR amplification on plasmid T2(2)-ori to obtain a linear plasmid fragment (4242 bp);

[0065] The product of (3) was verified by agarose gel imaging. Figure 1 As shown;

[0066] The primer sequences used in step (3) PCR amplification are:

[0067] T2-GF: GGATCCCCCGGGCTGCAGGAATTC (SEQ ID NO. 15);

[0068] T2-GR:GAGCTCGTAGAAAAGATCAAAGGA (SEQ ID NO. 16);

[0069] (4) The upstream and downstream homology arms and the linear plasmid fragments obtained in steps (2) and (3) are recombined by seamless cloning enzyme to obtain a circular recombinant product, the connection mode of which is: linear backbone + upstream homology arm + downstream homology arm + linear backbone (the same as the recombinant product of Example 2); the recombinant product is transformed into Escherichia coli DH5α by calcium chloride transformation method, and screened at 37°C in a medium containing kanamycin resistance to obtain transformants, which are verified by colony PCR (primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band appears at 1466bp, it means that the knockout plasmid is successfully constructed, and the above transformant is a positive transformant (named: knockout plasmid T2-△mdr (Ba)); the result is as follows Figure 2 As shown, the knockout plasmid was successfully constructed.

[0070] T2-F: ATGTGATAACTCGGCGTA (SEQ ID NO. 17),

[0071] T2-R: GCAAGCAGCAGATTACGC (SEQ ID NO. 18);

[0072] (5) The knockout plasmid T2-△mdr(Ba) was transformed into Bacillus amyloliquefaciens XH7 by electroporation, and the transformants were screened at 37°C in a medium containing kanamycin resistance. The transformants were verified by colony PCR (primers used were: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band appears at 1466bp, it proves that the knockout plasmid T2-△mdr(Ba) was successfully transformed into Bacillus amyloliquefaciens XH7. At this time, the transformant is a positive transformant, that is, Bacillus amyloliquefaciens XH7 that has been transformed with the knockout plasmid T2-△mdr(Ba) is further transformed by single-double exchange homologous recombination (the homologous recombination method refers to the paper: Knocking out the amino acid transporter gene yhdG in Bacillus licheniformis DW2 to improve bacitracin production The recombinants were screened by PCR (primers used were △mdr-YF(Ba) and △mdr-YR(Ba)). If the PCR verification result of the recombinant was: an electrophoresis band appeared at 1285 bp, it indicated that the knockout recombinant strain was successfully constructed, and the recombinant strain Bacillus amyloliquefaciens XH7△mdr was obtained. Figure 3 As shown, the knockout recombinant strain was successfully constructed.

[0073] △mdr-YF(Ba):ATTGGCTTCCTCCTCATT(SEQ ID NO.19),

[0074] Δmdr-YR(Ba):AAAAGCATTGTCGGTGAAG (SEQ ID NO. 20).

[0075] Embodiment 2:

[0076] The method for constructing a recombinant Bacillus licheniformis XZ3△mdr with knocked-out gene mdr comprises:

[0077] (1) Based on the gene mdr and its upstream and downstream gene sequences in the genomic DNA sequence of Bacillus licheniformis XZ3, an upstream homology arm amplification primer pair (△mdr-F3, △mdr-R3) and a downstream homology arm amplification primer pair (△mdr-F4, △mdr-R4) for knocking out the gene mdr were designed; and the genomic DNA of Bacillus licheniformis XZ3 was used as a template, and PCR amplification was performed using the upstream homology arm amplification primer pair and the downstream homology arm amplification primer pair to obtain the upstream homology arm and downstream homology arm fragments (534 bp and 623 bp, respectively, the upstream homology arm DNA sequence is shown in SEQ ID NO.8, and the downstream homology arm DNA sequence is shown in SEQ ID NO.9);

[0078] The amino acid sequence encoded by the mdr gene in Bacillus licheniformis is shown in SEQ ID NO.2, and the nucleotide sequence is shown in SEQ ID NO.4;

[0079] SEQ ID NO.2:

[0080]

[0081] SEQ ID NO.4:

[0082]

[0083] SEQ ID NO.8:

[0084] TCCTCCTCTGAATATCGGCTTAAAAATCCGGCAGATTCTTGCGCCAAGTCTTGAAAGATACGAGAGATCTTCTCCAGGTTTTCCGGGATCAGCTCGACTAAAAGACGCCTTCTGTCGGACGAATCCCTGATGCGTCTGACATAGCCCGTTTTCTCAAGGCGGTCGATCACGCCTGTGATCGCTCCCGTTGTCAGCCCGCTTTTTGCGGCAAGCTCCCCCGCTGTTACTTTACCTTCCCGCGAGATGATCTCAAGGCATTTATGATCTGTTGCGTTCAGTCCGATTTTCTCGCCGATCGCCTCGTGCAGAAAAATGGTTGCGGTGCTGTGAAACCTCAACTGCTGTATCAGCTCGTTGAGCAGCCCTTCTCCTTCAATATGATTTGTTCTTGACATCGGCAACACCCTTCTATAAAATCATTATGTCTTAGCAGCTAAGATATTTATTTCCTGATATAAATGATCATAACAGGATGAAGCGTCCATGCCAAACGCTGCTTTAGAACGAATTTATTTAAAAGGAGAATAGATTGAT;

