Pantothenic acid synthase mutant and application thereof

Abstract

The invention relates to the technical field of enzyme engineering, and discloses a pantothenic acid synthetase mutant and application thereof. According to the invention, site-specific mutagenesis is carried out on 62nd, 123rd and 189th amino acids of pantothenic acid synthase from escherichia coli, and site-specific and directed mutagenesis is carried out through an alanine scanning strategy near an active pocket to change protein amino acid residues; the 62nd phenylalanine is mutated into isoleucine and / or the 123rd amino acid arginine is mutated into glutamine and / or the 189th arginine is changed into isoleucine, so that the efficiency of catalyzing the D-panthenol by the pantothenic acid synthetase is improved, and the yield of the D-panthenol is increased. Finally, when the sites are mutated at the same time, recombinant escherichia coli of the pantothenic acid synthetase can improve the efficiency of catalyzing synthesis of D-panthenol by the pantothenic acid synthetase by 1.32 times, and the yield of a genetic engineering strain carrying the constructed pantothenic acid synthetase mutant in shake flask fermentation of panthenol is improved by 3.65 times.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, and in particular to a pantothenate synthase mutant and application thereof. Background Art

[0002] Panthenol is also known as provitamin B5, with the chemical formula C9H 19 NO4, relative molecular weight 205.25, the conformation of panthenol is divided into D-type and L-type, of which only D-type panthenol has biological activity. D-panthenol can be quickly oxidized into D-pantothenic acid in the body and participate in the metabolism of acetyl coenzyme A. Therefore, it is often used as an equivalent of vitamin B5 and as a dietary supplement in the feed field to improve the nutritional value of feed. In addition, D-panthenol is also widely used in many other fields, including medicine, cosmetics, hair care products, etc. At present, the market size of D-panthenol will continue to grow.

[0003] Panthenol is synthesized by chemical methods in industry. At present, the known synthesis methods of D-panthenol are mostly synthesized by chemical condensation of D-pantoic acid lactone and 3-aminopropanol. The synthesis of D-pantoyl lactone is obtained by enzymatic or chemical separation of racemized D-pantoyl lactone. Racemic pantoyl lactone is mostly obtained by multi-step chemical reactions of small molecules, including aldol reaction between isobutyraldehyde and formaldehyde, addition reaction of hydrogen cyanide and generated hydroxy aldehyde, acid hydrolysis reaction of formed cyanohydrin and corresponding carboxylic acid, and lactonization reaction of D-pantoic acid. This method is currently widely used in industry, but it also has many problems at this stage. For example, since the pantoyl lactone of the substrate needs to have a strict D-type conformation, L-pantoyl lactone needs to be re-racemized during the production process, which undoubtedly increases the corresponding cost of D-panthenol. In addition, a large amount of organic reagents and toxic cyanide are required in this process, which does not meet the requirements of environmental friendliness. In contrast, microbial fermentation production has the advantages of low cost, environmental friendliness and sustainability.

[0004] Existing D-pantothenic acid production bacteria produced by direct microbial fermentation mainly include Escherichia coli, Corynebacterium glutamicum, etc. Among them, in the biological fermentation production of D-pantothenic acid, pantothenate synthase plays a key role. It can catalyze the condensation of D-pantothenic acid and β-alanine to D-pantothenic acid under the condition of ATP. However, the efficiency of pantothenate synthase in catalyzing the conversion of D-pantothenic acid and 3-aminopropanol into D-pantothenic acid is currently low. Summary of the invention

[0005] In order to solve the technical problem of low catalytic efficiency of pantothenate synthase, the present invention provides a pantothenate synthase mutant and its application. The present invention performs site-directed mutagenesis on the 62nd, 123rd and 189th amino acids of pantothenate synthase from Escherichia coli, and changes the protein amino acid residues through site-directed mutagenesis by alanine scanning strategy near the active pocket, mutates the 62nd alanine to isoleucine and / or the 123rd amino acid arginine to glutamine and / or the 189th arginine to isoleucine, thereby improving the efficiency of pantothenate synthase in catalyzing D-panthenol and increasing the yield of D-panthenol.

[0006] The specific technical scheme of the present invention is: In a first aspect, the present invention provides a pantothenate synthase mutant, which is obtained by subjecting the amino acid sequence shown in SEQ ID NO.1 to single-point mutation or multi-point combined mutation at the following sites: The 62nd position of alanine was mutated to isoleucine; The amino acid arginine at position 123 was mutated to glutamine; Arginine at position 189 is changed to isoleucine.

