Application of ANT3 gene or ANT3 protein inhibitor

Abstract

The invention discloses application of an ANT3 gene or an ANT3 protein inhibitor, and particularly discloses application of the ANT3 gene or the ANT3 protein inhibitor to preparation of drugs for treating or inhibiting multiple myeloma. According to the application disclosed by the invention, ANT3-mediated myeloma BTZ drug resistance is proposed for the first time, and ANT3 can be used as a new target for clinically treating relapse and refractory MM patients. A new thought is provided for exploration of BTZ drug-resistant molecular mechanisms and therapeutic targets, research and development of new drugs and the like, and clinical application prospects are achieved.

Description

Technical Field

[0001] The present invention relates to the field of oncology, and in particular to the application of ANT3 gene or ANT3 protein inhibitors. Background Art

[0002] Bortezomib (BTZ) resistance is an important factor in multiple myeloma (MM) relapse and affects the overall survival of patients, but the mechanism mediating BTZ resistance is still unclear. How to overcome MM resistance, improve clinical treatment plans and make them more targeted has become an urgent problem to be solved in the clinical diagnosis and treatment of MM.

[0003] Adenine nucleotide translocases 3 or ADP / ATP translocases 3 (ANT3) is a mitochondrial protein encoded by the SLC25A6 gene. It is located in the inner membrane of mitochondria and is one of the most expressed proteins in the mitochondrial membrane. As a member of the mitochondrial transporter family (MCF), ANT3 is an important component of the mitochondrial permeability transition pore complex (mPTP), which is mainly responsible for the exchange of cellular ADP / ATP. The normal expression of the ANT family is extremely important for maintaining the normal function of mitochondria and cell survival, but its role in tumors is still unclear. In addition, ANT3 has been found to be a substrate of the heat shock protein family HSPA9 and is involved in the process of HSPA9 promoting the survival of BRAF mutant tumors. Interestingly, in different studies, it was found that ANT3 had different effects on apoptosis in various cell lines, and even opposite effects: overexpression of ANT3 in HeLa (human cervical cancer cells) has a pro-apoptotic effect, while in Jurkat (acute T-cell leukemia cells) it has an anti-apoptotic effect, suggesting that the function of ANT3 in cells is highly cell type-dependent. Recent research results also suggest that ANT3 may be a potential serum marker for cervical cancer, and is highly correlated with HPV infection, with good specificity and sensitivity, and has certain diagnostic value. cDNA microarray analysis also found that in various tumor cell lines such as HL60 (promyelocytic leukemia cells) and K562 (chronic myeloid leukemia cells), the expression level of ANT3 changed after the action of various chemotherapeutic drugs (including paclitaxel, homoharringtonine, etc.). These studies indicate that ANT3 may be the molecular basis for acquired drug resistance in tumor cells, but the role and molecular mechanism of ANT3 in mediating drug resistance in different tumors still need further research to clarify. In addition, the role of ANT3 in hematological malignancies such as MM has not yet been reported.

[0004] Mitophagy is the main mechanism of mitochondrial quality control, and its activation or inhibition depends on many factors such as the type and development stage of the tumor. It is generally recognized that in the early stages of tumorigenesis, mitophagy often maintains the normal metabolism of cells and plays a tumor suppressor role; when the tumor further develops, tumor cells use mitophagy to play an anti-apoptotic role, thereby maintaining the survival of tumor cells. A large number of studies have confirmed that dysfunctional mitophagy can lead to the progression and drug resistance of various tumors, including MM. Since the anticancer effects of most MM chemotherapy drugs are attributed to the induction of apoptosis caused by oxidative stress and mitochondrial dysfunction, mitophagy may maintain the homeostasis of MM cells by rapidly removing damaged mitochondria, thereby leading to drug resistance. However, some studies have found that inhibition of thioredoxin can activate the level of mitophagy in BTZ-resistant MM cells, thereby enhancing the sensitivity of resistant MM cells to BTZ. Therefore, this means that mitophagy may play a dual role in MM resistance treatment. Whether MM cells can coordinate these two effects in different ways as a protective mechanism to ensure the survival of tumor cells themselves needs further study. Summary of the invention

[0005] The technical problems to be solved by the present invention are: 1. Whether ANT3 can be used as a biomarker to judge the progression and drug resistance of MM is unclear; 2. Mitochondrial autophagy may play a dual role in the treatment of MM resistance, and whether it can be used as a solution to intervene in BTZ resistance is still unclear. In order to overcome the shortcomings of the above-mentioned prior art solutions, the inventors need to solve the following problems: 1. Explain and clarify the cancer-promoting effect of ANT3 in MM in vivo and in vitro, and its specific mechanism of action; 2. Clarify the specific molecular mechanism of ANT3-mediated mitochondrial autophagy; In order to solve the above technical problems, the present invention provides an application of an ANT3 gene or ANT3 protein inhibitor. The present invention proposes for the first time that ANT3 mediates BTZ resistance in myeloma, and ANT3 can be used as a new target for the clinical treatment of relapsed and refractory MM patients. It provides new ideas for the molecular mechanism of BTZ resistance, the exploration of therapeutic targets, and the development of new drugs, and has clinical application prospects.

[0006] The first aspect of the present invention provides a use of an inhibitor of ANT3 gene or ANT3 protein for preparing a drug for treating or inhibiting multiple myeloma.

[0007] In a preferred embodiment, the inhibitor is an agent that inhibits ANT3 gene transcription or an agent that inhibits ANT3 protein expression.

[0008] In a preferred embodiment, the agent for inhibiting the transcription of the ANT3 gene is an agent for knocking down or knocking out the ANT3 gene, such as a plasmid with a knocking down or knocking out function.

[0009] In a preferred embodiment, the agent for inhibiting the expression of ANT3 protein is shANT3, for example, the sequence of shANT3 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0010] Another aspect of the present invention provides a use of an ANT3 gene or its protein, or a detection reagent thereof, for preparing a reagent or a kit for diagnosing multiple myeloma.

[0011] In a preferred embodiment, the kit includes: a reagent for quantitatively detecting ANT3 protein or its mRNA, and a corresponding label or instruction manual.

[0012] In a preferred embodiment, the reagents include ANT3-specific primers, specific antibodies, probes and / or chips.

[0013] In a preferred embodiment, the ANT3 gene or its protein is derived from mammals.

[0014] In a preferred embodiment, the amino acid sequence of the ANT3 protein is shown in SEQ ID NO:9.

[0015] In a preferred embodiment, the nucleotide sequence encoding the ANT3 protein is shown as SEQ ID NO:10.

[0016] In a preferred embodiment, the object of determination includes a tissue sample, a blood sample, a serum sample or a body fluid sample.

[0017] Another aspect of the present invention provides a use of an ANT3 gene or ANT3 protein inhibitor for preparing a drug for restoring the sensitivity of multiple myeloma cells to BTZ.

