Application of OsSAP5 gene in regulation and control of drought resistance of rice in seedling stage

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of an OsSAP5 gene in regulation and control of drought resistance in a rice seedling stage, a CDS sequence of the OsSAP5 gene is shown as SEQ ID NO.1, and a full-length sequence of the OsSAP5 gene is shown as SEQ ID NO.2. The invention further relates to application of the OsSAP5 gene in regulation and control of drought resistance in a rice seedling stage. The OsSAP5 gene is knocked out from a Nipponbare rice variety, the survival rate and the water content of the OsSAP5 gene knockout mutant after drought treatment in the rice seedling stage are remarkably reduced, the application of the OsSAP5 gene knockout mutant in regulation and control of the drought resistance in the rice seedling stage is proved, and an important gene resource is provided for cultivation of the drought-resistant rice variety.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and specifically relates to OsSAP5 Application of genes in regulating drought resistance in rice seedlings. Background Art

[0002] Rice ( Oryza Sativa Rice is one of the most important food crops for human beings. It has a long history of cultivation and consumption. Half of the world's population eats rice, mainly in Asia, southern Europe, tropical America and parts of Africa. The total output of rice ranks third in the world's food crop output.

[0003] In recent years, high temperature weather has occurred frequently around the world. With the frequent occurrence of high temperature weather, some rice-growing areas will suffer from water shortage due to high temperature, leading to drought in agricultural land, posing a serious threat to rice production safety. Drought stress can cause rice leaves to curl, ABA accumulation, decreased stomatal conductance, weakened photosynthesis, and significantly weakened leaf growth, resulting in insufficient nutrient supply, decreased starch content, and increased chalkiness, which ultimately affects rice quality. Therefore, exploring high-yield and high-resistance rice varieties is crucial for rice breeding.

[0004] It is reported that plant stress-associated proteins (SAPs) are a class of zinc finger proteins with A20 / AN1 zinc finger domains, also known as ZFPs (Zinc-finger proteins) family proteins, which play an important role in plant growth and development and stress response. There are 18 SAP proteins in rice, and OsSAP1 is the first reported zinc finger protein with A20 / AN1 domain in plants. It is overexpressed in tobacco. OsSAP1 , the plants are more resistant to cold, salt and drought. OsSAP8 Overexpression of tobacco and rice seeds enhanced tolerance to salt, drought, and cold stress. OsSAP9 ( ZFP177 ) respond to both cold and high temperature stress. OsSAP9 Transgenic plants are more sensitive to salt and drought stress. OsSAP4 ( ZFP185 ) can affect the biosynthesis of gibberellins and abscisic acid and increase the sensitivity of rice to abiotic stress. OsSAP7 ( ZFP173 ) overexpression reduced drought tolerance in rice plants. OsSAP11 Down-regulating the expression of gibberellin biosynthesis genes, limiting cell elongation, and causing rice plants to become dwarfed. Both OsSAP1 and OsSAP11 can interact with the receptor-like protein kinase OsRLCK253 to enhance the plant's tolerance response to abiotic stress. OsSAP16 The plant's stomatal conductance decreased, photosynthesis increased, and resistance to drought stress increased. OsSAP16The germination rate of the mutant decreased at low temperature, and the overexpression OsSAP16 The low temperature germination of seeds is enhanced.

[0005] OsSAP5 is an important member of the rice SAP family. Although it has been reported that it may be involved in the high temperature response of rice during the filling period, it has only been phenotypically verified in Arabidopsis, and its functional research has not been carried out in rice. There are also no research reports on OsSAP5 regulating rice drought stress. Summary of the invention

[0006] In view of the need for research on enhancing rice drought resistance in the prior art, the present invention provides OsSAP5 The application of genes in regulating drought resistance of rice seedlings, the specific technical scheme is as follows: In a first aspect, the present invention provides OsSAP5 Application of genes in regulating drought resistance in rice seedling stage, the OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.2.

[0007] In a second aspect, the present invention provides an application of OsSAP5 protein in regulating drought resistance of rice at the seedling stage. The amino acid sequence of the OsSAP5 protein is shown in SEQ ID NO.3.

[0008] Furthermore, the OsSAP5 improves the drought resistance of rice by enhancing the photosynthesis of rice seedlings.

