Universal nanoparticle composite hydrogel microsphere capable of adjusting inflammation microenvironment of injured part and carrying cells

Abstract

The invention belongs to the technical field of biomedical tissue engineering, and particularly relates to a universal nano-particle composite hydrogel microsphere capable of adjusting the inflammation microenvironment of an injured part and carrying cells. According to the microspheres, polydopamine nano particles and micro particles are integrated, so that the microspheres are endowed with the characteristics (such as good fluidity, high specific surface area and injectability), and the nano particles are endowed with the characteristics (such as anti-inflammation, cell adhesion target providing and the like).

Description

Technical Field

[0001] The invention belongs to the technical field of biomedical tissue engineering, and in particular relates to a universal nanoparticle composite hydrogel microsphere capable of regulating the inflammatory microenvironment of an injury site and carrying cells. Background Art

[0002] The main problem in the field of tissue regeneration is local cell and tissue damage caused by inflammation and peroxide accumulation, which in turn causes slow cell and tissue regeneration or local necrosis. The introduction of anti-inflammatory small molecules or materials can effectively improve the inflammatory environment and promote local tissue regeneration. For large-area injuries or tissue necrosis, areas with weak self-tissue regeneration ability (for example, nerve or spinal cord regeneration) usually require in situ injection of allogeneic or allogeneic ectopic cells to assist tissue regeneration. However, severe cell loss after transplantation, low survival and differentiation rates, greatly reduce the efficiency of treatment.

[0003] In the related art, hydrogels and implantable scaffolds are often used as three-dimensional matrices for cell transplantation. However, due to the lack of large pores in hydrogels, it is usually not conducive to nutrient exchange and neural network formation, and the survival rate and integration of transplanted cells in the body are not ideal. In addition, the non-injectability of implanted scaffolds increases the difficulty of transplantation and limits its clinical application. In addition, microsphere materials, as new materials, can also be used for large-scale cell culture, thereby promoting the development of new stem cell medicine, medical beauty, 3D culture and other fields, but its current scope of application is still insufficient.

[0004] Therefore, it is necessary to develop nanoparticle composite hydrogel microspheres that can regulate local microenvironment inflammation and carry cells. Summary of the invention

[0005] The first aspect of the present invention aims to provide a hydrogel microsphere comprising polydopamine (PDA) nanoparticles.

[0006] The purpose of the second aspect of the present invention is to provide a method for preparing the hydrogel microspheres containing polydopamine nanoparticles according to the first aspect.

[0007] The third aspect of the present invention aims to provide use of the hydrogel microspheres containing polydopamine nanoparticles according to the first aspect of the present invention in the preparation of products for tissue regeneration.

[0008] The fourth aspect of the present invention aims to provide a product.

[0009] The purpose of the fifth aspect of the present invention is to provide a method for preparing the product of the fourth aspect of the present invention.

[0010] In order to achieve the above object, the technical solution adopted by the present invention is:

[0011] The first aspect of the present invention provides a hydrogel microsphere comprising polydopamine nanoparticles, wherein the polydopamine nanoparticles are dispersed in the hydrogel microsphere.

[0012] Hydrogel microspheres refer to hydrogels prepared into spherical gels within the micron (μm) size range.

[0013] Preferably, the raw materials for preparing the hydrogel microspheres include: polydopamine nanoparticles and hydrogel precursors.

[0014] Preferably, the hydrogel precursor comprises at least one of methacrylated gelatin, methacrylated hyaluronic acid, methacrylated sodium alginate, methacrylated silk fibroin, methacrylated dextran, and methacrylated chitosan; further comprises methacrylated gelatin.

[0015] Preferably, the mass ratio of the polydopamine nanoparticles to the hydrogel precursor is 1:(40-200); further 1:(40-100); further 1:(40-60).

[0016] Preferably, the particle size of the polydopamine nanoparticles is 80 to 800 nm; further, 90 to 700 nm; further, 90 to 110 nm.

[0017] Preferably, the polydopamine nanoparticles are prepared by an alcohol-water method or a sodium hydroxide method.

[0018] Preferably, the preparation process of the polydopamine nanoparticles using the alcohol-water method is as follows: alcohol and ammonia water are mixed for the first time, the obtained first mixed solution is mixed with dopamine hydrochloride for the second time, and the obtained second mixed solution is reacted to obtain the dopamine nanoparticles.

[0019] Preferably, the first mixed liquid further comprises water.

[0020] Preferably, the water is ultrapure water.

[0021] Preferably, the concentration of the alcohol in the first mixed solution is 25-35% by volume; further 28-32% by volume.

[0022] Preferably, the concentration of the aqueous ammonia in the first mixed solution is 0.05-0.5% w / v; further 0.07-0.3% w / v; further 0.26-0.3% w / v.

[0023] Preferably, the alcohols are anhydrous alcohols.

[0024] Preferably, the concentration of dopamine hydrochloride in the second mixed solution is 0.1-10 mg / mL; further 1-5 mg / mL; further 2 mg / mL.

[0025] Preferably, the alcohol comprises at least one of methanol, ethanol and pentanediol; further comprises ethanol.

[0026] Preferably, the first mixing is stirring; further stirring is performed at 800-1200 rpm for 25-35 min.

[0027] Preferably, the reaction time is 14 to 22 hours; further 16 to 20 hours; further 18 hours.

[0028] Preferably, the reaction further comprises a solid-liquid separation step.

[0029] Preferably, the solid-liquid separation method comprises at least one of centrifugation and dialysis.

[0030] Preferably, the centrifugal conditions are 12000-18000 rpm for 5-11 min; further, 148000 rpm for 10 min.

[0031] Preferably, the cutoff of the dialysis bag in the dialysis is 1 to 50 kDa; further 2 to 20 kDa; further 12 to 14 kDa.

[0032] Preferably, the dialysis time is 1 to 5 days; further 2 to 4 days; further 2.5 to 3.5 days.

[0033] Preferably, the solid-liquid separation further comprises a drying step; further preferably, the solid-liquid separation further comprises a freeze-drying step.

[0034] Preferably, the preparation process of the polydopamine nanoparticles using the sodium hydroxide method is as follows: dopamine hydrochloride and sodium hydroxide are mixed and reacted to obtain polydopamine nanoparticles.

[0035] Preferably, the mass ratio of dopamine hydrochloride to sodium hydroxide is (4.7-11.3):1.

[0036] Preferably, the reaction time is 4 to 18 hours; further 4 to 12 hours; further 6 hours.

[0037] Preferably, the reaction temperature is 20-70°C; further preferably 50°C.

[0038] Preferably, the reaction further comprises a solid-liquid separation step.

[0039] Preferably, the solid-liquid separation method is centrifugation.

[0040] Preferably, the centrifugal conditions are 12000-18000 rpm for 5-11 min; further, 14800 rpm for 10 min.

[0041] Preferably, a washing step is further included after the solid-liquid separation.

[0042] Preferably, the washing further comprises a drying step; further preferably, the washing further comprises a freeze-drying step.