[0018] In a preferred embodiment, the restoration of sensitivity of multiple myeloma cells to BTZ is achieved by regulating the level of mitochondrial autophagy in the cells.

[0019] In a preferred embodiment, the inhibitor is an agent that inhibits ANT3 gene transcription or an agent that inhibits ANT3 protein expression;

[0020] In a preferred embodiment, the agent for inhibiting the transcription of the ANT3 gene is an agent for knocking down or knocking out the ANT3 gene, such as a plasmid with a knocking down or knocking out function.

[0021] In a preferred embodiment, the agent for inhibiting the expression of ANT3 protein is shANT3, for example, the sequence of shANT3 is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0022] Another aspect of the present invention provides a use of an ANT3 gene or a protein thereof, or a detection reagent thereof, for preparing a reagent or a kit for determining whether multiple myeloma is resistant to BTZ.

[0023] In a preferred embodiment, the kit includes: a reagent for quantitatively detecting ANT3 protein or its mRNA, and a corresponding label or instruction manual.

[0024] In a preferred embodiment, the reagents include ANT3-specific primers, specific antibodies, probes and / or chips.

[0025] In a preferred embodiment, the ANT3 gene or its protein is derived from mammals.

[0026] In a preferred embodiment, the amino acid sequence of the ANT3 protein is shown in SEQ ID NO:9.

[0027] In a preferred embodiment, the nucleotide sequence encoding the ANT3 protein is shown as SEQ ID NO:10.

[0028] In a preferred embodiment, the object of determination includes a tissue sample, a blood sample, a serum sample or a body fluid sample.

[0029] On the other hand, the present invention also provides a method for inhibiting the growth, proliferation and / or drug resistance of multiple myeloma cells for non-therapeutic purposes, characterized in that it comprises the steps of: culturing multiple myeloma cells in the presence of an ANT3 protein inhibitor, thereby inhibiting the growth, proliferation and / or drug resistance of multiple myeloma cells.

[0030] In the present invention, the ANT3 protein includes fusion protein and non-fusion protein.

[0031] The chip includes a detection chip and further includes a nucleic acid chip or a protein chip.

[0032] The nucleic acid chip comprises a substrate and specific oligonucleotide probes of multiple myeloma-related genes spotted on the substrate, wherein the specific oligonucleotide probes of multiple myeloma-related genes comprise probes specifically binding to ANT3 gene or its mRNA.

[0033] The protein chip comprises a substrate and specific antibodies of multiple myeloma-related proteins spotted on the substrate, and the specific antibodies of multiple myeloma-related proteins comprise specific antibodies against ANT3 proteins.

[0034] The present invention also provides a kit, which includes: a reagent for quantitatively detecting ANT3 protein or its mRNA, and a corresponding label or instruction manual.

[0035] The present invention also provides a method for screening candidate compounds for treating MM.

[0036] Through gene-edited MM-sensitive cells and BTZ-resistant cells, MM patient specimens, subcutaneous and in situ MM animal models, etc., it was confirmed that abnormally expressed ANT3 promotes MM progression and BTZ resistance. The biological function of ANT3-mediated ADP / ATP translocation affects the normal operation of the cell cycle, thereby regulating the proliferation of myeloma; ANT3 interacts with Timm22 to mediate PINK1 transport and stability, inducing mitochondrial autophagy to promote BTZ resistance. Targeting the ANT3-PINK1 signaling pathway is expected to become an effective strategy for the clinical treatment of drug-resistant multiple myeloma.

[0037] Bortezomib (BTZ) resistance is one of the main obstacles affecting the overall survival of multiple myeloma (MM) patients. How to overcome or reverse resistance is an important idea for the treatment of MM. The inventors first discovered that ANT3 plays a role in promoting tumor development and BTZ resistance in MM, and explained that it mediates BTZ resistance by affecting mitochondrial autophagy. This study used experimental methods such as lentiviral gene editing, protein immunoprecipitation, immunofluorescence co-localization, mitochondrial transmission electron microscopy, subcutaneous and orthotopic transplant tumor animal models to conduct in-depth research on the regulatory role and molecular mechanism of ANT3 in regulating the occurrence, development and resistance of MM.

[0038] The study found that: (1) Public databases, primary patient specimens, and in situ animal models all suggest that ANT3 is positively correlated with MM progression and BTZ resistance; (2) ANT3 promotes MM cell proliferation, which is related to its mediated ATP transport affecting the cell cycle; (3) ANT3 promotes bortezomib resistance in MM cells, and knockdown of ANT3 resensitizes the resistant cell lines, which is related to its induction of mitochondrial autophagy; (4) ANT3 affects the normal intra-membrane transfer of PINK1 by interacting with the mitochondrial membrane transporter protein Timm22, stabilizing it in the mitochondrial outer membrane, thereby promoting mitochondrial autophagy.

[0039] 1) The inventors' research conclusions confirmed that ANT3 drives the progression of multiple myeloma and bortezomib resistance. First, through the analysis of the public database on the Internet, it was found that ANT3 was highly expressed in multiple myeloma patients, especially in patients with BTZ resistance, and high levels of ANT3 were associated with poor prognosis in MM patients. After that, by constructing MM cell lines with ANT3 overexpression, knockdown and control, and recording growth curves, EdU staining and soft agar clone formation, the role of ANT3 in promoting MM cell proliferation and BTZ resistance was clarified. In-depth exploration of the mechanism, the inventors found that ANT3 promoted myeloma proliferation and was related to its influence on intracellular ATP levels and regulation of the cell cycle. In addition, the inventors also verified the hypothesis that ANT3 mediates myeloma resistance through mitochondrial autophagy by using agonists and inhibitors of mitochondrial autophagy. And by immunofluorescence co-localization, immunoprecipitation and other methods, the specific molecular mechanism of ANT3 affecting the transport of PINK1 by interacting with Timm22, thereby causing mitochondrial autophagy, was screened and verified. This project provides a new target for the treatment of myeloma and has potential clinical application prospects.

[0040] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0041] Unless otherwise specified, the reagents and raw materials used in the present invention are commercially available.