[0009] The present invention uses CRISPR / Cas9 gene editing technology to modify the rice variety Nipponbare ( Nip , Oryza. Sativa L. spp. japonica , var. Nipponbare ) OsSAP5 Gene, prepared OsSAP5 Knockout plants Ossap5-1 and Osasp5-2 ( Nip background).

[0010] Through OsSAP5 Knockout rice Ossap5-1 and Osasp5-2 , and wild-type control materials, were used to identify the resistance of rice to drought stress at the seedling stage. It was found that compared with the wild type, OsSAP5 The survival rate and water content of the knockout mutants were significantly reduced after drought treatment at the rice seedling stage. The chlorophyll fluorescence Fv / Fm of the mutants was significantly reduced, and the conductivity and MDA content were significantly increased. This indicates that OsSAP5 Knocking out the gene significantly reduced the drought resistance of rice.

[0011] In a third aspect, the present invention provides an application of a recombinant vector in regulating drought resistance of rice seedlings, wherein the recombinant vector comprises OsSAP5 Gene, OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.1.

[0012] In a fourth aspect, the present invention provides an application of a genetically engineered bacterium in regulating drought resistance of rice seedlings, wherein the genetically engineered bacterium comprises OsSAP5 Gene, OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.2.

[0013] In a fifth aspect, the present invention provides a method for regulating rice drought stress, wherein the regulating method is: By silencing, knocking down or knocking out OsSAP5 genes, thereby reducing drought resistance in rice seedlings; Furthermore, the knockout OsSAP5 The genetic method is: (1) Based on OsSAP5 Genome sequence, design target sequence sgRNA, and construct using CRISPR / Cas9 technology OsSAP5 Knockout mutant vector; (2) The CRISPR / Cas9 vector is transferred into Agrobacterium competent cells to construct a knockout vector OsSAP5 Agrobacterium strains with gene CRISPR / Cas9; (3) Transforming the rice callus with the Agrobacterium strain to obtain a knockout OsSAP5 Gene homozygous strains.

[0014] In a sixth aspect, the present invention provides OsSAP5 Application of genes in screening and creating drought-resistant rice germplasm resources, the OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.2.

[0015] Compared with the prior art, the present invention has the following beneficial effects: The present invention knocks out the OsSAP5 Gene, found OsSAP5 The survival rate and water content of the gene knockout mutant were significantly reduced after drought treatment at the rice seedling stage, confirming its use in regulating drought resistance of rice seedlings and providing an important genetic resource for breeding drought-resistant rice varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 For rice OsSAP5 Schematic diagram of the phenotype, survival rate and relative water content of mutant plants after drought treatment at the seedling stage; A: Nihonbare and Ossap5-1 Phenotypes before drought treatment and one week after recovery; B: Japan's clear and Ossap5-2 Phenotypes before drought treatment and one week after recovery. C: Survival rate statistics of plants one week after drought treatment; D: Leaf water content of plants 72 hours after drought treatment. CK: control, PEG6000: simulated drought treatment; Nipponbare: wild type of Nipponbare; Ossap5-1 and Ossap5-2 : OsSAP5 All data are the average of 3 replicates; lowercase letters in the figures indicate significant differences between different materials (LSD, α = 0.05).

[0017] Figure 2 Nipponbare and OsSAP5 Schematic diagram of the effect of mutant leaf chlorophyll fluorescence at the seedling stage; A: Nipponbare and OsSAP5 Chlorophyll fluorescence images of mutant plants after drought treatment; B: Nipponbare and OsSAP5 Fv / Fm values ​​of mutant plants after drought treatment. CK: control, PEG6000: drought stress; Nipponbare: Nipponbare wild type; Ossap5-1 and Ossap5-2 : OsSAP5 All data are the average of 3 replicates; lowercase letters in the figures indicate significant differences between different materials (LSD, α = 0.05).

[0018] Figure 3 Nipponbare and OsSAP5 Schematic diagram of the effects of relative conductivity, MDA and POD activity on the leaves of mutants at the seedling stage; A: relative conductivity; B: MDA content. CK: control, PEG6000: drought treatment; Nipponbare: Nipponbare wild type; Ossap5-1 and Ossap5-2 : OsSAP5 Knockout mutants of genes; all data are the average of 3 replicates. Lowercase letters in the figure indicate the significant difference between different materials (LSD, α=0.05). DETAILED DESCRIPTION

[0019] In order to make those skilled in the art better understand the scheme of the present invention, the technical scheme of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and are only embodiments of a part of the present invention, rather than all embodiments.