[0043] Preferably, the raw materials for preparing the hydrogel microspheres further include: a photoinitiator.

[0044] Preferably, the photoinitiator comprises at least one of photoinitiator 2959, methylene blue, tetrachlorofluorescein disodium salt, and lithium phenyl-2,4,6-trimethylbenzoylphosphonate (LAP); further lithium phenyl-2,4,6-trimethylbenzoylphosphonate.

[0045] Preferably, the mass ratio of the hydrogel precursor to the photoinitiator is 20:1 to 120:1; further 20:1 to 60:1; further 30:1 to 50:1; further 40:1.

[0046] Preferably, the raw materials for preparing the hydrogel microspheres further include: an aqueous medium.

[0047] Preferably, the aqueous medium comprises at least one of water, physiological saline, and phosphate buffer; further DPBS.

[0048] The second aspect of the present invention provides a method for preparing the hydrogel microspheres containing polydopamine nanoparticles according to the first aspect of the present invention, comprising mixing the polydopamine nanoparticles and a hydrogel precursor, and cross-linking and curing them to obtain.

[0049] Preferably, the preparation method comprises at least one of an emulsification method, a microfluidic emulsion method, a liquid phase separation method, a mechanical grinding method, an emulsion polymerization method, and a spray method.

[0050] Preferably, the emulsification method comprises the following steps: mixing polydopamine nanoparticles, a hydrogel precursor and a photoinitiator to obtain a mixture; adding the mixture to oil, reacting, and precipitating hydrogel microspheres to obtain the hydrogel microspheres containing polydopamine nanoparticles.

[0051] Preferably, the mixing of the polydopamine nanoparticles, the hydrogel precursor and the photoinitiator comprises: mixing the polydopamine nanoparticles and the hydrogel precursor for the first time to obtain a mixture A; and mixing the obtained mixture A with the photoinitiator for the second time to obtain a mixture.

[0052] Preferably, the hydrogel precursor is a hydrogel precursor solution.

[0053] Preferably, the solvent of the hydrogel precursor solution is the aqueous medium in the first aspect of the present invention.

[0054] Preferably, the hydrogel precursor solution is prepared by mixing the hydrogel precursor with an aqueous medium and heating (preferably heating at 55 to 75° C. for 15 to 25 min) to dissolve the hydrogel precursor.

[0055] Preferably, the first mixing is ultrasonic mixing.

[0056] Preferably, the mixture is added to the oil through a needle.

[0057] Preferably, the temperature of the oil is 50-60°C.

[0058] Preferably, the oil is olive oil.

[0059] Preferably, the reaction comprises a process of stirring and ultraviolet light irradiation.

[0060] Preferably, the stirring is performed at 1000-1400 rpm for 30-120 min, and then the mixture is placed in an ice water bath and stirred continuously until the microgel is solidified.

[0061] Preferably, the ultraviolet light irradiation time is 5 to 15 minutes.

[0062] Preferably, the method for precipitating the hydrogel microspheres is to add acetone; further, to add pre-cooled acetone.

[0063] Preferably, the precipitation of the hydrogel microspheres further comprises the steps of solid-liquid separation and washing.

[0064] Preferably, the microfluidic method comprises the following steps: mixing polydopamine nanoparticles, a hydrogel precursor, and a photoinitiator to obtain an aqueous phase (inner phase); mixing Span80 and oil to obtain an oil phase (outer phase); preparing an oil-in-water solution by a microfluidic device, and then performing ultraviolet light curing to obtain the hydrogel microspheres containing polydopamine nanoparticles.

[0065] Preferably, the mixing of the polydopamine nanoparticles, the hydrogel precursor and the photoinitiator comprises: mixing the polydopamine nanoparticles and the hydrogel precursor for the first time to obtain a mixture A; and mixing the mixture A with the photoinitiator for the second time to obtain an aqueous phase (internal phase).

[0066] Preferably, the first mixing is ultrasonic mixing.

[0067] Preferably, the aqueous phase further comprises the aqueous medium in the first aspect of the present invention, which is added during the second mixing.

[0068] Preferably, the concentration of Span 80 in the oil phase is 10 to 30 wt %; further 15 to 25 wt %.

[0069] Preferably, after the ultraviolet light curing, the steps of solid-liquid separation and washing are further included.

[0070] The third aspect of the present invention provides use of the hydrogel microspheres comprising polydopamine nanoparticles according to the first aspect of the present invention in the preparation of a product for tissue regeneration.

[0071] Preferably, the product has antioxidant and / or anti-inflammatory effects.

[0072] Preferably, the product further comprises at least one of cells and drugs; and further comprises cells.

[0073] Preferably, the cells include at least one of stem cells, neural progenitor cells, lung progenitor cells, osteoblasts, and pancreatic islet cells; further include at least one of neural progenitor cells and lung progenitor cells; and further are neural progenitor cells.

[0074] Preferably, the stem cells include at least one of embryonic stem cells, parthenogenetic stem cells, induced pluripotent stem cells, mesenchymal stem cells, adipose stem cells, and umbilical cord blood stem cells; more preferably, the stem cells include embryonic stem cells.

[0075] Preferably, the stem cells are derived from mammals; further derived from primates, and further derived from humans.

[0076] Preferably, the embryonic stem cells are commercial human embryonic stem cell lines.

[0077] Preferably, the embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0078] Preferably, the drug comprises at least one of small molecule drugs, nucleic acid drugs, polypeptide drugs, and protein drugs.

[0079] Preferably, the product is at least one of a medicine and a medical material.

[0080] The fourth aspect of the present invention provides a product comprising the hydrogel microspheres containing polydopamine nanoparticles according to the first aspect of the present invention.

[0081] Preferably, the product further comprises at least one of cells and drugs; and further comprises cells.

[0082] Preferably, the cells include at least one of stem cells, neural progenitor cells, lung progenitor cells, osteoblasts, and pancreatic islet cells; further include at least one of neural progenitor cells and lung progenitor cells; and further are neural progenitor cells.

[0083] Preferably, the neural progenitor cells and / or lung progenitor cells are obtained by differentiation of stem cells.

[0084] Preferably, the preparation method of the neural precursor cells is as follows: culturing stem cells with a differentiation medium, wherein the differentiation medium comprises: N2, B27, ascorbic acid, glutamic acid, antibiotics, LDN, SB431542, DMEM / F12, and Neuro basalmedium.

[0085] Preferably, the antibiotic comprises at least one of penicillin and streptomycin.

[0086] Preferably, the culture time is 11 to 15 days; further 12 to 14 days; further 13 days.

[0087] Preferably, the culturing further comprises a step of culturing overnight in a stem cell culture medium containing a ROCK inhibitor.

[0088] Preferably, the ROCK inhibitor comprises at least one of Blebbistatin, HA-100, Y-27632, HA-1077, KD-025, Y-33075, and Narciclasine; further preferably, the ROCK inhibitor comprises Y-27632.

