Novel human-derived II type collagen COLII-14K-H as well as gene and application of novel human-derived II type collagen COLII-14K-H

Abstract

The invention provides a novel human-derived II-type collagen COLII-14K-H and a coding gene thereof, the coding gene is shown as SEQ ID NO.1, and the amino acid sequence is shown as SEQ ID NO.2. The invention further provides a preparation method of the novel human-derived II-type collagen COLII-14K-H. The invention also provides a preparation method of the human-derived II-type collagen COLII-14K-H and application of the human-derived II-type collagen COLII-14K-H in preparation of cartilage repair drugs, skin repair drugs and skin care products. The inventor-derived II-type collagen can obviously improve the gene expression level of the collagen, so that the content of the collagen in human dermal fibroblasts is improved, and the skin aging is delayed; meanwhile, the protein fragment can show a remarkable skin repairing effect at low concentration, provides a new treatment choice for skin repairing, and can be widely applied to the fields of skin repairing and nursing.

Description

Technical Field

[0001] The present invention relates to the fields of biotechnology and medical health, and in particular to a novel human type II collagen COLII-14K-H and its gene and application. Background Art

[0002] As an important member of the collagen family, type II collagen has shown a wide range of application potential in the biomedical field, especially in bone and joint health and biomaterials science. Its unique molecular structure and biological activity make type II collagen have irreplaceable advantages in promoting cartilage repair, enhancing joint function and serving as a basic component of biomaterials.

[0003] In the field of bone and joint health, type II collagen is one of the main components of cartilage tissue and is essential for maintaining joint flexibility and stability. With age or the influence of disease, cartilage tissue will gradually degenerate, leading to joint pain, stiffness and even dysfunction. The supplementation and application of type II collagen can stimulate the proliferation and differentiation of chondrocytes, promote the synthesis and repair of cartilage matrix, thereby effectively improving joint health and improving the quality of life of patients.

[0004] In addition, in the field of biomaterials science, type II collagen is widely used in tissue engineering scaffolds, drug carriers and regenerative medicine materials due to its good biocompatibility, degradability and bioactivity. Its performance can be further optimized by compounding or modifying with other biomaterials to meet different clinical needs. For example, biological scaffold materials based on type II collagen can simulate the microenvironment of natural cartilage tissue, guide cell growth and differentiation, and promote tissue regeneration and repair.

[0005] However, despite the remarkable achievements of type II collagen in the fields of bone and joint health and biomaterials science, its application in the field of skin health is relatively limited.

[0006] Skin wound healing is a highly complex and finely regulated biological process, covering a series of continuous and intertwined pathophysiological stages, including inflammation, proliferation, and remodeling. This series of processes is deeply rooted in an intricate network of interactions between multiple cell types, cytokines, growth factors, and extracellular matrices. Although there are some differences in the latest statistics on the number of chronic wound patients worldwide, a study in the journal Research and Reviews in Plant Science pointed out that approximately 13 million people worldwide suffer from chronic wounds each year. In view of this, finding safe and efficient wound healing material promoting ingredients has become a hot topic and focus of current biomedical research.

[0007] Modern scientific research has confirmed that the use of bioactive ingredients derived from nature, such as collagen, can significantly optimize and accelerate the process of wound healing. Collagen plays a vital chemotactic role in this process. It not only guides fibroblasts to adhere to the wound site efficiently, but also strongly promotes the proliferation of fibroblasts. In addition, collagen also has a positive effect on the deposition of collagen fibers and the remodeling of tissue structure in the wound area, thereby further promoting the overall process of wound healing.

[0008] Therefore, it is of great significance to actively develop skin products based on type II collagen and to explore its potential in skin repair and promoting collagen regeneration through in-depth research on the specific mechanism of action and effects of type II collagen in the wound healing process. Summary of the invention

[0009] The technical problem to be solved by the present invention is to provide a novel human type II collagen COLII-14K-H and its gene and application.

[0010] The present invention adopts the following technical solutions to solve the above technical problems:

[0011] A novel human type II collagen COLII-14K-H, whose amino acid sequence is shown in SEQ ID NO.2.

[0012] As one of the preferred embodiments of the present invention, the human type II collagen COLII-14K-H contains one "GER" and two "GEK integrin recognition sites".

[0013] A gene encoding the novel human type II collagen COLII-14K-H, wherein the gene is COLII-14K-H, and the nucleotide sequence is shown in SEQ ID NO.1.

[0014] As one of the preferred embodiments of the present invention, the nucleotide sequence shown in SEQ ID NO.1 is a codon-optimized sequence adapted to the Pichia pastoris expression system.