[0020] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.

[0021] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without specifying detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.

[0022] In the present invention, OsSAP5 The nucleotide sequence of the protein coding region of the gene is shown in SEQ ID NO.1, OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.2. OsSAP5 The protein encoded by the gene is a protein with an A20 / AN1 zinc finger domain, consisting of 154 amino acids, and its amino acid sequence is shown in SEQ ID NO.3, specifically: SEQ ID NO.1: ATGGCTGAGGAGCAGAGGTGGCAGGAGGGCTGCCACCGCCTGTGCGCCAACAACTGCGGCTTCTTCGGTAGCCCCGCCACGCTCGACCTCTGCTCCAAGTGCTACCGCGACCGCCAAGGCCGGGAGAGTACTGCACCCGTCGTCGTCGCCGCCGCAGCCTCGGCCTGCCCGGCTACTCATCCTTCCTCGCCATCCTCGTCGTCTTGTCCGGCGTTCTTGCCTTCCTCCACTGCCGCCGAGGCTGGCGTCGTCGTCGCGGCGGTGGCGAAGGCGAGCAGGTGCGCGAGCTGTAGGAAGCGGGTGGGGCTTACGGGGTTCGCGTGCCGGTGCGGCGGCACGTTCTGCGGCGCACACCGGTACCCGGAGCGGCACGCGTGCGGCTTCGACTTCAAGGCCGCCGGCCGCGACGCCATCGCGCGCGCCAACCCGCTCATCAAGGGCGACAAGCTCAAGGACAAGATCTGA SEQ ID NO.2: CTTGCCTCCACCCACGTCGTCGATCTCGTCCACTCCAATTACATCCATCCATCCGCTCTGCAACCTTCTCCGGTTGCTGCGAGCGAGAGCGAGAGCGATCGCTACAGCCGCCGGTGGCCAGCCATGGCTGAGGAGCAGAGGTGGCAGGAGGGCTGCCACCGCCTGTGCGCCAACAACTGCGGCTTCTTCGGTAGCCCCGCCACGCTCGACCTCTGCTCCAAGTGCTACCGCGACCGCCAAGGCCGGGAGAGTACTGCACCCGTCGTCGTCGCCGCCGCAGCCTCGGCCTGCCCGGCTACTCATCCTTCCTCGCCATCCTCGTCGTCTTGTCCGGCGTTCTTGCCTTCCTCCACTGCCGCCGAGGCTGGCGTCGTCGTCGCGGCGGTGGCGAAGGCGAGCAGGTGCGCGAGCTGTAGGAAGCGGGTGGGGCTTACGGGGTTCGCGTGCCGGTGCGGCGGCACGTTCTGCGGCGCACACCGGTACCCGGAGCGGCACGCGTGCGGCTTCGACTTCAAGGCCGCCGGCCGCGACGCCATCGCGCGCGCCAACCCGCTCATCAAGGGCGACAAGCTCAAGGACAAGATCTGATCCCTCCCCACCTGCCGTGCTCCCCGTCGCCGCCGGAAGAACGCGCGGTTGGATTCCAAATTAAATACGCTTATTATTATGTAAGCTACAGCCGGCCGGCGGTGAAATCGCCAGCCAGCCATGCATGCATGCGACTGAAATGAAAATGAGTTCATATCTCTGCTCCTTCTATTCA SEQ ID NO.3: MAEEQRWQEGCHRLCANNCGFFGSPATLDLCSKCYRDRQGRESTAPVVVAAAASACPATHPSSPSSSSCPAFLPSSTAAEAGVVVAAVAKASRCASCRKRVGLTGFACRCGGTFCGAHRYPERHACGFDFKAAGRDAIARANPLIKGDKLKDKI。

[0023] Example 1 Rice OsSAP5Gene cloning, gene knockout vector construction and transformation 1. Extraction of total RNA from rice The total RNA of young rice leaves was extracted using the EasyPure Plant RNA Kit, and the extracted RNA was reverse transcribed using the instructions of the One-Step RT-PCR SuperMix to obtain cDNA (as shown in SEQ ID NO.1), which was stored at -20°C for future use.