[0007] The invention performs site-directed mutation on the 62nd, 123rd and 189th amino acids of pantothenate synthase derived from Escherichia coli (amino acid sequence is shown in SEQ ID NO.1), and changes the protein amino acid residues through site-directed mutation through alanine scanning strategy near the active pocket, so as to mutate the 62nd alanine into isoleucine and / or the 123rd amino acid arginine into glutamine and / or the 189th arginine into isoleucine, thereby improving the efficiency of pantothenate synthase in catalyzing D-panthenol and improving the yield of D-panthenol.

[0008] Preferably, the pantothenate synthase mutant is obtained by performing multiple combined mutations of the following sites on the amino acid sequence shown in SEQ ID NO.1: the 62nd amino acid alanine is mutated to isoleucine, the 123rd amino acid arginine is mutated to glutamine, and the 189th amino acid arginine is changed to isoleucine.

[0009] When the amino acids at positions 62, 123, and 189 of pantothenate synthase are mutated simultaneously, the recombinant Escherichia coli expressing pantothenate synthase can increase the efficiency of D-panthenol synthesis catalyzed by pantothenate synthase by 1.32 times. The genetically engineered strain carrying the constructed pantothenate synthase mutant increases the yield of panthenol in shake flask fermentation by 3.65 times, maximizing the efficiency of D-panthenol synthesis.

[0010] In a second aspect, the present invention provides a gene encoding the above-mentioned pantothenate synthase mutant.

[0011] In a third aspect, the present invention provides a recombinant vector comprising the above-mentioned encoding gene.

[0012] Preferably, the vector is pTrc99a or pET-28a(+).

[0013] In a fourth aspect, the present invention provides a genetically engineered bacterium comprising the above-mentioned encoding gene or the above-mentioned recombinant vector.

[0014] Preferably, the genetically engineered bacteria is Escherichia coli.

[0015] In a fourth aspect, the present invention provides use of the pantothenate synthase mutant in the preparation of D-panthenol.

[0016] Compared with the prior art, the present invention has the following technical effects: 1. The present invention performs site-directed mutagenesis on the 62nd, 123rd and 189th amino acids of pantothenate synthase from Escherichia coli (amino acid sequence as shown in SEQ ID NO.1), and changes the protein amino acid residues by site-directed mutagenesis through alanine scanning strategy near the active pocket, so as to mutate the 62nd alanine to isoleucine and / or the 123rd amino acid arginine to glutamine and / or the 189th arginine to isoleucine, thereby improving the efficiency of pantothenate synthase in catalyzing D-panthenol and increasing the yield of D-panthenol.

[0017] 2. When the 62nd, 123rd and 189th amino acids of pantothenate synthase are mutated at the same time, the efficiency of pantothenate synthase-catalyzed D-panthenol synthesis in recombinant Escherichia coli can be increased by 1.32 times. The production of panthenol in shake flask fermentation of the genetically engineered strain carrying the constructed pantothenate synthase mutant is increased by 3.65 times, and the efficiency of D-panthenol synthesis is greatly improved. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The gel electrophoresis diagram of the embodiment of the present invention, wherein: Figure 1 a is the nucleic acid gel electrophoresis diagram when constructing pET-28a(+)-panC and pTrc99a-panC, Figure 1 In a, M1 is a 250 kb marker, 1 is a pTrc99a linearized vector, 2 is an amplified product of the panC fragment connected to pTrc99a, 3 is a pET-28a(+) linearized vector, and 4 is an amplified product of the panC fragment connected to pET-28a(+); Figure 1 b is the PCR amplification product of the recombinant plasmid pTrc99a-panC, Figure 1 In b, M1 is a 250 kb marker, 1 is a single-point mutation amplification product, 2 is a double-point mutation amplification product, and 3 is a triple-point mutation amplification product; Figure 1 c is the PCR amplification product of the recombinant plasmid pET-28a(+)-panC, Figure 1 In c, M1 is a 250 kb marker, 1 is a single-point mutation amplification product, 2 is a double-point mutation amplification product, and 3 is a triple-point mutation amplification product.

[0019] Figure 2 The figure shows the relative enzyme activity and conversion rate of the wild type and mutant.