[0042] The positive and progressive effects of the present invention are: the inventors first discovered that ANT3 protein may be involved in the development and drug resistance of MM, and is associated with poor prognosis. The inventors preliminarily clarified that ANT3 can promote MM cell proliferation and participate in myeloma BTZ resistance. After exploring the mechanism, the inventors found that ANT3 exerts a cell proliferation effect by regulating the cellular ATP level, thereby affecting the cell cycle. In addition, ANT3 can also affect the level of mitochondrial autophagy in cells, causing cell BTZ resistance, and has nothing to do with its function of regulating oxidative phosphorylation. ANT3 interacts with the serine-threonine kinase PINK1 on the outer membrane of mitochondria. ANT3 participates in the transport of PINK1 on the mitochondrial membrane, and interacts with Timm22 to stabilize PINK1 on the outer membrane, thereby affecting the process of mitochondrial autophagy. This project explores the specific molecular mechanism by which ANT3 participates in mitochondrial autophagy to exert drug resistance, providing new targets and a reliable theoretical basis for the treatment of drug-resistant myeloma. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1ANT3 was shown to be associated with the development, progression, and poor prognosis of multiple myeloma, where: (A) The difference in ANT3 expression in healthy donors, monoclonal gammopathy of undetermined significance (MGUS), smoldering myeloma (smoldering MM), and multiple myeloma (MM) was analyzed using a publicly available dataset (GSE6477) from the NCBI Gene Expression Omnibus (GEO), and statistical data were calculated using the Wilcoxon Rank Sum Test. (B) Kaplan-Meier curves of ANT3 expression levels and overall survival (OS) and progression-free survival (PFS) of MM patients were calculated using a publicly available dataset (GSE136324) from the GEO database, and significant differences were calculated using the Log-rank Mantel-Cox test. (C) The receiver operating characteristic curve (ROC) of ANT3 expression in 153 multiple myeloma patients and 5 normal subjects was analyzed using a publicly available dataset (GSE13591) from the GEO database, and statistical data were calculated using logistic regression. (D) Western blot showing the expression level of ANT3 protein in MM cell lines compared with PBMCs from healthy donors, with Actin as a control. (E) Orthotopic myeloma model was established by tail vein injection of ANT3-OE / EV RMPI8226 cells. In vivo imaging captured the fluorescence intensity of each group at 28, 42, and 56 days after injection. (F) Mouse body weight was recorded at 28, 42, and 56 days after injection. (G) Immunohistochemical analysis of femoral bone marrow, scale bar = 25 μM, original magnification: ×200 and ×400.

[0044] Figure 2This indicates that ANT3 promotes myeloma cell proliferation by regulating intracellular ATP levels. (A) The cell numbers of MM cells (NCI-H929R and RPMI8226-R5) with ANT3 knockdown and control (shANT3 / shCTRL) were recorded for 6 consecutive days after trypan blue staining (n=3, *P<0.05, **P<0.01). (B) EdU proliferation staining analysis of MM cells (NCI-H929 and NCI-H929R) with ANT3 overexpression, knockdown and their respective controls (ANT3-OE / EV or shANT3 / shCTRL), scale bar=100μM, original magnification: ×400; the bar graph shows the proportion of EdU positive cells (n=10, *P<0.05, **P<0.01). (C) Soft agar colony formation assay of ANT3-OE / EV MM cells (NCI-H929 and RPMI8226). (D) Microplate reader was used to detect the intracellular ATP level of shANT3 / shCTRL MM cells (NCI-H929R, RPMI8226-R5) (n=3, *P<0.05, **P<0.01). (EF) ATP level and growth curve of ANT3-OE / EV MM cells were detected after oligomycin A (5μm) treatment (n=3, *P<0.05, **P<0.01, ***P<0.001). (G) Flow cytometry was used to detect the cell cycle of shANT3 / shCTRL MM cells (NCI-H929R, RPMI8226-R5). The bar graph on the right shows the percentage of cells in each stage (n=3, *P<0.05, **P<0.01). (H) Western blot analysis of G0 / G1 phase-related proteins in shANT3 / shCTRL MM cells (NCI-H929R, RPMI8226-R5), with Actin as a control.

[0045] Figure 3It shows that ANT3 is an important factor in BTZ resistance in myeloma. (A) qRT-PCR was used to detect ANT3 levels in MM cells treated with gradient chemotherapy drugs, including bortezomib (BTZ), etoposide (ET), melphalan (MEP), doxorubicin (DOX) and dexamethasone (DEX) (n=3, **P<0.01). (B) ANT3 expression in bortezomib responders and non-responders was analyzed using the GEO database (GSE9782). (C) Western blot compared the difference in ANT3 expression levels between sensitive and BTZ-resistant MM strains (NCI-H929 / NCI-H929R, RPMI8226 / RPMI8226-R5). (D) After ANT3 knockdown and control MM resistant cells (NCI-H929R, RPMI8226-R5) were treated with bortezomib, the growth inhibition was detected by CCK-8 assay (n=3, **P<0.01, ***P<0.001), and (E) soft agar colony formation ability, the bar graph shows the colony count (n=3, **P<0.01, ***P<0.001). (F) ANT3 overexpression and control MM cells, as well as MM sensitive strains and corresponding BTZ resistant strains (NCI-H929, NCI-H929R) were treated with gradient concentrations of clodronic acid (0, 0.1, 0.2, 0.4, 1, 2, 4 mM) for 72 h, and cell viability was detected by CCK-8. n=3, *P<0.05, **P<0.01, ***P<0.001.

[0046] Figure 4Showing that ANT3 positively regulates mitophagy levels in myeloma cells to induce bortezomib resistance: (AC) Western blot was used to detect markers of mitophagy (PINK1, P62, and LC3) in three groups of MM cells, including sensitive / resistant MM cells (NCI-H929 / NCI-H929R), shANT3 / shCTRLMM cells (NCI-H929R), and ANT3-OE / EV MM cells (NCI-H929). (D) shANT3 / shCTRL MM cells (NCI-H929R and RPMI8226-R5) were pre-treated with CQ (20 μm) for 2 h and then stained with mitochondrial tracer (200 nM) for 20 minutes. The expression and colocalization of LC3 (green) and mitochondria (red) were recorded using laser confocal microscopy. The right bar graph shows the fluorescence intensity of the overlapping parts of LC3 and mitochondria in each cell (n=20, **P<0.01, ***P<0.001). (E) Transmission electron microscopy images of mitochondria in ANT3-OE / EV MM cells (NCI-H929) and shANT3 / shCTRLMM resistant cells (NCI-H929R). (F) ANT3-OE / EV MM cells (NCI-H929) were pretreated with CQ (10 μm) or Baf (2 nm) for 4 h, then treated with bortezomib for 48 h, and cell viability was detected by CCK-8 method. (G) PINK1 was knocked down in ANT3-overexpressing MM cells, then treated with bortezomib for 48 h, and cell viability was detected by CCK-8 method.

[0047] Figure 5 This indicates that ANT3 promotes mitophagy by mediating PINK1 translocation due to its interaction with Timm22. (A) MM cells (NCI-H929, RPMI8226) were treated with oligomycin A (5 μm) or CTRA (20 μm), and then the level of mitochondrial membrane potential (MMP) was detected by flow cytometry using a mitochondrial membrane potential detection reagent (JC-1). The bar graph below compares the percentage of PE / FITC fluorescence intensity representing aggregates and monomers, respectively (n=5, ***P<0.001). (B) qPCR was used to detect the expression of PINK1 transcription levels in ANT3 knockdown and control MM cells. (C) Endogenous immunoprecipitation was performed in NCI-H929 using ANT3 antibody or PINK1 antibody, respectively, and anti-IgG was used as a nonspecific control. (D) Laser confocal microscopy was used to capture the co-localization level of PINK1 (red) and ANT3 (green) in MM cells (NCI-H929). (E) The protein interaction network with ANT3 and PINK1 as nodes was analyzed using the STRING database. Circles represent proteins and lines represent interaction modes.