[0015] A method for preparing the above-mentioned human type II collagen COLII-14K-H comprises the following steps:

[0016] (1) Synthesizing the nucleotide sequence encoding human type II collagen COLII-14K-H as shown in SEQ ID NO.1;

[0017] (2) constructing a recombinant expression vector pPIC9K-COLII-14K-H containing the DNA fragment encoding human type II collagen COLII-14K-H;

[0018] (3) After linearization, the constructed group expression vector was transferred into Pichia pastoris GS115 competent cells to obtain recombinant Pichia pastoris engineered bacteria;

[0019] (4) Screening and fermentation of the recombinant strain to obtain human type II collagen COLII-14K-H;

[0020] (5) Combining nickel ion affinity chromatography and dialysis, the human type II collagen COLII-14K-H expressed in step (4) is separated and purified.

[0021] A use of the human type II collagen COLII-14K-H in the preparation of cartilage repair or skin repair drugs.

[0022] As one of the preferred embodiments of the present invention, the human type II collagen COLII-14K-H is used to promote cartilage repair.

[0023] As one of the preferred embodiments of the present invention, the human type II collagen COLII-14K-H is used to promote skin wound repair, accelerate skin cell migration, proliferation and scratch repair.

[0024] As one of the preferred embodiments of the present invention, the skin repair drug is in the form of a gel, a mask, or a liquid disposable.

[0025] A use of the human type II collagen COLII-14K-H in the preparation of skin care products.

[0026] As one of the preferred embodiments of the present invention, the human type II collagen COLII-14K-H is used to increase the expression level of type I and III collagen genes and protein expression level in human skin fibroblasts, and promote the production of collagen in human skin cells; at the same time, it is used to increase the transcription level of elastin gene in human skin fibroblasts, and promote the production of elastin in human skin cells.

[0027] As one of the preferred embodiments of the present invention, the skin care product is in the form of toner, essence, facial mask, emulsion, body lotion, facial cream, and eye cream.

[0028] The advantages of the present invention compared to the prior art are:

[0029] (1) The human type II collagen COLII-14K-H fragment provided by the present invention contains one "GER" and two "GEK integrin recognition sites" (integrin can recognize GER and GEK sites, which can not only mediate the adhesion of cells to the extracellular matrix, but also activate various biological processes in cells through signal transduction pathways, promote cell proliferation and adhesion, and are crucial for biological processes such as tissue repair and regeneration). By accurately selecting the key active regions of human type II collagen and optimizing the base sequence, its cell adhesion and integrin binding abilities are enhanced;

[0030] (2) According to the expression characteristics of Pichia pastoris, the present invention performs codon optimization on the nucleotide sequence encoding recombinant human type II collagen, making the nucleotide sequence encoding recombinant human type II collagen more suitable for the expression system of Pichia pastoris, and obtains a high-yield engineered bacterium of recombinant type II collagen through rapid screening by small-scale expression test;

[0031] (3) The present invention purifies recombinant human type II collagen COLII-14K-H by nickel ion affinity chromatography and one-step dialysis to obtain recombinant human type II collagen with high purity and high recovery rate;

[0032] (4) The present invention uses Pichia pastoris as an expression host to produce recombinant human type II collagen COLII-14K-H, which has the advantages of being endotoxin-free, capable of post-translational modification of collagen, and capable of high-density fermentation. These characteristics ensure that the collagen produced by the present invention has excellent biological function performance;

[0033] (5) The expression vector used in the present invention is a secretory expression vector pPIC9K, which can secrete and express collagen in the fermentation broth supernatant, and the content of impurities in the supernatant is low, which greatly simplifies the downstream purification steps, significantly reduces the purification time and cost, and provides strong support for the industrial production of recombinant collagen;

[0034] (6) The recombinant human type II collagen COLII-14K-H provided by the present invention can achieve low-dose and high-efficiency in "skin repair", that is, it can show significant skin repair efficacy at low concentrations (efficiently promotes skin cell adhesion and cell migration, and promotes skin repair), and is comparable to commercially available recombinant collagen and natural animal collagen;

[0035] (7) In terms of "skin care", the recombinant human type II collagen fragment provided by the present invention can effectively increase the expression level of type I and III collagen genes and protein expression level in human skin fibroblasts, thereby promoting the production of collagen in human skin cells (currently not found in similar recombinant collagen); at the same time, it can also effectively increase the transcription level of elastin gene in human skin fibroblasts, promote the production of elastin, and improve skin elasticity. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 is the active site map of the amino acid sequence of the recombinant human type II collagen fragment COLII-14K-H in Example 1 (in the map, GER and GEK are integrin recognition sites);

[0037] Figure 2 This is the protein electrophoresis diagram obtained by separation and purification of the recombinant human type II collagen COLII-14K-H in Example 5 (in the figure, the first lane is the protein marker, and the second lane is the purified COLII-14K-H protein; the molecular weight of the COLII-14K-H protein detected by electrophoresis is about 23 kDa);