[0020] Figure 3 This is a diagram showing the results of fermentation ubiquinol production and biomass determination of ubiquinol-producing strains. DETAILED DESCRIPTION

[0021] The present invention will be further described below in conjunction with embodiments. Those of ordinary skill in the art will be able to implement the present invention based on these descriptions. In addition, the embodiments of the present invention involved in the following description are generally only embodiments of a part of the present invention, rather than all embodiments. Therefore, based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work should belong to the scope of protection of the present invention.

[0022] In the following examples, the method for determining the activity of pantothenate synthase is: (1) Enzyme activity assay reaction system: 25 mM pantoic acid, 25 mM 3-aminopropanol, 4.5 mM ATP, 10 mM magnesium chloride, 15 mM potassium chloride, pH adjusted to 8.0.

[0023] (2) Take 20 μL of enzyme solution and add it to 1.1 mL of reaction system. Mix well and react at 30°C for 24 h. Then add 10 μL of 6 M hydrochloric acid to the system. Centrifuge for 10 min. Take 200 μL and add it to the inner tube of the liquid phase bottle for high performance liquid chromatography detection. Deionized water was used instead of crude enzyme solution in the control group.

[0024] (3) Definition of 1 enzyme activity unit (U): The amount of enzyme required to produce 1 μg of D-panthenol per minute from 1 mL of enzyme solution under the above conditions. Prepare D-panthenol solutions of different concentrations, and use liquid chromatography to detect the peak area, and calculate the enzyme activity based on the standard curve. Specific enzyme activity (U / mg) = enzyme activity / protein amount.

[0025] In the following examples, the purification method of pantothenate synthase is as follows: slowly pour the nickel column filler into the chromatography column, stand it vertically, and install the nickel column after the filler is completely precipitated. Use AKTA protein purifier to purify the protein, set the parameters after starting the machine, wash it with ultrasonic distilled water, flush out 20% ethanol, and then balance the column with 20mM PB buffer after ultrasonic. The crude enzyme solution is placed in ice, slowly injected through the sample loading pipeline, and loaded at a rate of 1.0mL / min. The higher the absorption peak, the greater the enzyme amount. After completing the injection, first use a low concentration imidazole buffer (10mM imidazole) 2~5mL / min to flow through the Ni affinity column, and about 5 column volumes are used to remove impurities. After baseline equilibrium, change to a high concentration imidazole buffer (60mM imidazole) to elute the target protein and collect the protein and place it on ice, and finally wash it with ultrapure water. Use 20% ethanol solution to preserve the nickel column filler and store it at 4°C. The collected enzyme solution was placed in a dialysis tape and dialyzed overnight in 20 mM PB buffer at pH 8.0. For detailed operation details, refer to the Enzymology Methods E-book.

[0026] In the following examples, information on primers is shown in Table 1.