[0048] Figure 6 It also shows that ANT3 promotes mitophagy by mediating PINK1 transport due to interaction with Timm22. (A) HEK293T cells were transfected with Timm10-HA / Timm22-HA / Tomm20-HA alone or co-transfected with ANT3-Flag, cell lysates were immunoprecipitated with Flag antibody, and immunoprecipitates were analyzed by immunoblotting using HA antibody and Flag antibody. (B) MM cells (ARP-1) were transfected with Timm22-HA / Tomm20-HA alone or co-transfected with ANT3-Flag. Cell lysates were immunoprecipitated with anti-HA, and immunoprecipitates were analyzed by immunoblotting using HA antibody, Flag antibody, and PINK1 antibody. (C) ANT3 knockdown and control MM cells were pretreated with MG132 (10 μM) for 4 h, co-immunoprecipitated with PINK1 antibody, and the co-immunoprecipitated products were analyzed by immunoblotting using Ubiquitin antibody. (D) MM resistant cells stably transfected with shANT3 / shCTRL (NCI-H929R) were treated with DMSO, CCCP (10 μM) or MG132 (10 μM) for 4 h, and the expression of PINK1 was detected by Western blotting. (E) After pretreatment with CCCP or MG132, shANT3 / shCTRLMM cells were stained for mitochondria (red) and Parkin (green) by immunofluorescence. The level of Parkin recruitment to mitochondria was recorded using laser confocal microscopy. (F) Model of ANT3-mediated PINK1 translocation through ANT3 interacting with Timm22.

[0049] Figure 7 Knockdown of ANT3 inhibits the growth of MM xenograft tumors and promotes sensitivity to BTZ in vivo: (A) Schematic diagram of the establishment of subcutaneous xenograft tumors and the process of BTZ treatment. (BC) Tumor-bearing nude mice were treated with NS or bortezomib, and the gross appearance of tumor samples in each group (n = 5 mice / group). (D) Tumor tissues of each group were stained with HE and immunohistochemistry, including Ki67, ANT3, and PINK1. Scale bar = 25 μM, original magnification: × 400. (EF) Tumor volume during the experiment and tumor weight at the end of the experiment were recorded (n = 5, *P < 0.05, **P < 0.01, ***P < 0.001). (G) Indicators of bone marrow sections from four normal donors and four myeloma patients were detected by immunohistochemistry, including ANT3 and PINK1.

[0050] Figure 8A working model of the main molecular mechanisms by which ANT3 promotes proliferation and BTZ resistance in multiple myeloma cells is described. ANT3 is an important factor in myeloma progression and bortezomib resistance. ANT3 is involved in regulating cellular ATP levels as an ADP / ATP transporter, thereby affecting the operation of the cell cycle. ANT3 promotes mitophagy independently of its biological function. Interaction with Timm22 blocks the translocation of PINK1 to the inner mitochondrial membrane and stabilizes PINK1 in the outer membrane, which recruits Parkin, LC3, and P62 to stimulate mitophagy and ultimately induce resistance to bortezomib.

[0051] Fig. 9 The correlation between ANT3 expression and tumors is shown. (A) The CCLE database (https: / / sites.broadinstitute.org / ccle) was used to detect the expression levels of ANT3 in tumor cell lines and non-tumor cell line controls from different tissues. Hematological malignancies are marked with red underlines. *p<0.05, **p<0.01, ***p<0.001. (B) The GEPIA2 database (http: / / gepia2.cancer-pku.cn / ), which contains 33 common human cancer types, was used to compare the expression levels of ANT3 in tumors and normal controls. And the optimized comparison in four types of tumors is shown (*P<0.05). (C) Serum was extracted from the orthotopic mouse model, and blood was drawn from the eyeball at the end of the experiment and serum was extracted to detect the levels of alkaline phosphatase (ALP), β2-microglobulin (β2-MG), and lactate dehydrogenase (LDH).

[0052] Fig.10 The expression level of ANT3 was shown to affect the growth rate of myeloma cells. (A) The number of ANT3-OE / EV MM cells (NCI-H929, RPMI8226) was recorded for 6 consecutive days after trypan blue staining (n=3, **P<0.01, ***P<0.001). (B) EdU staining of ANT3-OE / EV or shANT3 / shCTRLMM cells, scale bar=100μM, original magnification: ×400. The bar graph shows the proportion of EdU positive cells (n=10, *P<0.05, **P<0.01, ***P<0.001). (C) Flow cytometry was used to detect the effect of oligomycin A on the cell cycle.

[0053] Fig.11Figure 4: The relationship between ANT3 expression, mitophagy and bortezomib resistance in MM: (AC) Mitophagy markers (PINK1, P62 and LC3) were detected by Western blotting in three groups of MM cells, including sensitive / resistant cells (RPMI8226 / RPMI8226-R5), shANT3 / shCTRL cells (RPMI8226-R5) and OE / EV MM cells (RPMI8226). (D) MM sensitive cells (NCI-H929, RPMI8226) were pre-treated with rapamycin (100 nM) for 4 hours, and then bortezomib was added. Cell viability was measured 48 hours later using CCK-8 assay (n=3, **P<0.01, ***P<0.001). (E) MM-resistant cells (NCI-H929R, RPMI8226-R5) were pretreated with bafilomycin (2 nM) for 4 h and bortezomib for 48 h, and CCK-8 assay was used to measure cell viability (n=3, **P<0.01, ***P<0.001).

[0054] Fig.12 Indicates the level of mitophagy after bortezomib treatment. (A) NCI-H929 cells were treated with bortezomib (0, 2.5, 5 nM) for 48 h, and then mitophagy markers (PINK1, P62, and LC3) were detected by Western blotting. (B) NCI-H929R stably transfected with shANT3 / shCTRL were treated or not with bortezomib, and then the expression of ANT3 and the level of mitophagy were detected by Western blotting. DETAILED DESCRIPTION

[0055] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are selected according to conventional methods and conditions, or according to the product specifications. The data collection and analysis methods of the following examples are as follows:

[0056] The materials and methods involved in the embodiments are as follows:

[0057] Cell culture and reagents

[0058] Wild-type MM cells were cultured in RPMI1640 medium (Gibco) supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2. HEK293 cell lines and stably transfected cells were cultured in DMEM medium (Gibco). Human ARP-1MM cell line / NCI-H929, RPMI8226 and their resistant cells were purchased from ATCC. Primary bone marrow cells were donated by healthy donors and multiple myeloma patients. The experiment was approved by the Review Committee and Ethics Committee of Shanghai Tenth People's Hospital.