[0038] Figure 3 This is a graph showing the effect of recombinant human type II collagen COLII-14K-H on the proliferation of human chondrocytes in Example 5 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0039] Figure 4 Microscopic photograph of the experiment of recombinant human type II collagen COLII-14K-H on the migration of human chondrocytes;

[0040] Figure 5 This is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the migration rate of human chondrocytes in Example 5 (in the graph, graph A shows the migration results for 24 hours, and graph B shows the migration results for 48 hours; "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0041] Figure 6 This is a graph showing the effect of recombinant human type II collagen COLII-14K-H on the proliferation of human immortalized epidermal cells in Example 6 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0042] Figure 7 This is a microscopic photograph of the experiment on the effect of recombinant human type II collagen COLII-14K-H on the migration of human immortalized epidermal cells in Example 6;

[0043] Figure 8 This is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the migration of human immortalized epidermal cells in Example 6 (in the graph, Figure A shows the 24h migration result, Figure B shows the 48h migration result, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0044] Fig. 9 This is a graph showing the effect of recombinant human type II collagen COLII-14K-H on the proliferation of human fibroblasts in Example 7 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0045] Fig.10 This is a microscopic photograph of the experiment on the effect of recombinant human type II collagen COLII-14K-H on the migration of human fibroblasts in Example 7;

[0046] Fig.11 This is a graph showing the effect of the recombinant human type II collagen COLII-14K-H on the migration of human fibroblasts in Example 7 (in the graph, Graph A shows the 24h migration rate result, Graph B shows the 48h migration rate result; "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0047] Fig.12 This is a graph showing the effect of recombinant human type II collagen COLII-14K-H on the adhesion of human fibroblasts in Example 7 (in the graph, "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0048] Fig.13 This is the result of the recombinant human type II collagen COLII-14K-H promoting the expression of type I and type III collagen genes in human fibroblast HSF in Example 8 (in the figure, Figure A is the result of type I collagen gene, and Figure B is the result of type III collagen gene; "*" indicates P<0.05, "**" indicates P<0.01, and "***" indicates P<0.001);

[0049] Fig.14 This is a graph showing the results of the recombinant human type II collagen COLII-14K-H promoting the expression of type I collagen in human fibroblast HSF in Example 9 (in the graph, graph A is the result at 24h, and graph B is the result at 48h; "*" indicates P<0.05, and "**" indicates P<0.01);

[0050] Fig.15This is a graph showing the results of the recombinant human type II collagen COLII-14K-H promoting the expression of type III collagen in human fibroblast HSF in Example 9;

[0051] Fig.16 This is a graph showing the results of the recombinant human type II collagen COLII-14K-H promoting the increase in the transcription level of the elastin gene in human fibroblast HSF in Example 10 (in the graph, "**" indicates P<0.01);

[0052] Fig.17 This is a graph showing the effect of the recombinant human type II collagen COLII-23 on the migration of human fibroblasts in Example 11 (in the graph, Figure A shows the 24h migration result, and Figure B shows the 48h migration result; "*" indicates P<0.05, "**" indicates P<0.01, "***" indicates P<0.001, and "****" indicates P<0.0001). DETAILED DESCRIPTION

[0053] The following is a detailed description of an embodiment of the present invention. This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and a specific operation process are given, but the protection scope of the present invention is not limited to the following embodiment.

[0054] The Pichia pastoris GS115 competent cells used in the following examples were from Shanghai Angyu Company, the expression vector pPIC9K was from Shanghai Shenggong Company, and other reagents or instruments used without indicating the manufacturer were all conventional products that can be purchased through regular channels. The medium formula used is as follows:

[0055] (1) YPD complete medium (1 L): Add 10 g yeast extract and 20 g peptone to 900 mL water, sterilize under high temperature and high pressure, and then add 100 mL of sterile 10× glucose solution. For solid medium, add 1.5% agar powder.

[0056] (2) MD medium (1 L): sterilize 800 mL of water by high temperature and high pressure, cool to 60°C, then add 100 mL of 10X YNB, 100 mL of 10X glucose, and 2 mL of 500X biotin. Add 1.5% agar powder to the solid medium.

[0057] (3) BMGY medium (1 L): Add 10 g yeast extract and 20 g peptone to 700 mL water, sterilize under high temperature and high pressure, cool to room temperature, and then add 100 mL 1 M potassium phosphate buffer (pH 6.0), 100 mL 10X YNB, 100 mL 10X glycerol and 2 mL 500X biotin.

[0058] (4) BMMY medium (1 L): Add 10 g yeast extract and 20 g peptone to 700 mL water, sterilize under high temperature and high pressure, cool to room temperature, and then add 100 mL 1 M potassium phosphate buffer (pH 6.0), 100 mL 10X YNB, 100 mL 5% methanol and 2 mL 500X biotin.