[0027] Table 1 Primer sequence list Primer name Sequence 5, -3, F62I-F CGTTAACCCGATGCAGATTGACCGCCCGGAAGAT F62-R CTGCATCGGGTTAACGAAAATACTGACGACGACCA R123Q-F CCATGCTGGAAGGTGCCAGCCAACCGGGACATTTTCGCGGCG R123-R GCTGGCACCTTCCAGCATGGTCGAAAGGCCAGGAAC R189I-F GGTCTGGCGCTAAGTTCCATTAACGGTTATCTGACGGCGGA R189-R GGAACTTAGCGCCAGACCGTCTTTGGCGC panC-trc-F TTTCACACAGGAAACAGACCGTGTTAATTATCGAAACCCTGCCG panC-trc-R CTCTCATCCGCCAAAACAGCCTTACGCCAGCTCGACCATTTTG pTrc-F GGCTGTTTTGGCGGATGAGAG pTrc-R GGTCTGTTTCCTGTGTGAAATTCC panC-28a-F CCGAATTCGAGCTCCGTCGAGTGTTAATTATCGAAACCCTGCC panC-28a-R TTGTTAGCAGCCGGATCTCATTACGCCAGCTCGACCATTT pET28a-F TGAGATCCGGCTGCTAACAAA pET28a-R TCGACGGAGCTCGAATTCGG Example 1 Construction of recombinant bacteria expressing pantothenate synthase In this example, the pantothenate synthase-expressing recombinant bacteria were constructed by following the steps below: Escherichia coli W3110 (purchased from the American Type Culture Collection (ATCC) website, the same below) was inoculated into a 10 mL LB test tube, cultured at 37°C with shaking for 12 h, and centrifuged at 12000 rpm to obtain the bacterial cells. Then, the kit ( The genome of Escherichia coli was extracted using a PCR amplification kit (PCR amplification kit) and the desired target gene, panC gene (pantothenate synthase encoding gene, the amino acid sequence of the pantothenate synthase encoded by it is shown in SEQ ID NO.1) was cloned from it. The PCR product was verified by agarose gel electrophoresis. The gel electrophoresis diagram is shown in Figure 1 In the middle a figure, the band position is observed to be around 850bp ( Figure 1 Lane 4 in Figure a) is consistent with the position of the target band. One-step cloning was performed to clone it into the expression vector pET-28a(+)( Figure 1a 3 lane) and transformed into E. coli DH5α competent cells, and verified by colony PCR. The colony PCR product was sent for sequencing, and the sequencing results were compared with the base sequence of the panC gene. The recombinant plasmid was correctly extracted and transformed into E. coli BL21 (DE3) competent cells. The single colony obtained by transformation was the target engineered bacteria E. coliBL21-pET-28a (+)-panC, and the successfully constructed engineered bacteria was preserved in low-temperature glycerol tubes. The preserved strain was streaked on a Kan plate and cultured in a 37°C incubator overnight. A single colony was picked from the streaked plate and inoculated into a test tube containing 10 mL of sterile LB medium, and Kan resistance was added. The culture was shaken at 37°C and 180 rpm for 12 hours. The bacterial solution in the low-temperature glycerol tube was inoculated into 100 mL of sterile LB medium at a 2% (volume ratio) inoculation volume, Kan resistance was added, and the bacterial solution was shaken and cultured at 37°C and 180 rpm until the OD600 value of the bacterial solution reached 0.7. 10 μL of IPTG mother solution (1M, the same below) was added, and the bacterial solution was shaken and cultured at 28°C and 180 rpm for 12 hours. After the bacterial solution was collected, it was centrifuged at 8000 rpm and 4°C for 10 minutes to break the cells and obtain the crude enzyme. After the crude enzyme was purified, the enzyme activity was determined. The results are shown in Figure 2 , wherein WT represents the wild-type enzyme activity, that is, the enzyme activity result of the culture solution of the engineered bacteria E. coli BL21-pET-28a(+)-panC constructed in this example.

[0028] Example 2 Effect of single-point mutation of pantothenate synthase on the expression of pantothenate synthase activity In this example, a single point mutation was performed on pantothenate synthase to study the effect of the mutation on the expression of pantothenate synthase activity, and the following steps were performed: Primers F62I-F and F62-R (as shown in Table 1) were designed, and pET-28a(+)-PanC constructed in Example 1 was used as a template to perform PCR, and the mutated alanine at position 62 was replaced with isoleucine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. The PCR amplification system was: 1 μL template, 1 μL upstream and downstream primers, 25 μL buffer, 1 μL dNTP, 1 μL enzyme, and 20 μL ddH2O. The band size was verified by running gel, and the agarose gel electrophoresis results were as follows: Figure 1As shown in lane 2 in c, the original template was digested. The resulting plasmid was named pET-28a(+)-panC(F62I). Then it was transformed into BL21 competent state, coated with Kan plate, positive colonies were picked, and the mutant strain with site-directed mutation was obtained after overnight culture at 37°C shaking, named BL21-pET-28a(+)-panC(F62I). The plasmid carried by the mutant strain was extracted to obtain pET-28a(+)-panC(F62I). A single colony was picked from the streaked plate and inoculated into a test tube containing 10 mL of sterile LB medium, Kan resistance was added, and cultured at 37°C and 180 rpm for 12 hours. The bacterial solution in the test tube was inoculated into 100 mL of sterile LB medium at a 2% (volume ratio) inoculation volume, Kan resistance was added, and the bacterial solution was shaken and cultured at 37°C and 180 rpm until the OD600 value of the bacterial solution reached 0.7. 10 μL of IPTG mother solution was added and shaken and cultured at 28°C and 180 rpm overnight. After the bacterial solution was collected, it was centrifuged at 8000 rpm and 4°C for 10 minutes to break the cells and obtain the crude enzyme. After the crude enzyme was purified, the enzyme activity and product conversion rate were determined, and the relative enzyme activity was calculated. The results are shown in Figure 2 , wherein F62I represents a mutant enzyme in which the 62nd position of pantothenate synthetase is mutated to isoleucine, that is, the measurement result of the pantothenate synthetase mutant expressed by the recombinant bacteria constructed in this example.