[0059] Oligomycin A was purchased from Selleckchem (Houston, USA); carbonyl cyanide 3-chlorophenylhydrazone (CCCP), chloroquine diphosphate (CQ) and carboxy atractyloside (CTRA) were purchased from TargetMol (Boston, USA); bafilomycin A1, rapamycin and MG132 were all purchased from Sigma-Aldrich (Missouri, USA).

[0060] PBMCs of healthy donors and PBMCs of MM cell lines were extracted from peripheral blood samples of clinical healthy donors. shC TRL is an empty vector, and wild-type cells (NCI-H929, RPMI8226) were screened and cultured with low concentrations of bortezomib to obtain drug-resistant cells (NCI-H929R, RPMI8226-R5). The corresponding numbers of the proteins involved are as follows: G0 / G1 phase-related proteins include cyclin D1: ENSG00000110092, CDK4: ENSG00000135446, CDK6: ENSG00000105810; cyclin B: ENSG00000134057. The corresponding numbers of the markers involved are as follows: PINK1: ENSG00000158828, P62: ENSG00000161011, LC3: ENSG00000140941, Tim m22: ENSG00000177370, Timm10-HA: ENSG00000134809, Timm22-HA: ENSG00000177370, Tomm20-HA: ENSG00000173726, Ki67: ENSG00000148773, Parkin: ENSG00000185345.

[0061] The amino acid sequence of ANT3 is shown in SEQ ID NO:9:

[0062] MTEQAISFAKDFLAGGIAAAISKTAVAPIERVKLLLQVQHASKQIAADKQYKGIVDCIVRIPKEQGVLSFWRGNLANVIRYFPTQALNFAFKDKYKQIFLGGVDKHTQFWRYFAGNLASGGAAGATSLCFVYPLDFARTRLAADVGKSGTEREFRGLGDCLVKITKSDGIRGLYQGFSVSVQGIIIYRAAYFGVYDTAKGMLPDPKNTHIVVSWMIAQTVTAVAGVVSYPFDTVRRRMMMQSGRKGADIMYTGTVDCWRKIFRDEGGKAFFKGAWSNVLRGMGGAFVLVLYDELKKVI。

[0063] The nucleotide sequence of ANT3 is shown as SEQ ID NO:10 as follows:

[0064] atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgtccgcatccccaaggagcagggcgtgctgtccttctggaggggcaaccttgccaacgtcattcgctacttccccactcaagccctcaacttcgccttcaaggataagtacaagcagatcttcctggggggcgtggacaagcacacgcagttctggaggtactttgcgggcaacctggcctccggcggtgcggccggcgcgacctccctctgcttcgtgtacccgctggatttcgccagaacccgcctggcagcggacgtgggaaagtcaggcacagagcgcgagttccgaggcctgggagactgcctggtgaagatcaccaagtccgacggcatccggggcctgtaccagggcttcagtgtctccgtgcagggcatcatcatctaccgggcggcctacttcggcgtgtacgatacggccaagggcatgctccccgaccccaagaacacgcacatcgtggtgagctggatgatcgcgcagaccgtgacggccgtggccggcgtggtgtcctaccccttcgacacggtgcggcggcgcatgatgatgcagtccgggcgcaaaggagctgacatcatgtacacgggcaccgtcgactgttggaggaagatcttcagagatgaggggggcaaggccttcttcaagggtgcgtggtccaacgtcctgcggggcatggggggcgccttcgtgctggtcctgtacgacgagctcaagaaggtgatctaa。

[0065] Plasmid construction, virus packaging and cell infection

[0066] Using RNA purified from HEK293 cells as a template, the ANT3 sequence was amplified by PCR and inserted into the EcoRI and Xhol sites of the GFP-tagged pCDH vector (Haro life, Shanghai) and the Flag-tagged vector, as well as the Timm10 / 22 and Tomm20 sequences inserted into the HA-tagged vector, all of which were finally successfully verified by sequencing. ShRNA was purchased from Qingke Biotechnology (sequences are shown in the following table). HEK293T cells (Shanghai Cell Bank of Chinese Science) were transfected with lentiviral plasmids (PCDH vector plasmids, Shanghai Qihe Biotechnology Co., Ltd.) and two auxiliary vectors pMD2G and psPAX2 at a ratio of 1:1:1 using Lipofectamine 3000 reagent (Invitrogen, California, USA). The packaged virus was collected, filtered and concentrated to infect MM cells, and MM cells with stable expression were screened with 2-4 μg / mL of puromycin (Beyotime Institute of Biotechnology). The lentivirus carrying luciferase was purchased from Shanghai Gene Chemistry Company, which was used for secondary infection and screened with neomycin.

[0067] Cell viability assay

[0068] MM cells (2×10 5 Cells were inoculated into 96-well plates at 100 μl / ml and treated with different reagents. Subsequently, 10 μl of cell counting kit-8 (CCK-8) solution (Shanghai Yisheng Biotechnology Co., Ltd., China) was added, and the mixture was incubated at 37°C for another 2 hours. The absorbance was then measured at 450 nm on a microplate reader (BioTek, Winooski, USA).

[0069] RNA extraction and qRT-PCR detection

[0070] Total RNA was extracted using an RNA rapid purification kit (ES Science, Shanghai, China) according to standard protocols and reverse transcribed into complementary DNA (cDNA) using a Prime Script RT kit (TakaraBio Inc., Shiga, Japan). The samples were then analyzed on an ABI 7000 PCR detection system (ABI, Vernon, CA, USA) and relative expression levels were calculated. The primer sequences used in this study are shown below.

[0071] Western blotting

[0072] Total cell proteins were extracted using lysis buffer (100 mM Tris HCl pH 6.8, 4% SDS, and 20% glycerol) and subsequently separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were transferred to nitrocellulose membranes and then blocked with 5% skim milk for 1 hour at room temperature. The proteins were incubated with the designated antibodies overnight at 4 ° C and then incubated with the corresponding secondary antibodies for 1 hour at room temperature. Protein bands were finally detected using the Odyssey dual-color infrared laser imaging system (LICOR, Lincoln, NE, USA). Primary antibodies against PINK1 and HA were purchased from CellSignaling Technology (Danvers, USA); ANT3, Flag, LC3, P62, CDK4, CDK6, Cyclin B, and Cyclin D1 were purchased from Abcam (Cambridge, USA); Parkin was purchased from Abmart (Shanghai, China).

[0073] Immunofluorescence staining

[0074] The day before will be a total of 4 × 10 5 Cells were seeded into 12-well plates and incubated with mitochondrial fluorescent needles (MitoTracker, 200nM) for 20 minutes the next day. Then, the cells were collected, washed and dropped on adhesive slides until complete adhesion was achieved. Fix with 4% PFA for 10 minutes and block with PBS containing 3% BSA and 0.03% Triton X-100 for 30 minutes at room temperature, followed by staining with the primary antibody at 4°C overnight and staining with a fluorescent dye-conjugated IgG secondary antibody for 2 hours at room temperature. After sealing with an anti-quenching sealant, images were acquired using a Leica TCS SPE confocal microscope using a ×100 oil immersion objective. Mitochondrial fluorescent needles and LC3 dots were measured by Fijiimage, and at least 20 cells in each group were quantified.