[0089] Preferably, the lung progenitor cells are prepared as follows: stem cells are cultured with DE medium, then cultured with AFE medium, and finally cultured with LPC medium;

[0090] The DE medium comprises MCDB131 medium, BSA, glucose, NaHCO3, vitamin C, GlutaMAX, antibiotics, Activin A, ChiR99021, and insulin-transferrin-selenium-aminoethanol;

[0091] The AFE medium contains Advanced DMEM / F12 medium, HEPES, N2, B27, GlutaMAX, antibiotics, SB431542, Noggin, SAG, FGF4, and ChiR99021;

[0092] The LPC culture medium contains Advanced DMEM / F12 medium, HEPES, N2, B27, GlutaMAX, antibiotics, DAPT, BMP4, FGF7, FGF10, ChiR99021, and RA.

[0093] Preferably, the culture time of the DE medium is 3 to 4 days.

[0094] Preferably, the culture time of the AFE medium is 4 to 7 days.

[0095] Preferably, the culture time of the LPC culture medium is 5 to 9 days.

[0096] Preferably, the antibiotics in the DE medium, AFE medium and LPC medium independently contain at least one of penicillin and streptomycin.

[0097] Preferably, the stem cells include at least one of embryonic stem cells, parthenogenetic stem cells, induced pluripotent stem cells, mesenchymal stem cells, adipose stem cells, and umbilical cord blood stem cells; more preferably, the stem cells include embryonic stem cells.

[0098] Preferably, the stem cells are derived from mammals; further derived from primates, and further derived from humans.

[0099] Preferably, the embryonic stem cells are commercial human embryonic stem cell lines.

[0100] Preferably, the embryonic stem cells are stem cells isolated or obtained from human embryos within 14 days of fertilization that have not undergone in vivo development.

[0101] Preferably, the drug comprises at least one of small molecule drugs, nucleic acid drugs, polypeptide drugs, and protein drugs.

[0102] Preferably, the product has antioxidant and / or anti-inflammatory effects.

[0103] Preferably, the product is at least one of a medicine and a medical material.

[0104] The fifth aspect of the present invention provides a method for preparing the product of the fourth aspect of the present invention, comprising mixing at least one of cells and drugs with the hydrogel microspheres containing polydopamine nanoparticles of the first aspect of the present invention to obtain.

[0105] Preferably, the cells are mixed with the hydrogel microspheres comprising polydopamine nanoparticles according to the first aspect of the present invention to obtain.

[0106] Preferably, the cells further include a process of resuspending the cells in a cell culture medium before mixing.

[0107] Preferably, the ratio of the cells to the hydrogel microspheres containing polydopamine nanoparticles of the first aspect of the present invention is (8.5×10 5 ~8.5×10 7 cells): 4 mg; further (1×10 6 ~1×10 7 cells): 4mg.

[0108] The beneficial effects of the present invention are:

[0109] The present invention provides a hydrogel microsphere containing polydopamine nanoparticles, which integrates polydopamine nanoparticles and micron particles, giving it both the characteristics of microspheres (such as good fluidity, high specific surface area, injectability, etc.) and the characteristics of nanoparticles (such as anti-inflammatory, providing cell adhesion targets, etc.);

[0110] It is made of pure synthetic materials and does not require the introduction of additional active small molecules and proteins to promote cell adhesion and exert anti-inflammatory effects. It is the most simplified and optimized anti-inflammatory, adhesion-promoting, injectable hydrogel microsphere system with great transformation prospects and potential.

[0111] It contains rich benzoquinone structure, so it has a dark brown color. It is a natural color indicator and can be used as a color indicator during in vivo transplantation.

[0112] The present invention provides a product containing hydrogel microspheres containing polydopamine nanoparticles, which can be used for tissue regeneration and has good antioxidant and anti-inflammatory effects; further, by adding cells to the product, it can promote cell regeneration in situ while achieving excellent functional recovery effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0113] Figure 1 The figures are performance result graphs of polydopamine (PDA) nanoparticles: wherein A is a scanning electron microscope surface morphology characterization graph of the PDA nanoparticles prepared in Examples 1 to 3; B is a liquid distribution performance graph of the PDA nanoparticles prepared in Examples 1 to 3; C is a graph showing the antioxidant efficacy results of the PDA nanoparticles prepared in Examples 1 to 3; and D is a live and dead cell staining graph of neural precursor cells treated with the PDA nanoparticles prepared in Examples 1 to 3.

[0114] Figure 2The bright field images, scanning electron microscope images, single microspheres and surface morphology images (microstructures), PBS dispersion images and transmission electron microscope images of the hydrogel microspheres prepared in Example 7 and Comparative Example 1 are shown from left to right in A. The bright field images, scanning electron microscope images (SEM), morphology images of single microspheres and their surface microstructures, PBS dispersion images and transmission electron microscope images (TEM) of the hydrogel microspheres prepared in Comparative Example 1 are shown from left to right in B. The bright field images, scanning electron microscope images (SEM), morphology images of single microspheres and their surface microstructures, PBS dispersion images and transmission electron microscope images (TEM) of the hydrogel microspheres prepared in Example 7 are shown from left to right in B.

[0115] Figure 3 It is a diagram of the stem cell differentiation steps and neural-related gene expression results in Example 8; wherein A is a differentiation flow chart and bright field image of the neural precursor cell spheres differentiated from stem cells in Example 8; B is the expression of neural precursor cell-related genes in different differentiation time periods in Example 8, wherein H1 is the expression of related genes in stem cells.

[0116] Figure 4 The figures are the results of in vitro cell safety and adhesion evaluation of polydopamine nanoparticles and hydrogel microspheres: A is a bright field image of the co-culture of neural precursor cell beads and hydrogel microspheres in Example 2; B is a bright field image of the neural precursor cell beads after co-culture with microspheres on the Matrigel plate in Example 8 with neural axons; C is a graph of the trypan blue live cell staining results in Example 2 and Example 8; D is a graph of the adhesion results of the neural precursor beads in Example 3 after co-culture on the surface of hydrogel microspheres for 7 days; E is a graph of the adhesion results of the neural precursor beads in Example 9 after co-culture on the surface of hydrogel microspheres for 7 days.

[0117] Figure 5 It is a schematic diagram of the hydrogel microspheres prepared in Example 9 and Comparative Example 3 being used for in situ injection in rats with spinal cord injury.

[0118] Figure 6 This is a graph showing the BBB score results of the hydrogel microspheres prepared in Example 9 and Comparative Example 3 after in situ injection into rats with spinal cord injury.

[0119] Figure 7 The hydrogel microspheres prepared in Example 9 and Comparative Example 3 were injected in situ into the spinal cord tissue of rats with spinal cord injury 28 days later with fluorescent staining and H&E staining results.

[0120] Figure 8 The hydrogel microspheres prepared in Example 9 and Comparative Example 3 were used for in situ injection of inflammatory factors in the spinal cord tissue of rats with spinal cord injury 28 days later. * indicates p < 0.05; *** indicates p < 0.001.