[0059] Meanwhile, the DMEM basal culture medium, PBS, fetal bovine serum (FBS), and trypsin used in the following examples were from vivacell, human chondrocyte C28I2 was from BFB Shanghai Cell Bank, human immortalized epidermal cell line HaCaT was from Oricell, and human skin fibroblast HSF was from Shanghai Fuheng Biotechnology Co., Ltd.

[0060] Example 1

[0061] Recombinant human type II collagen COLII-14K-H encoding gene:

[0062] The present invention finally screened and optimized the recombinant human type II collagen fragment COLII-14K-H encoding gene, whose nucleotide sequence is shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO.2 (the GER and GEK active sites in the amino acid sequence of the recombinant human type II collagen fragment COLII-14K-H are shown in Figure 1 ).

[0063] Gene screening optimization process:

[0064] (1) Based on the Genebank gene sequence NM_033150.3 of human type II collagen, an original sequence fragment containing one "GER" and two "GEK integrin recognition sites" was found, as shown in SEQ ID NO.3.

[0065] (2) Sequence optimization was performed based on the codon preference of Pichia pastoris and the GC content of the DNA sequence. The optimized gene sequence is shown in SEQ ID NO. 1. The optimized gene sequence was synthesized by Shanghai Shenggong Biotechnology Co., Ltd.

[0066] Example 2

[0067] Construction of recombinant expression vector pPIC9K-COLII-14K-H:

[0068] An EcoRI restriction site sequence was added to the 5' end of the coding gene sequence, and a stop codon, a 6×His tag, and a NotI restriction site sequence were added to the 3' end; subsequently, the sequence fragment was inserted into the pPIC9K expression vector through the EcoRI and NotI restriction sites to obtain the corresponding recombinant expression vector pPIC9K-COLII-14K-H.

[0069] Example 3

[0070] Construction of recombinant Pichia pastoris engineering bacteria:

[0071] (1) After linearization, the recombinant expression vector pPIC9K-COLII-14K-H was transformed into Pichia pastoris GS115 competent cells and grown on MD plates for 2 to 5 days until transformants grew out.

[0072] (2) Transformants were picked from the MD plate and placed in a 48-well culture plate containing 500 μL YPD (0.75 mg / mL G418) medium. The plates were cultured at 30°C, 240 rpm for 18-24 h. The plates were then transferred to YPD liquid medium with increasing G418 content.

[0073] (3) Fermenting the strain with good growth, the steps are as follows:

[0074] The bacterial liquid was inoculated into 10mL / 50mL BMGY with an inoculum volume of 2%, and cultured at 30°C, 240rpm for 18-24h; centrifuged, the supernatant was discarded, 10mL BMMY was added for resuspending, and cultured at 28°C, 240rpm for 48h, and 100% methanol was added every 24h to a final concentration of 1.5%; centrifuged, and the supernatant was taken for SDS-PAGE analysis to obtain a recombinant Pichia pastoris with a high expression level.

[0075] Example 4

[0076] Production, preparation and purification of recombinant human type II collagen COLII-14K-H:

[0077] (1) The successfully constructed recombinant Pichia pastoris was activated in YPD medium (containing G418 with corresponding resistance) at 30°C and 240 rpm for 24 h.

[0078] (2) 2% inoculum was transferred to 200 mL / 1 L of BMGY and cultured at 30°C, 240 rpm for 16-18 h.

[0079] (3) Centrifuge, discard the supernatant, resuspend the cells in 200 mL BMMY, and culture at 28°C, 240 rpm for 48 h; add 100% methanol every 24 h to a final concentration of 1.5%.

[0080] (4) After fermentation, the supernatant was filtered through a 0.22 μm water filter membrane to obtain a clarified fermentation supernatant, and the recombinant type II collagen COLII-14K-H was separated and purified by nickel ion affinity chromatography and dialysis (1×PBS).

[0081] Figure 2 This is the protein electrophoresis diagram of the recombinant human type II collagen COLII-14K-H separated and purified. The COLII-14K-H protein solution after separation and purification was analyzed by gel filtration chromatography and SDS-PAGE, with a purity of >95% and a recovery rate of >85%.

[0082] Example 5

[0083] Recombinant human type II collagen fragment COLII-14K-H promotes growth and migration of human chondrocytes C28I2:

[0084] 1. MTT method to measure the effect of recombinant human type II collagen on the proliferation of human chondrocytes:

[0085] (1) Human chondrocytes C28I2 were digested, centrifuged, resuspended, and diluted to 2×10 4 Each well of the 96-well cell culture plate was inoculated with 100 μL of culture medium; at the same time, a blank control was inoculated with culture medium without cells at 37°C, 5% CO2, and 95% humidity.