[0029] like Figure 2 As shown, in this example, when the 62nd position of the genetically engineered enzyme pantothenate synthetase was mutated to isoleucine, the activity of pantothenate synthetase was slightly improved, which was 1.07 times that of the starting strain (WT).

[0030] Example 3 Effect of double-point mutation of pantothenate synthase on the expression of pantothenate synthase activity In this example, double-point mutations were performed on pantothenate synthase to study the effect of mutations on the expression of pantothenate synthase activity, and the following steps were followed: Primers R123Q-F and R123-R (as shown in Table 1) were designed, and PCR was performed using the constructed pET-28a(+)-panC(F62I) as a template to mutate the arginine at position 123 to glutamine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL each, buffer 25 μL, dNTP 1 μL, enzyme 1 μL, ddH2O 20 μL. The size of the band was verified by running gel. Figure 1c Lane 3, and then digest the original template. The resulting plasmid was named pET-28a(+)-panC(F62I / 123Q). It was then transformed into BL21 competent cells, coated with Kan plates, and positive colonies were picked. After overnight culture at 37°C in a shaking incubator, a site-directed mutant strain was obtained, named E. coliBL21-pET-28(+)-panC(F62I / R123Q). The plasmid carried by the mutant strain was extracted to obtain pET-28a(+)-panC(F62I / 123Q). A single colony was picked from the streaked plate and inoculated into a test tube containing 10 mL of sterile LB medium, and Kan resistance was added. The culture was shaken at 37°C and 180 rpm for 12 hours. The bacterial solution in the test tube was inoculated into 100 mL of sterile LB medium at a 2% (volume ratio) inoculation volume, Kan resistance was added, and the bacterial solution was shaken and cultured at 37°C, 180 rpm until the OD600 value of the bacterial solution reached 0.7. 10 μL IPTG mother solution was added and shaken and cultured at 28°C, 180 rpm overnight. After the bacterial solution was collected, it was centrifuged at 8000 rpm and 4°C for 10 minutes to break the cells and obtain the crude enzyme. After the crude enzyme was purified, the enzyme activity and product conversion rate were determined, and the relative enzyme activity was calculated. The results are shown in Figure 2 , wherein F62I / R123Q represents a mutant enzyme in which the 62nd amino acid alanine of pantothenate synthetase is mutated to isoleucine and the 123rd amino acid arginine is mutated to glutamine, that is, the measurement result of the pantothenate synthetase mutant expressed by the recombinant bacteria constructed in this example.

[0031] Depend on Figure 2 The results showed that when the 62nd position of the genetically engineered pantothenate synthetase was replaced by isoleucine and the 123rd amino acid arginine was mutated to glutamine, the enzyme activity of pantothenate synthetase was slightly improved, which was 1.13 times the enzyme activity of the starting strain.

[0032] Example 4 Effect of three-point mutation of pantothenate synthase on the expression of pantothenate synthase activity In this example, three-point mutations were performed on pantothenate synthase to study the effect of the mutations on the expression of pantothenate synthase activity, and the following steps were followed: Primers R189I-F and R189-R (as shown in Table 1) were used to construct pET-28a(+)-panC(F62I / R123Q) as templates for PCR. The arginine at position 189 was mutated to isoleucine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL each, buffer 25 μL, dNTP 1 μL, enzyme 1 μL, ddH2O 20 μL. The size of the band was verified by running gel. Figure 1c Lane 4, and then digest the original template. The resulting plasmid was named pET-28a(+)-panC(F62I / R123Q / 189I). Subsequently, the plasmid was transformed into BL21 competent cells, coated on Kan plates, and positive colonies were picked. After overnight culture at 37°C in a shaking incubator, a site-directed mutant strain was obtained, named E. coli BL21-pET-28(+)-panC(F62I / R123Q / R189I). The plasmid carried by the mutant strain was extracted to obtain pET-28a(+)-panC(F62I / R123Q / 189I). A single colony was picked from the streaked plate and inoculated into a test tube containing 10 mL of sterile LB medium, and Kan resistance was added. The culture was shaken at 37°C and 180 rpm for 12 hours. The bacterial solution in the test tube was inoculated into 100 mL of sterile LB medium at a 2% (volume ratio) inoculation volume, Kan resistance was added, and the bacterial solution was shaken and cultured at 37°C and 180 rpm until the OD600 value of the bacterial solution reached 0.7. 10 μL of IPTG mother solution was added and shaken and cultured at 28°C and 180 rpm overnight. After the bacterial solution was collected, it was centrifuged at 8000 rpm and 4°C for 10 minutes to break the cells and obtain the crude enzyme. After the crude enzyme was purified, the enzyme activity and product conversion rate were determined, and the relative enzyme activity was calculated. The results are shown in Figure 2 , wherein F62I / R123Q / R189I represents a mutant enzyme in which the 62nd amino acid alanine of pantothenate synthetase is mutated to isoleucine, the 123rd amino acid arginine is mutated to glutamine, and the 189th amino acid arginine is changed to isoleucine, that is, the measurement result of the pantothenate synthetase mutant expressed by the recombinant bacteria constructed in this example.