[0121] Fig. 9 The diagram is a step and bright field diagram of differentiation of stem cells into lung foregut stage glomeruli in Example 10; wherein A is a flow chart of differentiation of stem cells into lung foregut stage glomeruli in Example 10; B is a bright field diagram of self-aggregation of foregut stage glomeruli in Example 10; C is a diagram of adhesion of lung progenitor cells after 7 days of culture in Example 10 and Comparative Example 4 to the surface of hydrogel microspheres in Example 7; D is a diagram of adhesion of lung progenitor cells after 7 days of culture in Example 10 and Comparative Example 4 to the surface of hydrogel microspheres in Comparative Example 5. DETAILED DESCRIPTION

[0122] The present invention is further described in detail below through specific examples.

[0123] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0124] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The materials and reagents used in the examples are commercially available unless otherwise specified.

[0125] Example 1 Preparation of polydopamine (PDA) nanoparticles

[0126] A method for preparing polydopamine (PDA) nanoparticles, which adopts an alcohol-water method, and the specific method is as follows: first, 12 mL of anhydrous ethanol, 28 mL of ultrapure water, and 0.4 mL of ammonia water (concentration of 28% w / v) are added to a flask to obtain an alcohol / ammonia / water mixed solution (the final concentration of the alcohol is about 30% v / v, and the final concentration of the ammonia water is about 0.28% w / v), and the bottle mouth is covered with a breathable rubber stopper / tin foil (a breathable rubber stopper is used in this embodiment) to ensure exchange with the outside air; a magnetic stirrer is stirred at 1000 rpm for 30 minutes; then a deionized water solution of dopamine hydrochloride (transparent and colorless) is added to the above alcohol / ammonia / water mixed solution, and the final concentration of dopamine hydrochloride is 2 mg / mL, and the solution quickly turns light yellow, and the color gradually decreases with time. It turns dark brown and finally black. After 18 hours of reaction, centrifuge at 14800rpm for 10 minutes in an ultracentrifuge, then carefully pour out the supernatant and discard it. The black precipitate at the bottom of the tube is the PDA nanoparticles (the centrifugation step can also be replaced by a dialysis step, as follows: the solution after 18 hours of reaction is dialyzed in deionized water (DI) with a dialysis bag with a cutoff of 12kDa for 3 days, and then freeze-dried at -80°C to obtain PDA nanoparticles; the centrifugation step is used in this embodiment), and the centrifugation is repeated until the supernatant is transparent or becomes transparent light yellow; the PDA nanoparticle precipitate is placed in a -80°C refrigerator and frozen for 18 hours, ensuring that it is quickly transferred to a freeze dryer for freeze drying in a frozen state; PDA nanoparticles with a particle size of about 100nm are obtained.

[0127] Example 2 Preparation of polydopamine (PDA) nanoparticles

[0128] A method for preparing polydopamine (PDA) nanoparticles, compared with Example 1, has the following differences: the contents of anhydrous ethanol, ultrapure water, and ammonia water are 12 mL, 28 mL, and 0.2 mL, respectively (i.e., the final concentration of alcohol in the obtained alcohol / ammonia / water mixture is about 30% v / v, and the final concentration of ammonia water is about 0.14% w / v), and PDA nanoparticles with a particle size of about 300 nm are obtained.

[0129] Example 3 Preparation of polydopamine (PDA) nanoparticles

[0130] A method for preparing polydopamine (PDA) nanoparticles, compared with Example 1, has the following differences: the contents of anhydrous ethanol, ultrapure water, and ammonia water are 12 mL, 28 mL, and 0.1 mL, respectively (i.e., the final concentration of alcohol in the obtained alcohol / ammonia / water mixture is about 30% v / v, and the final concentration of ammonia water is about 0.07% w / v), and PDA nanoparticles with a particle size of about 700 nm are obtained.

[0131] Example 4 Preparation of polydopamine (PDA) nanoparticles

[0132] A method for preparing polydopamine (PDA) nanoparticles adopts a sodium hydroxide method, and the specific method is as follows: adding a 1M NaOH solution to a 2mg / mL dopamine hydrochloride deionized water solution, and adjusting the particle size of the PDA nanoparticles by adjusting the volume of the added NaOH, wherein the volume ratio of the dopamine hydrochloride deionized water to the NaOH solution is 95; after self-polymerization for 6 hours, centrifuging (14800rpm, 10 minutes) to obtain PDA nanoparticles, and washing with deionized water for several times until the supernatant becomes clear; placing the PDA nanoparticle precipitate in a -80°C refrigerator for 18 hours, and ensuring that it is quickly transferred to a freeze dryer for freeze drying in a frozen state; and obtaining PDA nanoparticles with a particle size of about 100.

[0133] Example 5 Preparation of polydopamine (PDA) nanoparticles

[0134] A method for preparing polydopamine (PDA) nanoparticles, compared with Example 4, has the following differences: the particle size of the PDA nanoparticles is regulated by adjusting the volume of added NaOH, the volume ratio of dopamine hydrochloride deionized water to NaOH solution is 1:18, and PDA nanoparticles with a particle size of about 300 nm are obtained.

[0135] Example 6 Preparation of polydopamine (PDA) nanoparticles

[0136] A method for preparing polydopamine (PDA) nanoparticles, compared with Example 4, has the following differences: the particle size of the PDA nanoparticles is regulated by adjusting the volume of added NaOH, the volume ratio of dopamine hydrochloride deionized water to NaOH solution is 2:25, and PDA nanoparticles with a particle size of about 700 nm are obtained.

[0137] Example 7 Preparation of universal nanoparticle composite hydrogel microspheres capable of regulating the inflammatory microenvironment at the injury site and carrying cells

[0138] A general method for preparing nanoparticle composite hydrogel microspheres capable of regulating the inflammatory microenvironment of the injury site and carrying cells adopts an emulsification method, and the specific method is as follows: first, methacrylated gelatin (GelMA, Suzhou Yongqinquan Intelligent Equipment Co., Ltd., EFL-GM-60) is dissolved in DPBS (pH 7.4) to form a 10wt% GelMA (heated at 65°C for 20 minutes, shaken until fully dissolved) precursor solution; the PDA nanoparticle powder prepared in Example 1 is added to make its final concentration 2mg / mL, and can be evenly dispersed in the GelMA precursor solution by ultrasound; a photoinitiator (phenyl-2,4,6-pyrrolidone) with a final concentration of 0.25wt% is added to the nanoparticle suspension GelMA precursor solution; -lithium trimethylbenzoylphosphonate, LAP); the PDA nanoparticle suspension GelMA precursor solution with the addition of a photoinitiator is added dropwise to the olive oil preheated at 55°C using a 25gauce needle at a rate of 1 drop / S (about 20 μL / S), stirred at 1200 rpm for 15 minutes, continued to stir at room temperature for 30 minutes, and then continued to stir in an ice-water bath for 30 minutes to solidify the microgel, and then irradiated the microgel with an ultraviolet lamp for 10 minutes to chemically cross-link the microgel; then 15 mL of acetone precooled at 4°C was added to the oil-water mixed solution to precipitate the microgel, and continued to stir in an ice-water bath for 30 minutes; the microgel was separated from the olive oil and acetone by vacuum filtration, and the microgel was further washed with acetone until the microspheres were dry black microspheres.