[0086] (2) Prepare COLII-14K-H protein suspensions at 1.6 mg / mL, 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL.

[0087] (3) The culture medium was discarded, and the blank control was supplemented with culture medium, the negative control was supplemented with culture medium, the positive control was supplemented with culture medium containing 2.5 mg / mL type II chicken cartilage collagen, and the experimental group was supplemented with culture medium containing different concentrations of protein solution. The cells were cultured at 37°C, 5% CO2, and 95% humidity for 48 h.

[0088] (4) Add 20 μL MTT to each well and incubate in an incubator for 4 h at 37°C, 5% CO2, and 95% humidity. Add 150 μL DMSO and incubate on a shaker for 10 min to fully dissolve the crystals. Detect the absorbance at 490 nm using an ELISA reader.

[0089] Test results such as Figure 3 As shown. Figure 3 It can be seen that the survival rate of the C28I2 experimental group to which 0.05 mg / mL COLII-14K-H was added was 124%, with the negative control group (NC) being 100%.

[0090] 2. Scratch test to measure the effect of recombinant human type II collagen on promoting the migration of human chondrocytes:

[0091] (1) Cell culture: Use a marker pen to draw 5 horizontal lines on the back of each well of a 6-well plate, with each line spaced approximately 0.5 cm apart as markers. Select C28I2 cells and set up a blank group, a control group, and an experimental group. After digestion, centrifugation, and resuspension, dilute to 5×10 5 Each well was 2 mL of cell suspension to ensure that the cell density of each group was the same and that the confluence reached 95-100% after 24 h of culture.

[0092] (2) Scratch test: After 24 hours of cell culture, a 200 μL pipette tip was used to scratch the cell layer vertically close to the culture plate surface to form a scratch, and the cells were rinsed with PBS three times to remove the scratched cells. 2 mL of culture medium containing recombinant human type II collagen COLII-14K-H was added to the wells, respectively, with final concentrations of 1.6 mg / mL, 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, and 0.00625 mg / mL. The blank group only added culture medium, and the positive control group added 4% FBS (adding serum FBS will definitely promote cell migration) and culture medium containing 0.625 mg / mL type II chicken cartilage collagen.

[0093] (3) Cultivate in an incubator at 37°C, 5% CO2, and 95% humidity, and take microscopic photos at a fixed position after 0 h, 24 h, and 48 h. Figure 4 shown.

[0094] (4) Use Image J to measure the scratch area: Use the software to process the scratch images (0h, 24h, 48h) and finally obtain the cell migration rate.

[0095] Test results such as Figure 5 As shown. Figure 5 It can be seen that the 24h migration rate of the blank control group (NC) was 25.65%, and the 48h migration rate was 40.13%; the 24h migration rate of the group added with 0.625mg / mL type II chicken cartilage collagen was 28.30%, and the 48h migration rate was 50.13%; the 24h migration rate of the experimental group added with 0.05mg / mL COLI-14K-H was 45.97%, and the 48h migration rate was 65.51%.

[0096] Example 6

[0097] Recombinant human type II collagen COLII-14K-H promotes growth and migration of human immortalized epidermal cells HaCaT:

[0098] 1. MTT method to measure the effect of recombinant human type II collagen on the proliferation of "human immortalized epidermal cells":

[0099] The experimental method is the same as that of Example 5-1. The positive control was added with a culture medium containing 0.625 mg / mL bovine Achilles tendon type I collagen and commercially available recombinant III collagen, and the experimental group was added with a culture medium containing different concentrations of COLII-14K-H protein solution, which were 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, 0.00625 mg / mL, and 0.003125 mg / mL, respectively.

[0100] Test results such as Figure 6 As shown. Figure 6 It can be seen that: taking the negative control group as 100%, the survival rate of the positive control group added with 0.625 mg / mL bovine Achilles tendon type I collagen was 114%, the survival rate of the positive control group added with 0.625 mg / mL commercially available recombinant III collagen was 126%, and the survival rate of the experimental group added with 0.0125 mg / mL COLI-14K-H was 134%.

[0101] 2. Scratch test to measure the effect of recombinant human type II collagen on promoting the migration of “human immortalized epidermal cells”:

[0102] The experimental method is the same as that of Example 5-2. HaCaT cells were selected and diluted to 2×10 6 / mL, 2mL cell suspension per well, set up experimental groups to add different concentrations of COLII-14K-H containing culture medium, which were 0.8mg / mL, 0.4mg / mL, 0.2mg / mL, 0.1mg / mL, 0.05mg / mL, 0.025mg / mL, 0.0125mg / mL, 0.00625mg / mL. The blank group was only added with culture medium, and the control group was added with 5mg / mL bovine Achilles tendon type I collagen and 1.25mg / mL commercially available recombinant III collagen.