[0033] The results showed that when the phenylalanine at position 62 of the genetically engineered pantothenate synthetase was replaced with isoleucine, the amino acid arginine at position 123 was mutated to glutamine, and the arginine at position 189 was changed to isoleucine, the enzyme activity of pantothenate synthetase was also greatly improved, which was 1.32 times the enzyme activity of the starting strain.

[0034] Example 5D-Construction of engineered bacteria for panthenol production In this example, the D-panthenol production engineering bacteria were constructed according to the following steps: Escherichia coli W3110 was inoculated into a 10 mL LB test tube, cultured at 37 °C for 12 h, and centrifuged at 12000 rpm to obtain the bacteria. The genome of Escherichia coli was extracted by using a kit (PCR kit), and the desired target gene, panC gene, was cloned therefrom. After the PCR product was verified by agarose gel electrophoresis, it was observed that the band position was about 850bp, which was consistent with the target band position. One-step cloning connected it with the expression vector pTrc99a, transformed into Escherichia coli DH5α competent cells, and verified by colony PCR. The colony PCR product was sent for sequencing, and the sequencing results were compared with the base sequence of the panC gene. The results showed that the recombinant plasmid was correctly extracted to obtain the recombinant plasmid pTrc99a-panC, which was transformed into Escherichia coli DPA12 to obtain the engineered bacteria DFC-panC. The strain Escherichia coli DPA12 is disclosed in the patent with application publication number CN109868254A and invention name "A genetically engineered bacterium with high production of pantothenic acid, construction method and application".

[0035] Primers F62I-F and F62-R (as shown in Table 1) were designed, and PCR was performed using the constructed pTrc99a-panC as a template to replace the 62nd position of the alanine with isoleucine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL each, buffer 25 μL, dNTP 1 μL, enzyme 1 μL, ddH2O 20 μL. The band size was verified by running the gel, and the agarose gel electrophoresis results were as follows: Figure 1 b As shown in lane 2, the original template was then digested. The cells were then transformed into Escherichia coli DPA12 competent cells, coated on Kan plates, and positive colonies were picked. After overnight culture at 37°C in a shaking incubator, a site-directed mutagenesis mutant strain was obtained, named DFC-F62I, and the plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC (F62I).

[0036] Primers R123Q-F and R123-R (as shown in Table 1) were designed, and PCR was performed using the constructed pTrc99a-panC (F62I) as a template to mutate the arginine at position 123 to glutamine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL each, buffer 25 μL, dNTP 1 μL, enzyme 1 μL, ddH2O 20 μL. The size of the band was verified by running gel. Figure 1b As shown in lane 3, the original template was then digested. The mutant strain was then transformed into Escherichia coli DPA12 competent cells, coated on Kan plates, and positive colonies were picked. After overnight culture at 37°C in a shaking incubator, a site-directed mutagenesis strain was obtained, which was named DFC-F62I / R123Q, and the plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC (F62I / R123Q).

[0037] Primers R189I-F and R189-R (as shown in Table 1) were designed, and PCR was performed using the constructed pTrc99a-panC (F62I / R189I) as a template to mutate the arginine at position 189 to isoleucine. The PCR reaction conditions were 98°C for 5 min, 30 cycles (95°C for 30 s, 55°C for 30 s, 72°C for 4 min), and 72°C for 10 min. PCR amplification system: template 1 μL, upstream and downstream primers 1 μL each, buffer 25 μL, dNTP 1 μL, enzyme 1 μL, ddH2O 20 μL. The size of the band was verified by running gel. Figure 1 b As shown in lane 4, the original template was then digested. The mutant strain was then transformed into Escherichia coli DPA12 competent cells, coated on Kan plates, and positive colonies were picked. After overnight culture at 37°C in a shaking incubator, a site-directed mutagenesis strain was obtained, which was named DFC-F62I / R123Q / R189I, and the plasmid carried by the mutant strain was extracted to obtain pTrc99a-panC (F62I / R123Q).