[0075] Determination of mitochondrial membrane potential

[0076] Mitochondrial membrane potential (δψm) was detected using the JC-1 kit (eyotime Institute of Biotechnology). MM cells were treated with oligomycin A or CTRA for 2 h, after which the JC-1 working solution was added and the cells were incubated in a cell culture incubator for 20 min. After washing and resuspension, the proportion of positive cells was analyzed by flow cytometry.

[0077] Transmission Electron Microscopy (TEM)

[0078] Cell pellets were collected and fixed in 2.5% glutaraldehyde at 4 °C overnight. Then, the samples were treated with 1% osmium acid solution, dehydrated with gradient concentrations of ethanol, and finally treated with pure acetone for 20 min. After penetration, the samples were embedded and heated at 70 °C overnight, and finally sectioned to 70-90 nm. The sections were stained in lead citrate solution and 50% ethanol saturated solution of uranyl acetate, dried, and observed by transmission electron microscopy.

[0079] Soft agar colony formation assay

[0080] Myeloma cells were resuspended in DMEM containing 20% ​​FBS to a density of 4 × 10 4 / ml. The diluted cell suspension was then mixed with 1 / 5 volume of 1.66% agar and treated with or without drugs at certain concentrations. The cells were seeded into 12-well plates containing a 0.7% bottom agar layer. Incubation was continued for 14 days, after which the colonies were stained with 0.1% crystal violet. The number of colonies was determined by a digital camera and counted by ImageJ.

[0081] ATP analysis

[0082] Myeloma cells were lysed on ice and centrifuged at 12,000 g for 5 minutes at 4°C. Cellular ATP was obtained according to the instructions of the ATP assay kit (Beyotime Institute of Biotechnology). All operations were performed on ice. Luminescence (RLU) was measured by a photometer (Promega). The protein content of each sample was simultaneously detected by the bicinchoninic acid (BCA) standard curve method.

[0083] Cell cycle analysis

[0084] After fixation with 75% ice-cold ethanol at -20°C overnight, cells were washed once with phosphate-buffered saline (PBS) and then stained with PI / RNase staining buffer (BD Biosciences) at 4°C for 30 minutes. The DNA content of myeloma cells was then analyzed by BD FACS Canto II (BD Biosciences). Cell cycle distribution was assessed by ModFit LT v 3.1 (VeritySoftware House, Topsham, ME).

[0085] Co-immunoprecipitation analysis

[0086] For Co-IP analysis, HEK293 and ARP-1 cells were transfected and collected according to standard protocols. Cells were lysed in NETN solution (100 mM NaCl, 20 mM Tris-HCl, 0.5 mM EDTA, and 0.5% NP40) on ice for 30 min, followed by ultrasound-assisted lysis. Protein A / G beads (Biolinkedin, Shanghai, China) were incubated with proteins and corresponding antibodies in a rotator at 4 ° C overnight. After extensive washing, the immunoprecipitates were resuspended in 2× protein sample buffer and heated at 100 ° C for 6 min, and then total proteins were detected simultaneously by SDS gel electrophoresis.

[0087] Human Myeloma Mouse Model

[0088] All animal work was performed under approved protocols (TJBB00223101) in accordance with the guidelines of the Shanghai Municipal Science and Technology Commission. For the subcutaneous tumor model, NCI-H929R cells (5 × 10 in 50 μl PBS) were cultured in PBS. 6 The bortezomib group was intraperitoneally injected with BTZ (1 mg / kg) on ​​days 1, 4, 8, and 11, and the control group was injected with saline. Tumor burden (mm 3 ), and calculated using the following formula: V = length × width 2 / 2. All mice were euthanized at the end of the experiment and their tumors were collected.

[0089] To establish an orthotopic myeloma model, cyclophosphamide (0.1 mg / g) was injected into 4-week-old NOD / SCID mice (Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd.) every day for two days in advance. Then, ANT3-OE / EVRPMI8226-luc cells (8 × 10 in 100 μl PBS) were inoculated into the tail vein. 6 The mice were injected with 100 mg / ml of ...

[0090] Statistical analysis

[0091] Data are presented as mean ± standard deviation (SD). One-way analysis of variance (ANOVA) or Student's t-test was used to determine the significance of multiple comparisons or two groups. ImageJ software (National Institutes of Health, Bethesda) was used to quantify the grayscale value and immunofluorescence intensity of immunoblots. Statistical analysis was performed using GraphPad Prism 8.0 software with SPSS v20.00 statistical analysis software (IBM Corp., Armonk, USA). P < 0.05 was considered statistically significant.

[0092] The sequences involved in the examples are shown in the table below:

[0093]

[0094] The following examples are for Figures 1 to 12 The results in the paper are analyzed in detail.

[0095] Example 1ANT3 is associated with MM progression and poor prognosis

[0096] The increased expression of ANT3 during MM progression attracted the attention of the inventors ( Figure 1 A in the figure). By collecting peripheral blood samples from healthy donors, the expression of ANT3 was detected by Western blotting. The results showed that the expression of ANT3 in MM cells was much higher than that in healthy human peripheral blood mononuclear cells ( Figure 1 D). Next, the inventors explored whether ANT3 is related to the clinical and biochemical characteristics of MM. According to the data set in the NCBI database (GSE136324), patients with higher β2M levels, cytogenetic abnormalities, and higher ISS system risk are more likely to have high expression of ANT3 (p<0.05), see Table 1. In addition, a Kaplan-Meier analysis was performed on the overall survival (OS) and progression-free survival (PFS) of MM patients in the NCBI database. These patients were classified according to the quartile level of ANT3 expression. Patients with higher ANT3 expression have a poorer prognosis ( Figure 1 B). The ROC curve also shows the value of ANT3 expression in judging the prognosis of MM ( Figure 1 The inventors also searched the GEPIA2 database (http: / / gepia2.cancer-pku.cn / ), which contains expression profiles of 33 common human cancer types except MM. The inventors also found that ANT3 was highly expressed in diffuse large B-cell lymphoma, hepatocellular carcinoma, testicular germ cell tumor, and thymoma compared with normal tissues ( Fig. 9 The inventors also confirmed that high expression of ANT3 contributes to the occurrence and development of multiple myeloma through in situ mouse models and recorded survival curves ( Figure 1 These data support that ANT3 expression levels are highly tissue-specific and correlate with MM progression and prognosis.

[0097] Table 1 Correlation between clinical and biochemical characteristics and ANT3 expression

[0098]

[0099] Note: Cytogenetic abnormalities include Del(13), Del(17), t(14;16), and t(14:20). P values ​​represent comparisons between groups, not overall comparisons (*P<0.05, **P<0.01).