[0085] SEQ ID NO.9:

[0086] CTAGCTTTGCAAAGCTTTCTTTTTTCTCATTTTCGAAATCAATAAAAGCGGAATCGGCACAATGCCGAATAAAACAGCCGCTTGATAGCCGATCATGTCGCCGAGAGAAAATACATCATCGATATTTTTTGGCGTCATTGCGAGCAAATACATCACCGGAAGCAGACCGAACATGATCGGTCTGCTCTTTTTTTTGAAAATTTGCGAGAGCCCCAGGGATGCAGCGTAAAATGAGACAGAAAAAGTCGCAAACAGCTGCATAATCCAGATGACAAGGAGCAGCGATTCAAAACGTTCAAATATTAAGCCGGGCATCTCAAAACTGCGGATCAGGTTAAGCGTCGGCCATGTCATCGCGGTCACCCCGTCAACCGACAGCCCCCCGATCACGAATACGACCGTTGTTAAGTAAAAGAGCATTGCGATGCCGATTCCCATGACAGCGACTTTGACACCATCTTTCGGCTTTTTCATAAACGCCAAAAGGAACACCATCACCTCTGCGCTGATGAACGAAAGCGTTGTCGCTTTTGTCCCCTTTATTGCCGGCATGATGCCTTTCCCAAGGACTGGCCGCAGATTATCCAGTTCAAATATGCCAAAGCTCATAAATACGACGGTTA;

[0087] The sequences of △mdr-F3, △mdr-R3 and △mdr-F4, △mdr-R4 are as follows:

[0088] △mdr-F3: CTGCAGCCCGGGGGATCCTCCTCCTCTGAATATCGG (SEQ ID NO.21),

[0089] △mdr-R3: GAAAGCTTTGCAAAGCTAGATCAATCTATTCTCCTTT (SEQ ID NO.22),

[0090] △mdr-F4: AAAGGAGAATAGATTGATCTAGCTTTGCAAAGCTTTC (SEQ ID NO.23),

[0091] △mdr-R4:GATCTTTTCTACGAGCTCTAACCGTCGTATTTATGAGC (SEQ ID NO. 24);

[0092] (2) The upstream homology arm and the downstream homology arm were then connected together by SOE-PCR (the primers used were △mdr-F3 and △mdr-R4) to obtain the complete upstream and downstream homology arms for knockout (1157 bp, the sequence is shown in SEQ ID NO.10);

[0093] SEQ ID NO.10:

[0094]

[0095] (3) Performing inverse PCR amplification on plasmid T2(2)-ori to obtain a linear plasmid fragment (4242 bp);

[0096] The product of (3) was verified by agarose gel imaging. Figure 4 As shown;

[0097] The primer sequences used in step (3) PCR amplification are:

[0098] T2-GF: GGATCCCCCGGGCTGCAGGAATTC (SEQ ID NO. 15);

[0099] T2-GR:GAGCTCGTAGAAAAGATCAAAGGA (SEQ ID NO. 16);

[0100] (4) The upstream and downstream homology arms and the linear plasmid fragments obtained in steps (2) and (3) are recombined by seamless cloning enzyme to obtain a recombinant product; the recombinant product is transformed into Escherichia coli DH5α by calcium chloride transformation method, and screened at 37°C in a medium containing kanamycin resistance to obtain transformants, and the transformants are verified by colony PCR (primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band appears at 1461bp, it means that the knockout plasmid is successfully constructed, and the above transformant is a positive transformant (named: knockout plasmid T2-△mdr (Bl)); the result is as follows Figure 5 As shown, the knockout plasmid was successfully constructed.