[0024] 2. OsSAP5 CRISPR / Cas9 knockout vector construction and Agrobacterium transformation Based on the genome (SEQ ID NO.2) sequence, specific target sequences were searched online (http: / / skl.scau.edu.cn / ), and the target sites with high score values, low off-target rates, and reasonable GC% were selected as the screening requirements to select the appropriate knockout target sequence. In order to increase the mutation rate, two pre-mutation target sites Target1 and Target2 were designed in the OsSAP5 open reading frame, and sgRNA (SEQ ID NO.6 and SEQ ID NO.8) were designed according to the pre-mutation target sites. : Target1:GAGGAGCAGAGGTGGCAGGA (SEQ ID NO.4); Target2: AAGTGCTACCGCGACCGCCA (SEQ ID NO.5); OsSAP5 -gRT1:GAGGAGCAGAGGTGGCAGGAgttttagagctagaaat (SEQ ID NO.6); OsSAP5 -OsU3T1:TCCTGCCACCTCTGCTCCTCTgccacggatcatctgc (SEQ ID NO.7); OsSAP5 -gRT2: AAGTGCTACCGCGACCGCCAgttttagagctagaaat (SEQ ID NO.8); OsSAP5 -OsU6aT2: TGGCGGTCGCGGTAGCACTTCggcagccaagccagca (SEQ ID NO. 9).

[0025] OsU3 and OsU6a promoters are the promoters of the sgRNA expression cassette. The pYLgRNA-OsU3 and pYLgRNA-OsU6a plasmids are used as templates to amplify the sgRNA expression cassette. After PCR amplification, gel electrophoresis is performed to detect bands. The first half of the promoter and the second half of the scaffold gel of OsU3 with expected band sizes are placed in the same centrifuge tube (OsU3+sgRNA), and the first half of the promoter and the second half of the scaffold gel of OsU6a are placed in the same centrifuge tube (OsU6a+sgRNA). The gels are crushed and 100 µL ddH2O is added. They are stored at 4°C as template materials for the next step of sgRNA complete expression cassette amplification. sgRNA complete expression cassette amplification The above gel products (OsU3+sgRNA and OsU6a+sgRNA) are used as templates for PCR amplification. The above two-step PCR reaction can connect the promoter and sgRNA to form a complete expression cassette. After the PCR program is completed, a gel electrophoresis test is performed to observe whether the amplified bands are in line with expectations. The target band of U3-gRNA is 564 bp, and the target band of U6a-gRNA is 629 bp. If the product is correct, gel recovery is performed and stored at -20°C.

[0026] The CRISPR / Cas9 vector (pYLCRISPR / Cas9 Pubi-H, pCAMBIA-1300) was digested with restriction endonuclease BsaI (#R0535V) from NEB Biotechnology, and the sgRNA expression cassette gel recovery product and the digested vector were recombined with T4 ligase (#M0202V) from NEB. The recombinant vector was transformed into Escherichia coli DH5α, and positive clones were picked for colony PCR and gel electrophoresis tests. Positive bands were selected for sequencing. After successful sequencing, Agrobacterium was transformed. The transformation of Agrobacterium was performed by freeze-thaw method according to the instructions of EHA105 competent cells from Weidi Company. Single colonies were picked for PCR identification, and Agrobacterium with correct bands was used for genetic transformation.

[0027] Example 2 Rice OsSAP5 Obtaining homozygous plants for gene knockout 1. Agrobacterium-mediated genetic transformation of rice Use containing OsSAP5 After infecting rice callus with Agrobacterium tumefaciens carrying CRISPR / Cas9 knockout vector and screening with differentiation medium and rooting medium, corresponding genetically transformed plants were obtained.

[0028] 2. Obtaining homozygous gene knockout plants The young leaves of T0 transgenic rice were selected when they grew to 3-4 leaves, and genomic DNA was extracted by CTAB method. OsSAP5Mutant plants were identified by T-DNA. Primers were designed based on the 610 bp sequence in the CRISPR / Cas9 vector (forward primer: 5'-GCTTCATGGCCCACTACGAAATGCTT-3'; reverse primer: 5'- CGCATCTATGGGCCTGGACGGAATAG -3'). OsSAP5 The mutant DNA was used as a template for PCR reaction.