[0100] Example 2 ANT3 promotes MM proliferation dependent on its ADP / ATP conversion function

[0101] In order to explore the specific role of ANT3 in MM cells, the inventors constructed stable transfected cell lines that overexpressed or knocked down ANT3, and observed significant changes in the growth rate of MM cells after differential expression. By recording the growth curves and EdU staining of ANT3-OE / EV and shANT3 / shCTRL MM cells, the inventors found that the expression level of ANT3 was related to the proliferation function of MM cells ( Figure 2 Middle AB; Fig.10 The inventors also conducted a soft agar clone formation experiment, and the results showed that the number of cell colonies was significantly reduced after knocking down ANT3, while overexpression had the opposite effect, further confirming the function of ANT3 in promoting cell proliferation ( Figure 2 C; Figure 3 E).

[0102] Considering that ANT3 mediates ADP / ATP exchange in cells, the inventors first speculated that the expression level of ANT3 changes the intracellular ATP supply, thereby leading to changes in cell growth rate. Reduced intracellular ATP levels were detected in ANT3 knockdown MM cells, preliminarily confirming the above hypothesis ( Figure 2 D). Subsequently, the inventors also applied oligomycin A, an ATP synthesis inhibitor, to ANT3-overexpressing MM cells and then detected the intracellular ATP level and growth rate ( Figure 2 The results showed that oligomycin reversed the trend of ANT3 to increase intracellular ATP content and promote proliferation.

[0103] In addition, the inventors also found that the low level of intracellular ATP caused by knockdown of ANT3 affects the cell cycle, such as Figure 2As shown in Figure 3, shANT3 cells tend to accumulate in the G0 / G1 phase. The reduced levels of G0 / G1 phase-related proteins, such as CDK4, CDK6, and Cyclin D, also support the results of flow cytometry ( Figure 2 These results help to clarify that cell cycle arrest at the G0 / G1 phase is the reason why knocking down ANT3 slows proliferation.

[0104] Example 3 ANT3 affects MM bortezomib resistance by regulating mitochondrial autophagy

[0105] Since previous microarray results showed that the expression level of ANT3 in several tumors changed after chemotherapy, it was suggested that ANT3 might be associated with drug resistance. The inventors applied common myeloma chemotherapy drugs to MM cells and detected the expression level of ANT3. Among all drugs, only after BTZ treatment was ANT3 downregulated in a concentration-dependent manner ( Figure 3 Then, the inventors used the GSE9782 dataset to analyze the differences in ANT3 expression between BTZ responders and non-responders, and compared the differences between MM BTZ-resistant cells and their corresponding sensitive cells ( Figure 3 BC). The results showed that ANT3 levels were higher in non-responding patients and BTZ-resistant cells, indicating a potential correlation with BTZ resistance. The same trend was also observed in MM-sensitive cells and corresponding resistant cells by Western blot analysis. The inventors then overexpressed ANT3 in sensitive cells and knocked down ANT3 in BTZ-resistant cells, followed by treatment with gradient BTZ. As expected, CCK-8 detection suggested that the expression level of ANT3 affected the sensitivity of MM cells to BTZ ( Figure 3 D; Figure 4 In addition, the smaller number of cell colonies formed by the shANT3 group after BTZ treatment also confirmed the relationship between ANT3 expression and BTZ resistance ( Figure 3 More importantly, after ANT3 knockdown, BTZ-resistant cells regained sensitivity to BTZ, indicating that targeted intervention of ANT3 may provide a new treatment option for clinical BTZ-resistant patients.

[0106] The mechanism of ANT3-induced drug resistance was further explored. The anti-MM efficacy of many chemotherapeutic drugs may be attributed to the induction of apoptosis induced by oxidative stress and mitochondrial dysfunction, while mitophagy maintains homeostasis by rapidly removing damaged mitochondria. MM cells were pretreated with the agonist rapamycin for 4 hours, and then BTZ was added. The results of CCK-8 showed that sensitive MM cells were more resistant to BTZ than DMSO controls ( Fig.11D). In contrast, pretreatment of MM-resistant cells NCI-H929R and RPMI8266-R5 with the mitochondrial autophagy inhibitor bafilomycin restored sensitivity to BTZ ( Fig.11 The above results indicate that mitophagy affects the response of MM to BTZ.

[0107] Considering that ANT3 is located in the inner membrane of mitochondria and plays a role in mitochondrial stability, the inventors inferred that ANT3 was involved in the activation of mitophagy. By detecting some mitophagy activation markers, including LC3B-I / II, P62, and PINK1 by Western blot, the inventors indeed found that mitophagy occurred in MM cells, especially in BTZ-resistant cells and ANT3-OE cells, compared with their respective controls ( Figure 4 A and C; Fig.11 AB), showing that ANT3 has a positive regulatory effect on mitochondrial autophagy in MM cells ( Figure 4 B; Fig.11 C). Using chloroquine diphosphate (CQ) to block lysosomal digestion and accumulation of LC3, the inventors observed that the punctate accumulation of LC3 was more obvious in NCI-H929R and RPMI8226-R5 cells, with LC3 per cell + MitoTracker + The fluorescence intensity was significantly stronger than that of ANT3 knockdown cells ( Figure 4 D). The inventors also visualized the process of mitophagy by photographing the fusion of mitochondria and autophagosomes under TEM, and analyzed the fusion of mitochondria and autophagosomes in each field of view (16 μm 2 ) were quantified, further verifying the above results of the inventors ( Figure 4 E). To test whether ANT3 affects MM's BTZ resistance through mitochondrial autophagy, the inventors treated MM cells with mitochondrial autophagy inhibitors (Baf and CQ) and then added BTZ at different concentrations. Figure 4 As shown in F, the results show that inhibiting mitochondrial autophagy can effectively restore BTZ resistance caused by ANT3 overexpression. Further knocking down PINK1 in cells overexpressing ANT3 can also restore resistance to BTZ ( Figure 4 G). In summary, the inventors speculate that ANT3 regulates PINK1-mediated mitophagy, thereby affecting the response of MM cells to BTZ.

[0108] Example 4 ANT3 regulates the transport of PINK1 and promotes its stabilization in the mitochondrial outer membrane, thereby regulating the occurrence of mitochondrial autophagy.

[0109] Next, we explored how ANT3 regulates mitophagy. The inventors first thought of the biological function of ANT3 in affecting the intracellular ATP level, because it may cause cell stress. However, the application of CTRA and oligomycin A to simulate the inhibition of ANT3 as an ADP / ATP exchanger promoted membrane depolarization. The decrease in mitochondrial membrane potential is a preliminary manifestation of mitophagy, which means that mitophagy is promoted, rather than inhibited. Figure 5 This result is contrary to our previous conclusion that ANT3 positively regulates mitophagy, suggesting that ANT3 may function in an independent and unknown pathway.