[0038] Example 6D- Shake flask fermentation of panthenol production engineered bacteria In this example, the engineered bacteria constructed in Example 6 were used for shake flask fermentation, and the following steps were followed: (1) Activation of strains: Take strains (DFC-panC, DFC-F62I, DFC-F62I / R123Q, DFC-F62I / R123Q / R189I) and streak inoculate them into activation medium (solid LB medium) and culture them at 37°C overnight; (2) Seed culture: Use an inoculation loop to pick activated seeds and inoculate them into a test tube containing 10 mL of seed culture medium (LB medium) and culture them at 37°C and 200 rpm overnight; (3) Shake flask fermentation: Inoculate the seed solution at 5% inoculum (volume ratio) into a 250 mL conical flask containing 50 mL of fermentation medium, and culture at 37°C and 200 rpm for 52 h. The yield and conversion rate of the fermented product D-panthenol were determined. The results are shown in Figure 3, where: the assay results of WT, F62I, F62I / R123Q, and F62I / R123Q / R189I are the fermentation assay results of DFC-panC, DFC-F62I, DFC-F62I / R123Q, and DFC-F62I / R123Q / R189I strains, respectively.

[0039] The shake flask fermentation medium consists of 20 g / L glucose, 16 g / L ammonium sulfate, 2 g / L yeast powder, 1 g / L KH2PO4, 0.2 g / L MgSO4, 15 g / L CaCO3, and 1 mL / L trace metal salt solution (salt solution: 10 g / L CuCl2, 10 g / L FeSO4·7H2O, 1 g / L ZnSO4·7H2O, 0.2 g / L CuSO4, and 0.02 g / L NiCl2·7H2O).

[0040] According to the fermentation results, the production strain DFC-panC carrying the wild-type panC recombinant plasmid pTrc99a-panC had a shake flask yield of 0.178 g / L, the production strain DFC-panC(F62I) carrying the single-point mutation panC recombinant plasmid pTrc99a-panC(F62I) had a shake flask yield of 0.380 g / L, and the production strain carrying the double-point mutation panC recombinant plasmid pTrc99a-panC(F62I / R123Q) had a shake flask yield of 0.178 g / L. The shake flask yield of strain DFC-panC (F62I / R123Q) was 0.5 g / L, and the shake flask yield of the production strain DFC-panC (F62I / R123Q / R189I) carrying the recombinant plasmid pTrc99a-panC (F62I / R123Q / R189I) with three-point mutations was 0.65 g / L. Compared with the wild-type panC, the three-point mutant panC increased the D-pantenol production of the engineered bacteria to 3.65 times the original.

[0041] The raw materials and equipment used in the present invention, unless otherwise specified, are all commonly used raw materials and equipment in the art; the methods used in the present invention, unless otherwise specified, are all conventional methods in the art.

[0042] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A pantothenate synthase mutant, characterized in that: The amino acid sequence shown in SEQ ID NO.1 is subjected to single point mutation or multi-point combined mutation at the following sites: The 62nd position of alanine was mutated to isoleucine; The amino acid arginine at position 123 was mutated to glutamine; Arginine at position 189 is changed to isoleucine.

2. A pantothenate synthase mutant according to claim 1, characterized in that: The amino acid sequence shown in SEQ ID NO.1 is subjected to multiple combined mutations at the following sites: the 62nd amino acid alanine is mutated to isoleucine, the 123rd amino acid arginine is mutated to glutamine, and the 189th amino acid arginine is changed to isoleucine.

3. A gene encoding the pantothenate synthase mutant according to any one of claims 1 to 2.

4. A recombinant vector, characterized in that: Comprising the coding gene according to claim 3.

5. The recombinant vector according to claim 4, characterized in that: The vector is pTrc99a or pET-28a(+).

6. A genetically engineered bacterium, characterized in that: Comprising the coding gene according to claim 3 or the recombinant vector according to claim 4.

7. The genetically engineered bacterium according to claim 6, characterized in that: The genetically engineered bacteria is Escherichia coli.

8. Use of the pantothenate synthase mutant according to any one of claims 1 to 2 in the preparation of D-panthenol.

Images