[0103] After 0h, 24h, and 48h, microscopic photography was performed at a fixed position, such as Figure 7 shown.

[0104] Test results such as Figure 8 As shown. Figure 8It can be seen that the 24h migration rate of the blank control group (NC) was 25.60%, and the 48h migration rate was 44.40%; the 24h migration rate of the positive control group added with 5mg / mL bovine Achilles tendon type I collagen was 38.17%, and the 48h migration rate was 49.97%; the 24h migration rate of the positive control group added with 1.25mg / mL commercially available recombinant III collagen was 41.76%, and the 48h migration rate was 56.51%; the 24h migration rate of the experimental group added with 0.05mg / mL COLI-14K-H was 40.44%, and the 48h migration rate was 55.06%.

[0105] Example 7

[0106] Recombinant human type II collagen COLII-14K-H promotes growth, migration and adhesion of human fibroblasts HSF:

[0107] 1. MTT method to measure the effect of recombinant human type II collagen on the proliferation of human fibroblasts:

[0108] The experimental method is the same as that of Example 5-1. The blank control was supplemented with culture medium, the positive control was supplemented with culture medium containing 0.5 mg / mL commercially available recombinant III collagen, and the experimental group was supplemented with culture medium containing different concentrations of COLII-14K-H protein solution, which were 0.8 mg / mL, 0.4 mg / mL, 0.2 mg / mL, 0.1 mg / mL, 0.05 mg / mL, 0.025 mg / mL, 0.0125 mg / mL, 0.00625 mg / mL, and 0.003125 mg / mL, respectively.

[0109] Test results such as Fig. 9 As shown. Fig. 9 It can be seen that: with the negative control group as 100%, the survival rate of the positive control group added with 0.5 mg / mL commercially available recombinant III collagen was 113%, and the survival rate of the experimental group added with 0.00625 mg / mL COLI-14K-H was 124%.

[0110] 2. Scratch test to measure the effect of recombinant human type II collagen on promoting migration of human fibroblasts:

[0111] The experimental method is the same as that of Example 5-2. HSF cells were selected and diluted to 5×10 5 / mL, 2mL cell suspension per well, set up experimental groups to add different concentrations of COLII-14K-H containing culture medium, the final concentration is 0.4mg / mL, 0.2mg / mL, 0.1mg / mL, 0.05mg / mL, 0.025mg / mL, 0.0125mg / mL, 0.00625mg / mL, 0.003125mg / mL. The blank group was only added with culture medium, and the control group was added with 0.125mg / mL bovine Achilles tendon type I collagen and 0.5mg / mL commercially available recombinant III collagen.

[0112] After 0h, 24h, and 48h, microscopic photography was performed at a fixed position, such as Fig.10 shown.

[0113] Test results such as Fig.11 As shown. Fig.11 It can be seen that the 24h migration rate of the blank control group (NC) was 22.16%, and the 48h migration rate was 30.98%; the 24h migration rate of the positive control group added with 0.125mg / mL bovine Achilles tendon type I collagen was 29.63%, and the 48h migration rate was 48.64%; the 24h migration rate of the positive control group added with 0.5mg / mL commercially available recombinant III collagen was 31.65%, and the 48h migration rate was 57.84%; the 24h migration rate of the experimental group added with 0.05mg / mL COLI-14K-H was 31.20%, and the 48h migration rate was 71.61%.

[0114] 3. MTT method to measure the effect of recombinant human type II collagen on promoting the adhesion of human fibroblasts (adhesion test verification):

[0115] (1) Coating preparation: Add commercially available bovine type I collagen and commercially available recombinant type III collagen as positive controls, COLII-14K-H as the test sample, and PBS as the negative control to a 96-well plate. Inoculate at 100 μL / well, make 6 wells for each concentration, and place in a 4°C refrigerator overnight (to deposit enough protein on the surface of the wells). Remove excess coating solution from the wells, add 100 μL of 1% BSA-PBS solution, and incubate in a 37°C, 5% CO2 incubator for 1 hour. After removing the liquid in the wells, wash three times with PBS, discard the washing solution, seal with sealing film, and place at 4°C for use.

[0116] (2) Cell preparation and detection: HSF cells grown to 90% of the culture dish were digested with trypsin, and the cell concentration was adjusted after counting. The cell density was adjusted to 1×10 using complete culture medium. 5 The cell suspension of 100 μL / mL was inoculated into a 96-well culture plate at 37°C and 5% CO2 saturated humidity for 1 h.

[0117] (3) Add MTT and detect: Aspirate the supernatant, wash once with PBS, add 120 μL of 1.2 mL MTT and 6 mL complete culture medium to each well, and incubate for 4 h. Then, aspirate the culture medium and add 150 μL DMSO. Shake for 10 min. Select 490 nm as the detection wavelength and 570 nm as the reference wavelength. Measure the light absorption value of each well on an ELISA reader.