[0139] Example 8 Preparation of Nanoparticle Composite Hydrogel Microspheres Carrying Neural Progenitor Cells

[0140] A method for preparing nanoparticle composite hydrogel microspheres carrying neural precursor cells comprises the following steps:

[0141] 1. Preparation of neural progenitor cells: Embryonic stem cells (H1, purchased from Wicell) were digested into single cells (D0) using cell digestion solution Accutase (1 mg / mL, StemCell, 07920), and plated on Matrigel (Corning, 354277) coated plates at a ratio of 1:6, and cultured overnight in stem cell culture medium (mTeSR, StemCell, 85850) containing 10 μM Y-27632 (Stemcell, 72307); on the next day, the culture medium was replaced with differentiation medium neural epithelial progenitors (NEPs), wherein the NEPs formula was: DMEM / F12 (Thermo, 11320033) and Neuro basal medium (Thermo Fisher, 21103049) in a volume ratio of 1:1, 0.5×N2 (Thermo Fisher, 17502048), 0.5×B27 (Thermo Fisher, 17504044), 0.1 mM ascorbic acid (Sigma, A4544-100G), 1× glutamate (GlutaMax, Thermo Fisher Scientific, 35050061) and 1× penicillin / streptomycin (penicillin / streptomycin, Thermo Fisher Scientific, 15140122), 0.1 μM LDN 212854 (5-(6-(4-(1-piperazinyl)phenyl)pyrazolo[1,5-a]pyrimidin-3-yl)quinoline) (MCE, HY-12071) and 2 μM SB431542 (MCE, HY-10431), the culture medium was changed every other day, and the neural rosette structure could be vaguely seen after 6 days of maintenance at 37°C and 5% CO2 (D6); the cells were cultured in NEPs medium for 7 days, and the cells were digested and suspended to form neural precursor spheres (D13);

[0142] 2. Sterilization of nanoparticle composite hydrogel microspheres: First, the nanoparticle composite hydrogel microspheres prepared in Example 7 were soaked in 75% alcohol for one hour, and the centrifuge tube was vigorously shaken every 10 minutes to fully exchange the alcohol inside and around the microspheres, and then the alcohol was removed and placed in a sterile clean bench overnight to fully evaporate the remaining alcohol, and then irradiated with ultraviolet light for 30 minutes before use;

[0143] 3. Add 20 mg of sterilized microspheres to 10 mL of NEPs culture medium; then use an ultrasonic device to sonicate the sterilized nanoparticle composite hydrogel microspheres under sterile conditions for 5 minutes (30 seconds on and 30 seconds off); transfer the solution containing nanoparticle composite hydrogel microspheres into a 24-well ultra-low attachment plate at a volume of 1 mL / well; add the neural progenitor cells obtained in step 1 to a 24-well plate containing microspheres at 250 μL, about 50 neural progenitor cell pellets / well, and culture at 37°C, 5% CO2 for 24 hours. Then transfer the neural pellets to a Matrigel-coated 24-well plate under a stereomicroscope to observe the adhesion of the neurospheres and the occurrence of neurons. Repeat 3 times (i.e., 3 wells).

[0144] Example 9 Preparation of Nanoparticle Composite Hydrogel Microspheres Carrying Neural Progenitor Cells

[0145] A method for preparing nanoparticle composite hydrogel microspheres carrying neural progenitor cells is the same as that of Example 8, except for step 3, which is as follows: 4 mg of sterilized microspheres are added to 2 mL of neural progenitor cells (8.5×10 6 cells / mL cell density), stored in a 2 mL syringe and kept on ice.

[0146] Example 10 Preparation of Nanoparticle Composite Hydrogel Microspheres Carrying Lung Progenitor Cells

[0147] A method for preparing nanoparticle composite hydrogel microspheres carrying lung progenitor cells comprises the following steps:

[0148] 1. Preparation of lung progenitor cells:

[0149] (1) Embryonic stem cells were maintained and cultured in stem cell culture medium (mTeSR, StemCell, 85850). When embryonic stem cells grew to 80% density, they were digested into single cells using Accutase and cultured at 1.6×10 6 cells / mL, add 500 μL of cell suspension into a 24-well plate, shake well and place in a 5% CO2 and 37°C incubator, replace stem cell culture medium every 24 hours, and proceed to the next step of differentiation culture when the cell density is close to 60%;

[0150] (2) Using DE medium to induce stem cells to differentiate into definitive endoderm cells: the formula of DE medium is: based on MCDB131 medium, 5 mg / mL BSA, 20 mM glucose (Glucose), 1.5 mg / mL NaHCO3, 0.25 mM vitamin C (Vitamin C), 1×GlutaMAX, 1×penicillin-streptomycin, 100 ng / mL Activin A, 3 μM ChiR99021, 0.002× insulin-transferrin-selenium-aminoethanol (ITS-X), DE medium is cultured for 3 days, and the medium is replaced every 24 hours;

[0151] (3) Using AFE medium to induce the definitive endoderm cells into anterior foregut endoderm spheres: The formula of AFE medium is: based on Advanced DMEM / F12 medium, 10mM HEPES, 1×N2, 1×B27, 1×GlutaMAX, 1×penicillin-streptomycin, 10μM SB431542, 200ng / mL Noggin, 1μM SAG, 500ng / ml FGF4, 2μM ChiR99021, the culture medium is replaced every 24 hours, and the culture is carried out for 3-4 days, and self-aggregated spheres appear floating in the culture medium;

[0152] (4) Inducing foregut endoderm spherules into lung progenitor cells using LPC medium: Collect spherules, digest and dissociate into foregut endoderm spherules (cell concentration 5×10 5 cells / mL), and were resuspended and coated in Matrigel droplets for culture using LPC culture medium. The LPC culture medium formula was as follows: based on Advanced DMEM / F12 culture medium, 10 mM HEPES, N2 (1:100), B27 (1:50), GlutaMAX (1:100), 1% penicillin-streptomycin, 20 μM DAPT, 20 ng / mL BMP4, 10 ng / mL FGF7, 10 ng / mL FGF10, 3 μM ChiR99021, and 50 μM RA. The culture medium was replaced every 24 hours for a total of 7 days.