[0101] T2-F: ATGTGATAACTCGGCGTA (SEQ ID NO. 25),

[0102] T2-R: GCAAGCAGCAGATTACGC (SEQ ID NO. 26);

[0103] (6) The knockout plasmid T2-△mdr (Bl) was transformed into Bacillus licheniformis XZ3 by electroporation, and the transformants were screened at 37°C in a medium containing kanamycin resistance. The transformants were verified by colony PCR (primers used were: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoresis band appears at 1461bp, it proves that the knockout plasmid T2-△mdr (Bl) was successfully transformed into Bacillus licheniformis XZ3. At this time, the transformant is a positive transformant, that is, Bacillus licheniformis XZ3 that has been transformed with the knockout plasmid T2-△mdr (Bl) is further transformed by single-double exchange homologous recombination (the homologous recombination method refers to the paper: Knocking out the amino acid transporter gene yhdG in Bacillus licheniformis DW2 to improve bacitracin production). , Li Yang et al., Journal of Biotechnology. 2018, 34(06), DOI: 10.13345 / j.cjb.170500) screened the recombinants and verified them by colony PCR (primers used were: △mdr-YF(Bl) and △mdr-YR(Bl)). If the PCR verification result of the recombinant was: an electrophoresis band appeared at 1388bp, it indicated that the knockout recombinant strain was successfully constructed and the recombinant strain Bacillus licheniformis XZ3△mdr was obtained. The results are as follows Figure 6 As shown, the knockout recombinant strain was successfully constructed.

[0104] △mdr-YF(Bl):CTGATATGGGCGGTGGTG(SEQ ID NO.27),

[0105] Δmdr-YR(Bl):GCTTGCCCGTTTATTTGA (SEQ ID NO. 28).

[0106] Embodiment 3:

[0107] The use of recombinant Bacillus amyloliquefaciens XH7△mdr or recombinant Bacillus licheniformis XZ3△mdr in the production of inosinic acid comprises the following steps:

[0108] 1) The specific steps of obtaining the seed solution are as follows: firstly, Bacillus amyloliquefaciens XH7△mdr or Bacillus licheniformis XZ3△mdr is activated respectively, that is, 1% by volume is inoculated from a glycerol tube into 5 mL of LB medium, and cultured at 230 r / min and 37° C. for 12 hours, and then the bacterial solution after the activation of the strain is inoculated into the seed medium at an inoculum amount of 1% by volume, and then cultured at 230 r / min and 37° C. for 12 hours to obtain a seed culture bacterial solution;

[0109] The formula of the seed culture medium is 1% tryptone, 0.5% yeast extract, 1% NaCl, 2.5% glucose, natural pH;

[0110] 2) 20 mL of fermentation medium of different formulations (specific formulations are shown in Table 1, and the pH of the fermentation medium in Table 1 is natural) was added to a 250 mL conical flask, and then the seed culture solution was inoculated with an inoculum amount of 3% (volume percentage), and the rotation speed was 230 r / min, the temperature was 37° C., and the fermentation culture was carried out for 72 hours.

[0111] The original Bacillus amyloliquefaciens XH7 or the original Bacillus licheniformis XZ3 fermented in the same way to produce inosinic acid was used as a control.

[0112] The production of inosinic acid was measured by high performance liquid chromatography (HPLC). The specific steps were as follows: the fermentation broth was placed in a 10 mL centrifuge tube, boiled in water for 15 minutes, centrifuged at 12000 r / min for 5 minutes, and the supernatant was taken. Accurately measure 5 mL of the supernatant in a 25 mL volumetric flask, dilute with deionized water, stir on a magnetic stirrer for 5 minutes, centrifuged at 12000 r / min for 5 minutes, take the supernatant, filter with a 0.22 μm water system microporous filter membrane, and the filtrate was used for HPLC determination. The production of inosinic acid in the fermented bacterial broth was calculated according to the HPLC method (see Table 2 and Table 3).

[0113] Table 1

[0114]

[0115]

[0116] Table 2

[0117]

[0118] Table 3

[0119]

[0120] It can be seen from Table 2 and Table 3 that under the same fermentation conditions, the inosinic acid production in the fermentation culture liquid using the recombinant Bacillus amyloliquefaciens XH7△mdr or the recombinant Bacillus licheniformis XZ3△mdr of the present invention is greatly improved (increased by more than 75.47%) compared with the control bacteria, indicating that the technical solution of the present invention has great application value in improving the inosinic acid production of Bacillus.

[0121] The research results of the present invention show that knocking out the mdr gene to increase the production of inosinic acid is a very effective method.

[0122] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A Bacillus with an mdr gene knocked out, characterized in that: The mdr gene knocked out Bacillus is obtained by introducing a knockout vector into an original Bacillus to knock out the mdr gene, and the original Bacillus is Bacillus amyloliquefaciens XH7 or Bacillus licheniformis XZ3; the amino acid sequence encoded by the mdr gene in Bacillus amyloliquefaciens is shown in SEQ ID NO.1, and the amino acid sequence encoded by the mdr gene in Bacillus licheniformis is shown in SEQ ID NO.

2.

2. The mdr gene knockout Bacillus according to claim 1, characterized in that: The sequence of the mdr gene knocked out in Bacillus amyloliquefaciens XH7 is shown in SEQ ID NO.3, and the sequence of the mdr gene knocked out in Bacillus licheniformis XZ3 is shown in SEQ ID NO.

4.