[0118] (4) Data analysis: The results were analyzed using Graphpad9.5. P < 0.05 was considered statistically significant, and P < 0.01 was considered significantly different.

[0119] Test results such as Fig.12 As shown. Fig.12 It can be seen that recombinant human type II collagen COLII-14K-H has a certain cell adhesion promoting effect on HSF cells.

[0120] Example 8

[0121] Recombinant human type II collagen COLII-14K-H promotes the expression of type I and type III collagen genes in human fibroblasts HSF (real-time quantitative PCR verification), specifically including the following steps in sequence:

[0122] The blank control was supplemented with culture medium, the positive control was supplemented with culture medium containing 20 ng / mL TGF-β (which has a well-known stimulatory effect on fibroblasts), and the experimental group was supplemented with 0.05 mg / mL COLII-14K-H. After culturing for 3 hours, the cells were collected. Total RNA was extracted using the TransZol Up Cell Kit (Quanshijin Biotechnology Co., Ltd., Beijing, China) according to the manufacturer's protocol. Total RNA (1000 ng) was reverse transcribed using the Novozymes Reverse Transcription Kit (Nanjing, Jiangsu, China) to prepare PCR amplification cDNA template. Specific primers for RT-qPCR analysis (Table 1) were synthesized by Universal Bio (Chuzhou, Anhui, China). The following thermal cycles were used as recommended in the official instructions (Table 2). RT-qPCR used Life Technologies Real-Time PCR Detection System (ThermoFisher Scientific, USA) and 2×AceQ Universal SYBR qPCR Master Mix (Novozymes, Nanjing, Jiangsu, China). The gene expression level of each target gene was measured by 2 -△△CT method.

[0123] Target gene mRNA expression levels were normalized to the housekeeping gene GAPDH as an internal control for quantification.

[0124] Table 1 Specific primers used for RT-qPCR analysis

[0125]

[0126]

[0127] Table 2 Thermal Cycling Conditions

[0128] Pre-denaturation 95℃ 5min Cyclic reaction (40×) 95℃ 10S 60℃ 30S 95℃ 15S Melting curve 60℃ 60S 95℃ 15S

[0129] Test results such as Fig.13 As shown. Fig.13 It can be seen that the gene expression of type I and type III collagen in the recombinant human type II collagen COLII-14K-H group increased by 41.80% and 82.21%, respectively. Compared with the gene expression of the blank group at the same time point, they were significantly increased. The gene expression of type I and type III collagen in the positive control TGF-β group increased by 70.49% and 123.47%, respectively. TGF-β, as a widely used cell stimulator, can significantly upregulate the two collagen subtypes, but it is non-selective and may increase the risk of collagen overexpression. In contrast, COLII-14K-H can gently and selectively upregulate gene expression, which may be an important advantage in application.

[0130] Example 9

[0131] Recombinant human type II collagen COLII-14K-H promotes the expression of type I and type III collagen in human fibroblasts HSF:

[0132] 1. Promoted expression of type I collagen (ELISA experiment):

[0133] Take human fibroblast HSF and dilute it to 1×10 5 / mL, 1mL was inoculated into each well of a 24-well cell culture plate; at the same time, a culture medium without cells was inoculated as a blank control. A negative control group was set up to add complete culture medium, a positive control was set up to add complete culture medium containing 20ng / mL TGF-β, and an experimental group was set up to add 0.05mg / mL COLII-14K-H. The cells were cultured for 1 and 2 days at 37°C in a humidified atmosphere of 5% CO2. The culture supernatant was collected to determine the content of type I collagen. Type I collagen was determined by ELISA. The absorbance at 450nm was measured using a microplate spectrophotometer. The results are as follows Fig.14 shown.

[0134] 2. Promoted expression of type IIII collagen (Western blotting experiment):

[0135] In a 6-well plate, blank control medium was added, and experimental group medium was added with 0.05 mg / mL COLII-14K-H, and cultured for 2 days. After 2 days, RIPA lysis buffer was directly added to the cell culture dish to collect the lysate of cells and extracellular matrix. The lysate was subjected to a Western blotting experiment using COL1A1 antibody / COL3A1 antibody, and then imaged using an imaging system. The relative expression level of the protein was calculated by summing the grayscale values ​​of the bands. The results are shown in Fig.15 shown.

[0136] Depend on Fig.14 , 15 It can be seen that recombinant human type II collagen COLII-14K-H can increase the production of COL1A1 and COL3A1 collagen in HSF cells.