[0153] 2. Sterilization of nanoparticle composite hydrogel microspheres: First, the nanoparticle composite hydrogel microspheres prepared in Example 7 were soaked in 75% alcohol for one hour, and the centrifuge tube was vigorously shaken every 10 minutes to fully exchange the alcohol inside and around the microspheres, and then the alcohol was removed and placed in a sterile clean bench overnight to fully evaporate the remaining alcohol, and then irradiated with ultraviolet light for 30 minutes before use;

[0154] 3. A method for preparing nanoparticle composite hydrogel microspheres carrying lung progenitor cells, as follows: 4 mg of sterilized microspheres were added to 2 mL of lung progenitor cells (8.5×10 6 After mixing with 500 μL lung progenitor cell culture medium, wait for the microspheres to fully absorb the culture medium and swell, then transfer them to a 24-well plate using a 1 mL syringe, add 500 μL lung progenitor cell culture medium, and culture the medium every other day to observe the adhesion of lung progenitor cells on the microsphere surface.

[0155] Comparative Example 1 Preparation of hydrogel microspheres

[0156] A method for preparing hydrogel microspheres is the same as that of Example 7, except that PDA nanoparticles are not added.

[0157] Comparative Example 2 Preparation of hydrogel microspheres carrying neural precursor cells

[0158] A method for preparing hydrogel microspheres carrying neural precursor cells is the same as that of Example 8, except that the hydrogel microspheres prepared in Comparative Example 1 are used.

[0159] Comparative Example 3 Preparation of hydrogel microspheres carrying neural precursor cells

[0160] A method for preparing hydrogel microspheres carrying neural precursor cells is the same as that of Example 9, except that the hydrogel microspheres prepared in Comparative Example 1 are used.

[0161] Comparative Example 4 Preparation of hydrogel microspheres carrying lung progenitor cells

[0162] A method for preparing hydrogel microspheres carrying lung progenitor cells is the same as that of Example 10, except that the hydrogel microspheres prepared in Comparative Example 1 are used.

[0163] Comparative Example 5 Preparation of composite PLGA microspheres carrying lung progenitor cells

[0164] PDA nanoparticle composite PLGA (polylactide-co-glycolide) microspheres were prepared by emulsion evaporation. 15 mg of PLGA (MW = 38-54 kDa, LA: GA = 50: 50) and 4 mg of PDA nanoparticle powder prepared in Example 1 were dissolved in 0.5 mL of DCM (dichloromethane) and added to 5 mL of 1% PVA (polyvinyl alcohol, MW = 31-50 kDa) dissolved in distilled water. The mixture was then homogenized at 22,500 rpm for 5 minutes using a homogenizer. The obtained emulsion was then poured into 20 mL of 1% PVA and stirred for 4 hours with the lid open. Centrifuged 5 times at 3,000 rpm for 5 minutes, then reconstituted in distilled water to obtain microspheres and purified. Finally, the microspheres were lyophilized and stored at -20 ° C for further experiments.

[0165] Composite PLGA microspheres carrying lung progenitor cells were prepared using the same preparation method as in Examples 8, 9, and 10.

[0166] Effect Example

[0167] 1. The PDA nanoparticles prepared in Examples 1 to 3 were tested using a scanning electron microscope. The results are as follows: Figure 1 As shown in A (from left to right in A are scanning electron microscope images of PDA nanoparticles prepared in Examples 1, 2, and 3 respectively): It can be seen that PDA nanoparticles were indeed prepared in Examples 1 to 3. The PDA nanoparticles prepared in Examples 4 to 6 were tested, and the results were similar to those in Examples 1 to 3.

[0168] 2. PDA nanoparticles were dispersed using DPBS solvent. The results are as follows Figure 1 As shown in B (from left to right in B are bright field images of PDA nanoparticles prepared in Examples 1, 2, and 3): PDA nanoparticles have good dispersibility in DPBS, and the color of the solution deepens as the particle size of the nanoparticles increases. The PDA nanoparticles prepared in Examples 4 to 6 were tested, and the results were similar to those in Examples 1 to 3.

[0169] 3. The antioxidant function of the PDA nanoparticles prepared in Examples 1 to 3 was determined by the DPPH method: DPPH· is a stable nitrogen free radical, which is widely used in antioxidant tests, and its maximum absorption peak appears at 516nm; DPPH· is dispersed in 95% ethanol with a final concentration of 100μM; 3mL of DPPH· solution was taken, and the same volume of solution containing 0, 1.56, 3.125, 6.25, 12.5, 25, 50, 100μg of the PDA nanoparticle samples prepared in Examples 1 to 3 or vitamin C was added, and then reacted in the dark for 30min, and the absorbance value of the mixed solution at 516nm was detected; scavenging activity (scavenging activity activity)=[1-(Ai-Aj)÷Ac]×100%; where Ac is the absorbance of DPPH·solution at 516nm, Ai is the absorbance of NPs+DPPH·solution (PDA nanoparticles or vitamin C solution+DPPH·solution) at 516nm, and Aj is the absorbance of PDA nanoparticles or vitamin C solution at 516nm. The results are as follows Figure 1 As shown in Figure C, the antioxidant performance of PDA nanoparticles with a particle size of 100 nm is greater than that of PDA nanoparticles with a particle size of 300 nm and greater than that of PDA nanoparticles with a particle size of 700 nm; wherein, the antioxidant performance of PDA nanoparticles with a particle size of 300 μm is similar to that of vitamin C. The PDA nanoparticles prepared in Examples 4 to 6 were tested, and the results were similar to those in Examples 1 to 3.

[0170] 4. The cell compatibility of the PDA nanoparticles of Examples 1 to 3 was tested by using the live-dead cell staining method. Figure 1 As shown in D: Ctrl represents the control group of neural progenitor cells not treated with PDA nanoparticles, which has the most dead cells. The PDA nanoparticle group has fewer dead cells than the control group. As the particle size of the nanoparticles decreases, the number of dead cells decreases successively, among which the PDA nanoparticle group with a particle size of 100nm has the least dead cells.

[0171] 5. The hydrogel microspheres of Example 7 and Comparative Example 1 were tested by optical microscopy (PBS dispersion diagram), scanning electron microscopy (single microsphere, microstructure), and transmission electron microscopy. The results are as follows: Figure 2 As shown: the PDA nanoparticle composite microspheres prepared in Example 7 are brown-black in color and have the function of a natural color indicator.

[0172] 6. Observe the process of stem cell differentiation into neural glomeruli in Example 8, observe and record the state of stem cells, neural rosette structure and neural precursor cell glomeruli morphology, and evaluate the differentiation efficiency. The results are as follows: Figure 3As shown: the neural precursor cells obtained by differentiation for 13 days have high expression of neural specific markers (NEUROG2: TGGGTCTGGTACACGATTGC (forward), SEQ ID NO: 9; GGGTCTCGATCTTGGTGAGC (reverse), SEQ ID NO: 10; SOX1: AATACTGGAGACGAACGCCG (forward), SEQ ID NO: 11, CCTCTCGCCTCGTTTTGACT (reverse), SEQ ID NO: 12; PAX6: CGAATTCTGCAGGTGTCCAA (forward), SEQ ID NO: 13; ACAGACCCCCTCGGACAGTAAT (reverse), SEQ ID NO: 14).