[0029] The T-DNA identification results in the previous step are consistent with expectations. OsSAP5 The mutant plants were sequenced and analyzed for mutation sites. OsSAP5 The two target sites were close to each other, so primers were designed 100 bp before the first target site and 100 bp after the second target site (forward primer: 5'-AGAGCGATCGCTACAGCCGC-3'; reverse primer: 5'- ACGACGACGGGTGCAGTACTCT-3') to amplify the endogenous OsSAP5 Gene, sequencing verified the PCR product, the results showed that OsSAP5 The gene has been deleted, i.e. OsSAP5 Transgenic lines with loss of gene function are named Ossap5-1 and Ossap5-2 .

[0030] Example 3 OsSAP5 Survival statistics and physiological and biochemical indexes of gene knockout rice after drought treatment 1. Drought treatment of rice plants and statistics of survival rate The rice Nipponbare background material obtained in Example 2 OsSAP5 Knockout clones Ossap5-1 and Ossap5-2 The healthy and full seeds of wild type and mutant were used as test materials. The seeds were disinfected with 2% NaClO for 20 min and then rinsed with clean water. The seeds were soaked at 37℃ for 3 days until they turned white. The seeds with the same white appearance were sown in 96-well hydroponic boxes and hydroponically cultivated using Yoshida rice nutrient solution formula (the specific formula is shown in Table 1). The hydroponic solution was changed every 4 days. When the rice seedlings grew to the four-leaf stage, they were treated with simulated drought in a light incubator. The treatment conditions were as follows: constant temperature of 25℃, 12 h of light, 12 h of darkness, and relative humidity of 75%. The control group was treated with normal hydroponic solution, and the drought treatment group was treated with hydroponic solution containing 20% ​​PEG6000. After 3 days of drought treatment, the seeds recovered and grew for 7 days, and the survival rate was counted. Three biological replicates were performed for each treatment.

[0031] Table 1 Yoshida rice nutrient solution formula

[0032] Note: Add 5 mL of each of the above I-VI stock solutions to every 4000 mL of culture medium and adjust the pH to 5.5-6.0 The results are as follows Figure 1 A and Figure 1 As shown in Figure B, it can be seen that when the rice seedlings at the four-leaf stage were treated with simulated drought for 24 hours, the leaves of the mutant plants began to curl; when the simulated drought was treated for 48 hours, the mutant leaves curled more severely, while the wild-type leaves began to curl at this time; after 72 hours of treatment, the mutants were almost completely dried up and curled, while only half of the wild-type leaves were curled and dried. Figure 1 As shown in B, the treated plants were transferred to normal growth conditions at 25°C to recover for one week. Ossap5-1 and Ossap5-2 The survival rates were 50% and 46%, respectively, compared to 80% for the wild type.

[0033] 2. Determination of relative water content of rice seedling leaves Take the rice seedlings treated with the above simulated drought for 72 hours, and repeat each treatment 3 times. Record the original weight (m0), soak the rice leaves in distilled water for several hours, and let the leaves fully absorb water to reach saturation. Take out the leaves, absorb the surface water with absorbent paper, and weigh them immediately, which is the weight of the leaves saturated with water (m1). Then dry the leaves in a 60℃ oven to constant weight, and measure the dry weight (m2) after cooling to room temperature in a desiccator. The relative water content (RWC) of the seedlings = (m0-m2) / (m1-m2)×100%.

[0034] The results are as follows Figure 1 As shown in C, wild type and OsSAP5 The relative water content of the leaves of the mutants had no significant difference under normal growth conditions, but after drought treatment OsSAP5 The relative water content of leaves of mutant plants was significantly lower than that of wild type plants.

[0035] 3. Determination of Chlorophyll Fluorescence Fv / Fm in Rice Seedling Leaves The rice seedlings were adapted to the dark for 30 min before and after the simulated drought treatment for 72 h. The chlorophyll fluorescence was detected and photographed using an Imaging-PAM fluorescence instrument (IMAG-MAXI, HeinzWalz, Effeltrich). The calculation formula is as follows: Fv / Fm=(Fm-F0) / Fm. The initial fluorescence value (F0) was determined after turning on the measuring light, and then a 0.8 s saturation pulse light (>4000 μmol m -2 s -1 ) were irradiated to obtain the maximum fluorescence yield (Fm) in the dark, and the data were analyzed using analysis software (Imagingwin).