[0110] Previous results suggest that the effect of ANT3 on mitochondrial autophagy is not related to its function of mediating ATP transport, but is caused by an unreported pathway. The inventors tend to believe that ANT3 regulates PINK1 at the protein level, because the results of qPCR did not show a difference in the expression of PINK1 at the transcriptional level between the shCTRL group and the shANT3 group ( Figure 5 At the same time, the inventors also verified that there is indeed a binding effect between ANT3 and PINK1 in MM cells ( Figure 5 The inventors further predicted the protein binding mode through the String database (https: / / string-db.org / ). According to the network analysis, almost all proteins connecting ANT3 and PINK1 are mitochondrial inner and outer membrane transport proteins, including Tomm20, Timm10 and Timm22, etc., which indicates that ANT3 may interfere with the transport process of PINK1 ( Figure 5 Therefore, the inventors constructed HA-tagged transporter protein plasmids and detected the interaction between ANT3 and these proteins in HEK293T cells, and selected Tomm20 and Timm22 with binding effects for subsequent studies ( Figure 6 A).

[0111] The inventors further detected the binding level between PINK1 and Tomm20 or Timm22 in ANT3-OE / EV cells. Although the level of PINK1 in MM cells increased after ANT3 overexpression, the interaction between PINK1 and Timm22 was significantly weakened, while the binding with Tomm20 showed no significant difference ( Figure 6B). Therefore, the inventors inferred that ANT3 interfered with the binding process of PINK1 to Timm22. In this case, PINK1 could not be transported to the inner membrane and was cleaved and degraded. To verify this result, the inventors used CCCP and MG132 to stabilize the 60kD full-length form or the 50kD fragment of PINK1, respectively, and detected the expression of PINK in ANT3 knockdown and control MM cells. In this case, the inventors used 8% gel to separate the two bands of PINK1, and observed more 50kD fragment forms in ANT3 knockdown cells, and more 60kD full-length form PINK1 expression in the control group ( Figure 6 D). Since PINK1 will be cleaved by related proteins after being transferred to the inner membrane and then released into the cytoplasm and hydrolyzed by the ubiquitin-proteasome pathway, we also detected the changes in the ubiquitination level of PINK1 after the expression level of ANT3 was changed ( Figure 6 C). ANT3 knockdown and control MM cells were further pretreated with MG132, and endogenous immunoprecipitation was performed using PINK1 antibody. The results showed that the level of PINK1 ubiquitination modification in ANT3 knockdown cells was significantly increased, which further verified the hypothesis that ANT3 affects the transport and stability of PINK1 protein. In addition, full-length PINK1 is stabilized in the outer membrane, thereby playing the role of recruiting Parkin. Therefore, the inventors detected the recruitment level of Parkin after treatment with CCCP and MG132 ( Figure 6 E). The laser scanning confocal microscopy images are consistent with the western blot. Only full-length PINK1 can effectively recruit Parkin to mitochondria, while 50-KD PINK1 accumulated by MG132 cannot effectively activate mitophagy. It is worth noting that there is no obvious accumulation and recruitment of Parkin in ANT3 knockdown cells even under CCCP. The complete process of ANT3-mediated PINK1 transport is shown in the model diagram ( Figure 6 F). The above indicates that ANT3 promotes mitophagy due to its interaction with Timm22, which mediates PINK1 translocation.

[0112] Example 5: Verification of intervention of ANT3 to restore the sensitivity of drug-resistant MM to BTZ by animal model

[0113] To further investigate the effect of ANT3 expression levels in MM on BTZ response, the inventors established a mouse MM xenograft model by subcutaneous injection of NCI-H929R cells. The recorded tumor volume curve showed that the shANT3 group exhibited a slower proliferation rate ( Figure 7 At the same time, according to the clinical treatment plan of BTZ, the inventors intraperitoneally injected BTZ (1 mg / kg) into the treatment group on days 1, 4, 8 and 11 of the experiment ( Figure 7 A). Consistent with the results of the in vitro study, the final tumor volume or weight indicated that the shANT3 group was more sensitive to BTZ than the control resistant group. In addition, immunohistochemistry showed that the shANT3 group had lower levels of the proliferation marker Ki-67 and higher levels of the mitochondrial autophagy marker in tumor tissue ( Figure 7 D). Bone marrow sections of MM patients also showed a consistent trend ( Figure 7 The above results confirmed that intervention of ANT3 is beneficial to improve the response of MM to BTZ in vivo.

[0114] The results of the above embodiments are integrated to obtain Figure 8 Working model of the major molecular mechanisms by which ANT3 promotes proliferation and BTZ resistance in multiple myeloma cells is shown.

Claims

1. A use of an inhibitor of ANT3 gene or ANT3 protein, characterized in that: Used for preparing drugs for treating or inhibiting multiple myeloma.

2. The use according to claim 1, characterized in that The inhibitor is an agent that inhibits ANT3 gene transcription or an agent that inhibits ANT3 protein expression; Preferably: The reagent for inhibiting ANT3 gene transcription is a reagent for knocking down or knocking out the ANT3 gene, such as a plasmid with a knockdown or knockout function; And / or, the agent for inhibiting ANT3 protein expression is shANT3, for example, the sequence of shANT3 is shown in SEQ ID NO: 1 or SEQ ID NO: 2, respectively.

3. Use of ANT3 gene or protein thereof, or detection reagent thereof, characterized in that: Used for preparing a reagent or kit for diagnosing multiple myeloma.

4. The use according to claim 3, characterized in that The kit includes: a reagent for quantitatively detecting ANT3 protein or its mRNA, and a corresponding label or instruction manual.

5. The use according to claim 3, characterized in that The reagents include ANT3 specific primers, specific antibodies, probes and / or chips.

6. The use according to claim 3, characterized in that The ANT3 gene or its protein is derived from mammals.

7. The use according to claim 3, characterized in that The amino acid sequence of ANT3 protein is shown in SEQ ID NO:

9.

8. The use according to claim 3, characterized in that The nucleotide sequence encoding the ANT3 protein is shown in SEQ ID NO:

10.

9. The use according to claim 3, characterized in that The object of the determination includes a tissue sample, a blood sample, a serum sample or a body fluid sample.

10. A use of an ANT3 gene or ANT3 protein inhibitor, characterized in that: For preparing drugs for restoring the sensitivity of multiple myeloma cells to BTZ; Preferably, the restoration of sensitivity of multiple myeloma cells to BTZ is achieved by regulating the level of mitochondrial autophagy in the cells.

11. Use of ANT3 gene or protein thereof, or detection reagent thereof, characterized in that: Used for preparing reagents or kits for judging the resistance of multiple myeloma to BTZ.

12. A method for inhibiting the growth, proliferation and / or drug resistance of multiple myeloma cells for non-therapeutic purposes, characterized in that: The method comprises the steps of: culturing multiple myeloma cells in the presence of an ANT3 protein inhibitor, thereby inhibiting the growth, proliferation, and / or drug resistance of the multiple myeloma cells.

Images