[0173] 7. After the neural progenitor cell pellets cultured for 13 days in Example 8 and Comparative Example 2 were co-cultured with the microspheres for 24 hours, the neural progenitor cell pellets were taken out and cultured in a 24-well plate covered with Matrigel, and the synaptic formation of the neurons in the neural pellets and trypan blue staining were observed and recorded. The results are as follows: Figure 4 As shown in Figures AC: It shows that the hydrogel microspheres in Example 8 and Comparative Example 2 have good safety.

[0174] 8. Observe the adhesion of neural progenitor cells on the surface of hydrogel microspheres after 7 days of culture in Example 9 and Comparative Example 3 (i.e., take 50 μl of microspheres prepared in Example 9 and Comparative Example 3 and culture them in a 24-well plate at 37°C and 5% CO2 for 7 days to observe the adhesion of neural cells and neural regeneration). The results are as follows: Figure 4 As shown in Figures DE: The hydrogel microspheres prepared in Comparative Example 1 have a weaker ability to carry neural precursor cells, while the nanoparticle composite hydrogel microspheres prepared in Example 9 with the addition of PDA nanoparticles significantly increase the adhesion of neural precursor cells to the hydrogel microspheres. The hydrogel microspheres prepared in Comparative Example 5 do not improve the adhesion of neural precursor cells as much as Example 9.

[0175] 9. Inject the nanoparticle composite hydrogel microspheres loaded with neural progenitor cells prepared in Example 9 into animals to observe their effects on regulating inflammation in the injured microenvironment and functional recovery of the animals

[0176] (1) Spinal cord injury rat model

[0177] With T8-T9 of the rat as the center, a dorsal incision was made to expose the T10 spinal cord. The spinal cord was completely lifted up with a blunt hook needle, and a surgical suture was passed between the ventral dura mater and the vertebral canal to the opposite side. The spinal cord was gently lifted up and the spinal cord was transected at the level of the T8 spinal cord segment with microscissors. The suture was pulled out from the fracture to ensure complete transection, resulting in a defect of about 3 mm. At the moment of injury, the rat had spasmodic tail swinging, and both lower limbs and torso retracted and fluttered before both lower limbs became paralyzed, which was a sign of successful modeling.

[0178] (2) After sufficient hemostasis, 200 μL of the hydrogel microspheres prepared in Example 9 and Comparative Example 3 were injected into the spinal cord defect so that they were in close contact with the spinal cord injury section, and then the muscles, fascia and skin were sutured layer by layer. Figure 5 ), the groups included a cell group (injected with an equal amount of neural progenitor cells, a control group, Control), a GelMA microsphere combined with a neural progenitor cell group (Comparative Example 3, a GelMA microsphere group, Microgel), and a PDA nanoparticle composite GelMA microsphere carrying a neural progenitor cell group (Example 9, a PDA-GelMA composite microsphere group, Nano-Microgel), and the material transplantation (the day of material transplantation was recorded as day 0) was successful and the rats did not show rejection reactions. Five rats in each group.

[0179] (3) Behavioral observation (BBB) ​​scoring

[0180] 1) This score divides the rat hind limb movement into three parts and 22 levels: complete hind limb paralysis is 0 points, and completely normal is 21 points: the first part is 0-7 points, which evaluates the hind limb joint movement in the early stage of recovery; the second part is 8-13 points, which evaluates the gait and coordinated movement in the middle stage of recovery; the third part is 14-21 points, which evaluates the fine movement of the toes during movement and evaluates the motor function after surgery.

[0181] 2) Scoring site requirements: 1 square meter fence.

[0182] 3) Time point: Behavioral scores were performed on animals in each group 1, 3, 7, 14 and 28 days after surgery.

[0183] 4) Scoring procedure: According to the activity pattern of rats, the scoring process was carried out at 19:00 in the evening. The movement and coordination of the hip, knee, ankle joints and toes of the hind limbs of the rats were observed during the activities. The observation time was five minutes, and the results were taken as the average value.

[0184] The results are as follows Figure 6As shown: the BBB score of the nanoparticle composite hydrogel microspheres carrying neural progenitor cells of the present invention (Example 9, adding PDA nanoparticles) is much higher than that of the hydrogel microspheres carrying neural progenitor cells (Comparative Example 3, without adding PDA nanoparticles). It can be seen that the present application improves the function of neural progenitor cells in recovering spinal cord injury by adding PDA nanoparticles to the hydrogel microspheres. However, the hydrogel microspheres prepared in Comparative Example 3 do not improve the function of neural progenitor cells in recovering spinal cord injury as much as Example 9.

[0185] (4) Tissue sample collection and analysis

[0186] 1) 28 days after transplantation, rats were euthanized: after intraperitoneal anesthesia with 10% chloral hydrate (300 mg / kg), the rats were fixed in supine position, and the chest cavity was exposed: aorta catheterization was performed, 250 mL of normal saline was quickly washed for 5 minutes, and 4% paraformaldehyde was perfused from the left ventricle to the ascending aorta, with a speed first fast and then slow, and the perfusion fixation was performed for 30 minutes.

[0187] 2) The spinal cord tissue was removed to observe the gross morphology, and the length of bleeding, redness and swelling above and below the transverse section, the length and circumference of the scar were measured respectively. Then, with the spinal cord at the transverse section as the center, about 1.5 cm of spinal cord tissue was removed and fixed with 4% paraformaldehyde, retaining about 0.5 cm of spinal cord on both sides of the transverse section for subsequent pathological detection.

[0188] 3) For gene level detection, about 0.5 cm of rat spinal cord tissue was collected into a centrifuge tube containing RLT, fully ground with a tissue grinder, and then mRNA was extracted and transcribed using a TAKARAMRNA kit. Inflammatory factors in the spinal cord were detected by QPCR. Among them, the primers for each inflammatory factor are as follows: iNOS: GGAGCGAGTTGTGGATTGTC (SEQ ID NO: 1) / CAGCCTCTTGTCTTTGACCC (SEQ ID NO: 2); TNF-α: CAGAAAGCAT GATCCGCGAC (SEQ ID NO: 3) / ATCCCTTTGGGGACCGATCA (SEQ ID NO: 4); IL-6: ATAGTCCTTCCTACCCCAATTTCC (SEQ ID NO: 5) / GATGAATTGGATGGTCTTGGTCC (SEQ ID NO: 6); GADPH: ACTTGAAGGGTGGAGCCAAA (SEQ ID NO: 7) / GCCCTTCCA CAATGCCAAAG (SEQ ID NO: 8).

[0189] The results of fluorescence staining and H&E staining of spinal cord tissue 28 days after transplantation are as follows Figure 7As shown: the cell group suffered from severe cell loss due to the lack of a hydrogel carrier, and the spinal cord section was not repaired; the spinal cord section of the GelMA microsphere combined with neural precursor cell group was slightly repaired, and green fluorescent cells were seen distributed in a scattered manner, and no neural cell network structure was formed; the spinal cord section of the PDA nanoparticle composite GelMA microsphere loaded with neural precursor cell group was basically connected, and a large number of cells were seen to form a neural cell network structure.