[0036] The results are as follows Figure 2 As shown, take a photo Figure 2 The chlorophyll fluorescence image shown in A is Figure 2 As shown in B, after simulated drought stress, the wild type and mutant Ossap5-1 and Ossap5-2 The Fv / Fm of the mutants were significantly reduced. Ossap5-1 and Ossap5-2 The Fv / Fm of the WT was significantly lower than that of the wild type.

[0037] 4. Relative conductivity determination Take 0.5 g of leaves from wild-type and mutant rice plants before and after simulated drought treatment for 72 hours, wash them, dry the surface moisture of the leaves with absorbent paper, cut them into small pieces, put them into a 15 ml clean test tube, add 10 ml of deionized water, cover them and culture them in a 25℃ constant temperature incubator for 24 hours, measure the initial conductivity (E0) with a Lei magnetic conductivity meter (DDS-307) at room temperature, boil the samples in a water bath for 15 minutes, cool them to room temperature, measure the conductivity (E1), and calculate the relative conductivity. The calculation formula is as follows: relative conductivity = E0 / E1×100%.

[0038] The results are as follows Figure 3 As shown in A, it can be seen that after simulated drought treatment, Ossap5-1 and Ossap5-2 The relative conductivity of the mutant leaves was significantly higher than that of the wild type.

[0039] 5. Determination of malondialdehyde content 0.15 g of the seedling leaves before and after the simulated drought treatment for 72 h were taken, 4 ml of 0.1 M phosphate buffer (PBS, pH 7.8) was added for grinding, and centrifuged at 12000×g for 15 min at 4°C. The supernatant was used as the extract for determining the malondialdehyde (MDA) content. The MDA content was determined according to the method of He et al. (2019a), adding 0.5 ml of crude enzyme extract and 0.85 ml of 5% (w / v) thiobarbituric acid (TBA)-trichloroacetic acid (TCA) reaction solution, boiling water bath for 15 min, rapidly cooled, centrifuged at 1800×g for 10 min, and the supernatant was taken to measure the absorbance at 532 nm and 600 nm wavelengths using a spectrophotometer (HIMADZU UV-1900). The calculation formula is as follows: MDA content (nmol / g) = [(OD532–OD600) × A × V / a] / (1.55 × 10-1 × W), where A is the total amount of reaction solution, V is the total amount of extract, a is the amount of extract used for determination, W is the fresh weight of the sample, and 1.55 × 10-1 is the MDA extinction coefficient.

[0040] The results are as follows Figure 3As shown in B, it can be seen that after the simulated drought treatment, Ossap5-1 and Ossap5-2 The MDA content of the mutant was significantly higher than that of the wild type.

Claims

1. OsSAP5 The application of the gene in regulating drought resistance of rice seedlings is characterized in that: Said OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.

1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.

2.

2. Application of OsSAP5 protein in regulating drought resistance of rice seedlings, characterized in that: The amino acid sequence of the OsSAP5 protein is shown in SEQ ID NO.

3.

3. The use according to claim 2, characterized in that: The OsSAP5 improves rice drought resistance by enhancing photosynthesis in rice seedlings.

4. Use of a recombinant vector in regulating drought resistance of rice seedlings, characterized in that: The recombinant vector comprises OsSAP5 Gene, OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.

1.

5. Use of a genetically engineered bacterium in regulating drought resistance of rice seedlings, characterized in that: The genetically engineered bacteria comprises OsSAP5 Gene, OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.

1.

6. A method for regulating rice drought stress resistance, characterized in that: The method of regulation is: By silencing, knocking down or knocking out OsSAP5 genes, thereby reducing drought stress resistance in rice seedlings; Said OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.

1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.

2.

7. The method according to claim 6, characterized in that The knockout OsSAP5 The genetic method is: (1) Based on OsSAP5 Genome sequence, design target sequence sgRNA, and construct using CRISPR / Cas9 technology OsSAP5 Knockout mutant vector; (2) The CRISPR / Cas9 vector is transferred into Agrobacterium competent cells to construct a knockout vector OsSAP5 Agrobacterium strains with gene CRISPR / Cas9; (3) Transforming the rice callus with the Agrobacterium strain to obtain a knockout OsSAP5 Gene homozygous strains.

8. OsSAP5 The application of genes in screening and creating drought-resistant rice germplasm resources is characterized in that: Said OsSAP5 The CDS sequence of the gene is shown in SEQ ID NO.

1. OsSAP5 The full-length sequence of the gene is shown in SEQ ID NO.2.

Images