3. The mdr gene knockout Bacillus according to claim 1, characterized in that: The knockout vector is T2(2)-ori.

4. The method for preparing the mdr gene knocked out Bacillus according to any one of claims 1 to 3, characterized in that: include: Step 1, using genomic DNA of Bacillus amyloliquefaciens or Bacillus licheniformis as a template, respectively using an upstream homology arm amplification primer pair and a downstream homology arm amplification primer pair to perform PCR amplification to obtain an upstream homology arm fragment and a downstream homology arm fragment; Step 2, connecting the upstream homology arm fragment with the downstream homology arm fragment to obtain complete upstream and downstream homology arms; Step 3, performing inverse PCR amplification on the gene knockout plasmid to obtain a linear plasmid fragment; Step 4, recombining the complete upstream and downstream homology arms and the linear plasmid fragment by seamless cloning enzyme to obtain a recombinant product; Step 5, the recombinant product is transformed into Escherichia coli DH5α, kanamycin is used as a resistance screening marker, and colony PCR is performed to obtain positive transformants and extract the knockout plasmid; Step 6, the knockout plasmid is transferred into Bacillus amyloliquefaciens XH7 or Bacillus licheniformis XZ3, and kanamycin is used as a resistance screening marker to screen and obtain positive transformant 2, and further single-double exchange homologous recombination is performed to obtain the Bacillus with the mdr gene knocked out.

5. The preparation method according to claim 4, characterized in that: In the step 1, the sequences of the upstream homology arm amplification primer pair using the genomic DNA of Bacillus amyloliquefaciens XH7 as a template are shown in SEQ ID NO.11 and SEQ ID NO.12, respectively, and the downstream homology arm amplification primer pair are shown in SEQ ID NO.13 and SEQ ID NO.14, respectively; preferably, the nucleotide sequences of the upstream homology arm fragment and the downstream homology arm fragment are shown in SEQ ID NO.5 and SEQ ID NO.6; Alternatively, in step 1, the sequences of the upstream homology arm amplification primer pair using the genomic DNA of Bacillus licheniformis XZ3 as a template are respectively shown as SEQ ID NO.21 and SEQ ID NO.22, and the sequences of the downstream homology arm amplification primer pair are respectively shown as SEQ ID NO.23 and SEQ ID NO.24; preferably, the nucleotide sequences of the upstream homology arm fragment and the downstream homology arm fragment are shown as SEQ ID NO.8 and SEQ ID NO.

9.

6. The recombinant plasmid according to claim 4 or 5, characterized in that In the step 2, the upstream homology arm and the downstream homology arm are connected by SOE-PCR; preferably, the primer pair sequences used by the SOE-PCR method for Bacillus amyloliquefaciens XH7 are shown in SEQ ID NO.11 and SEQ ID NO.14, and the obtained complete upstream and downstream homology arm sequences are shown in SEQ ID NO.7; Alternatively, the primer pair sequences used in the SOE-PCR method for Bacillus licheniformis XZ3 are shown in SEQ ID NO.19 and SEQ ID NO.22, and the obtained complete upstream and downstream homology arm sequences are shown in SEQ ID NO.

10.

7. Use of the mdr gene knocked out Bacillus according to any one of claims 1 to 3 in the preparation of inosinic acid.

8. A method for preparing inosinic acid, characterized in that: The steps include: Step 1), activating and culturing the mdr gene-knocked Bacillus, and then performing seed culture; Step 2), fermenting the bacterial solution after the seed culture to obtain inosinic acid.

9. The method according to claim 8, characterized in that The activation culture comprises: inoculating the mdr gene knocked-out Bacillus into LB culture medium at a volume percentage of 1-5%, and culturing at 200-250 r / min and a temperature of 37±1° C. for 10-15 hours; and / or, The seed culture comprises: inoculating the activated bacterial solution into the seed culture medium at a volume percentage of 1-5% and then culturing at 200-250 r / min and a temperature of 37±1° C. for 10-15 hours; Preferably, the culture medium used for the seed culture comprises the following components: 1.0-2.0% tryptone, 0.5-1.0% yeast extract, 0.5-1.0% NaCl, 2.5-3.0% glucose, and the remainder is sterile water.

10. The method according to claim 8 or 9, characterized in that: The control conditions of the fermentation culture include: the bacterial liquid of the seed culture is inoculated into the fermentation medium at an inoculation rate of 2-4%, and the fermentation culture is carried out at 200-250r / min and a temperature of 37±1°C for 70-75h; Preferably, the fermentation medium consists of: 0.5% yeast powder, 0.08-0.2% sodium citrate, 1.5-2.0% ammonium sulfate, 0.2-0.3% potassium dihydrogen phosphate, 0.2-0.3% magnesium sulfate heptahydrate, 0.0004-0.0005% manganese sulfate, 2-3% glucose, 1.5-2.0% calcium carbonate, and the balance is sterile water.

Images