[0190] The results of QPCR detection of inflammatory factors in spinal cord tissue 28 days after transplantation are as follows Figure 8 As shown: the expression of inflammatory factors in the GelMA microspheres combined with neural progenitor cells group was not significantly different from that in the control group, while the expression of inflammatory factors in the PDA nanoparticles combined with GelMA microspheres carrying neural progenitor cells group was significantly lower than that in the control group. The anti-inflammatory effect of the hydrogel microspheres carrying neural progenitor cells prepared in Comparative Example 3 was not as good as that in Example 9.

[0191] 10. Observe the process of stem cell differentiation into foregut stage spherules in Example 10, observe and record the morphology and spherule formation efficiency of foregut stage spherules. After the stem cells are plated, mTeSR is replaced every day. When the cell density is close to 60%, DE differentiation medium is added to direct the differentiation of stem cells into endoderm cells. DE medium is replaced every 24 hours. After 3 days of culture, AFE medium is replaced and culture is continued for 3-4 days. The foregut endoderm cells will form spheres separated from the adherent cells and floating in the culture medium (such as Fig. 9 Without destroying the adherent cells, the foregut stage pellets floating in the culture medium were transferred to a centrifuge tube and allowed to settle for 10-15 minutes. The residual culture medium was washed off with DPBS and then digested with Accutase to single cells (cell concentration was 5×10 5 cells / mL), resuspended in LPC medium and coated in Matrigel droplets for culture, and lung progenitor cells were collected after 7 days (such as Fig. 9 Lung progenitor cells were cultured at 8.5×10 6 The PDA nanoparticles composite GelMA or PLGA microspheres prepared and sterilized in advance were added at a density of cells / mL.

[0192] The adhesion of lung progenitor cells cultured for 7 days on the surface of hydrogel microspheres in Example 10 and Comparative Example 5 was observed. Fig. 9 As shown in Figures CD, the results show that the nanoparticle composite hydrogel microspheres prepared in Example 10 with the addition of PDA nanoparticles (Figure C) significantly increased the adhesion of lung progenitor cells to the hydrogel microspheres. However, the PLGA microspheres prepared in Comparative Example 5 (Figure D) did not improve the adhesion of lung progenitor cells as much as in Example 10.

[0193] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A hydrogel microsphere comprising polydopamine nanoparticles, wherein the polydopamine nanoparticles are dispersed in the hydrogel microsphere.

2. The hydrogel microsphere according to claim 1, characterized in that: The raw materials for preparing the hydrogel microspheres include: polydopamine nanoparticles and hydrogel precursors; Preferably, the hydrogel precursor comprises at least one of methacryloyl gelatin, methacryloyl hyaluronic acid, methacryloyl sodium alginate, methacryloyl silk fibroin, methacryloyl dextran, and methacryloyl chitosan; Preferably, the mass ratio of the polydopamine nanoparticles to the hydrogel precursor is 1:(40-200).

3. The hydrogel microsphere according to claim 2, characterized in that: The particle size of the polydopamine nanoparticles is 80 to 800 nm; Preferably, the polydopamine nanoparticles are prepared by an alcohol-water method or a sodium hydroxide method; Preferably, the preparation process of the polydopamine nanoparticles using the alcohol-water method is as follows: alcohol and ammonia water are mixed for the first time, the obtained first mixed solution is mixed with dopamine hydrochloride for the second time, and the obtained second mixed solution is reacted to obtain the dopamine nanoparticles; Preferably, the concentration of the alcohol in the first mixed solution is 25-35% by volume; Preferably, the concentration of the aqueous ammonia in the first mixed solution is 0.05-0.5% w / v; Preferably, the concentration of dopamine hydrochloride in the second mixed solution is 0.1-10 mg / mL; Preferably, the alcohol comprises at least one of methanol, ethanol and pentanediol; Preferably, the alcohol is anhydrous alcohol; Preferably, the preparation process of the polydopamine nanoparticles using the sodium hydroxide method is as follows: dopamine hydrochloride is mixed with sodium hydroxide to obtain polydopamine nanoparticles; Preferably, the mass ratio of dopamine hydrochloride to sodium hydroxide is (4.7-11.3):

1.

4. The hydrogel microsphere according to claim 2 or 3, characterized in that: The raw materials for preparing the hydrogel microspheres further include: a photoinitiator; Preferably, the hydrogel precursor is methacrylated gelatin; Preferably, the photoinitiator comprises at least one of photoinitiator 2959, methylene blue, tetrachlorofluorescein disodium salt, and phenyl-2,4,6-trimethylbenzoylphosphonate lithium; Preferably, the photoinitiator is lithium phenyl-2,4,6-trimethylbenzoylphosphonate; Preferably, the mass ratio of the hydrogel precursor to the photoinitiator is 20:1 to 120:1; Preferably, the raw materials for preparing the hydrogel microspheres further include: an aqueous medium; Preferably, the aqueous medium comprises at least one of water, physiological saline, and phosphate buffer.

5. The method for preparing hydrogel microspheres containing polydopamine nanoparticles according to any one of claims 2 to 4, comprising mixing polydopamine nanoparticles and hydrogel precursors, cross-linking and curing to obtain.

6. The preparation method according to claim 5, characterized in that: The preparation method comprises at least one of an emulsification method, a microfluidics method, a liquid phase separation method, a mechanical grinding method, an emulsion polymerization method, and a spray method; Preferably, the emulsification method comprises the following steps: mixing polydopamine nanoparticles, a hydrogel precursor, and a photoinitiator to obtain a mixture; adding the mixture to oil, reacting, and precipitating hydrogel microspheres to obtain the hydrogel microspheres containing polydopamine nanoparticles; Preferably, the reaction comprises a process of stirring and ultraviolet light irradiation; Preferably, the microfluidic method comprises the following steps: mixing polydopamine nanoparticles, a hydrogel precursor, and a photoinitiator to obtain an aqueous phase; mixing Span80 and oil to obtain an oil phase; preparing an oil-in-water solution by a microfluidic device, and then performing ultraviolet light curing to obtain the hydrogel microspheres containing polydopamine nanoparticles.

7. Use of the hydrogel microspheres containing polydopamine nanoparticles according to any one of claims 1 to 4 in the preparation of products for tissue regeneration.

8. A product comprising the hydrogel microspheres containing polydopamine nanoparticles according to any one of claims 1 to 4.

9. The use or product according to any one of claims 7 to 8, characterized in that: The product further comprises at least one of a cell and a drug; Preferably, the cells include at least one of stem cells, neural progenitor cells, lung progenitor cells, osteoblasts, and pancreatic islet cells; Preferably, the drug comprises at least one of small molecule drugs, nucleic acid drugs, polypeptide drugs, and protein drugs; Preferably, the product is at least one of a medicine and a medical material.

10. A method for preparing the product according to claim 9, comprising mixing at least one of cells and drugs with the hydrogel microspheres containing polydopamine nanoparticles according to any one of claims 1 to 4 to obtain.

Images