[0137] Example 10

[0138] The recombinant human type II collagen COLII-14K-H promotes the increase of elastin gene transcription level in human fibroblast HSF, specifically including the following steps in sequence: the experimental method is the same as in Example 8. The thermal cycle conditions are the same as in Table 2. The gene expression level of each target gene is measured by 2 -△△CT method.

[0139] Target gene mRNA expression levels were normalized to the housekeeping gene GAPDH as an internal control for quantification.

[0140] Table 3 Specific primers used for RT-qPCR analysis

[0141] Primer name Primer sequence 5'-3' Elastin_F GCAGGAGTTAAGCCCAAGG Elastin_R TGTAGGGCAGTCCATAGCCA GAPDH_F TCATGACCACAGTCCATGCC GAPDH_R AAGTGGTCGTTGAGGGCAAT

[0142] The results are as follows Fig.16 shown.

[0143] Depend on Fig.16 It can be seen that recombinant human type II collagen COLII-14K-H can increase the transcription level of elastin gene in HSF cells.

[0144] Embodiment 11

[0145] Comparison of the skin repair effects of the recombinant human type II collagen COLII-14K-H and the recombinant human type II collagen COLII-23 of the present invention:

[0146] The recombinant human type II collagen COLII-23 is the type II collagen designed by our laboratory in the early stage of screening, and the amino acid sequence is shown in SEQ ID NO.4.

[0147] This example tests the skin repairing effects of the recombinant human type II collagen COLII-14K-H and the recombinant human type II collagen COLII-23 of the present invention (the effects on the migration structure of human fibroblasts), and the experimental methods refer to the above examples. The final results are shown in Table 4. Fig.17 shown.

[0148] Table 4 Human fibroblast migration results of COLII-14K-H and COLII-23

[0149]

[0150]

[0151] From the above results, it can be seen that the recombinant human type II collagen COLII-14K-H of the present invention is significantly superior to the recombinant human type II collagen COLII-23 in terms of skin repair effect (taking the HSF cell migration experiment for 48H as an example).

[0152] In summary, the recombinant human type II collagen fragment COLII-14K-H of the present invention can achieve low-dosage and high-efficiency in "skin repair", that is, it can show significant skin repair effect at low concentration (efficiently promotes skin cell adhesion and cell migration, and promotes skin repair), and is equivalent to commercially available recombinant collagen and natural animal collagen; in terms of "skin care", COLII-14K-H can effectively increase the expression level and protein expression level of type I and III collagen in human skin fibroblasts, thereby promoting the production of collagen and elastin in human skin cells; at the same time, COLII-14K-H protein can also effectively increase the transcription level of elastin gene in human skin fibroblasts, promote the production of elastin, and improve skin elasticity.

[0153] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A novel human type II collagen COLII-14K-H, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

2.

2. A gene encoding the novel human type II collagen COLII-14K-H as claimed in claim 1, characterized in that: The gene is COLII-14K-H, and the nucleotide sequence is shown in SEQ ID NO.

1.

3. A method for preparing the novel human type II collagen COLII-14K-H as claimed in claim 1, characterized in that: The steps include: (1) Synthesizing the nucleotide sequence encoding human type II collagen COLII-14K-H as shown in SEQ ID NO.1; (2) constructing a recombinant expression vector pPIC9K-COLII-14K-H containing the DNA fragment encoding human type II collagen COLII-14K-H; (3) After linearization, the constructed group expression vector was transferred into Pichia pastoris GS115 competent cells to obtain recombinant Pichia pastoris engineered bacteria; (4) Screening and fermentation of the recombinant strain to obtain human type II collagen COLII-14K-H; (5) Combining nickel ion affinity chromatography and dialysis, the human type II collagen COLII-14K-H expressed in step (4) is separated and purified.

4. Use of the novel human type II collagen COLII-14K-H as claimed in claim 1 in the preparation of cartilage repair or skin repair drugs.

5. The use according to claim 4, characterized in that: The human type II collagen COLII-14K-H is used to promote cartilage repair.

6. The use according to claim 4, characterized in that: The human type II collagen COLII-14K-H is used to promote skin wound repair, accelerate skin cell migration, proliferation and scratch repair.

7. The use according to claim 4, characterized in that: The skin repair medicine is in the form of a gel, a mask, or a liquid disposable.

8. Use of the novel human type II collagen COLII-14K-H as claimed in claim 1 in the preparation of skin care products.

9. The use according to claim 8, characterized in that: The human type II collagen COLII-14K-H is used to increase the expression level of type I and III collagen genes and protein expression level in human skin fibroblasts, and promote the production of collagen in human skin cells; at the same time, it is used to increase the transcription level of elastin genes in human skin fibroblasts, and promote the production of elastin in human skin cells.

10. The use according to claim 8, characterized in that: The skin care product is in the form of toner, essence, facial mask, emulsion, body lotion, facial cream and eye cream.

Images