Heterozygote of 3-hydroxylase and application of heterozygote in production of levodopa, caffeic acid or hydroxytyrosol

Abstract

The invention discloses a heterozygote of 3-hydroxylase and application of the heterozygote in production of levodopa, caffeic acid or hydroxytyrosol, and relates to the technical field of biology. The heterozygote of the 3-hydroxylase comprises HpaB and HpaC, and the 3-hydroxylase comprises HpaB and HpaC. The limitation of the catalytic efficiency of hydroxylase in the prior art is overcome, the production efficiency of levodopa, caffeic acid or hydroxytyrosol is remarkably improved, and the method has a very good application prospect. The expression levels of HpaB and HpaC are properly regulated and controlled by using connecting element sequences such as a connecting peptide sequence and a 5 '-UTR sequence, so that a better production effect can be obtained.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a hybrid of 3-hydroxylase and application thereof in producing L-dopa, caffeic acid or hydroxytyrosol. Background Art

[0002] Levodopa (L-DOPA, 3,4-dihydroxyphenylalanine) is an amino acid derivative with significant effects in medicine, health, health and beauty. Currently, Levodopa is the most effective drug for the treatment of Parkinson's disease (such as Parkinson's syndrome). It enters the brain tissue through the blood-brain barrier and exerts its effects. It is suitable for primary Parkinson's disease and non-drug-induced Parkinson's disease syndrome. At the same time, it is effective for stiffness, movement disorders, drooling, arterial crisis, etc.

[0003] Caffeic acid is an important phenolic acid compound widely found in various plants. It has two functional groups, phenolic hydroxyl and acrylic acid, and thus has a series of physiological functions. Through the oxidation mechanism, caffeic acid can inhibit the proliferation of cancer cells; it has immunomodulatory and anti-inflammatory activities; it can also be used as an antioxidant; caffeic acid also has antiviral, anti-depressant, and anti-diabetic activities.

[0004] Hydroxytyrosol, 3,4-dihydroxyphenylethanol, is the hydroxylation product of tyrosol. It has stronger antioxidant activity than tyrosol. Its high antioxidant activity is beneficial to human health, and has activities such as cancer chemoprevention, anti-atherosclerosis, inhibition of DNA oxidative damage, protection of skin from photodamage, anti-inflammatory and anti-microbial activities.

[0005] Biosynthesis has become an important development direction for the above three compounds. Their biosynthesis requires the participation of 3-hydroxylase, and the commonly used one is non-P450, flavonoid-dependent flavonoid 3-hydroxylase HpaBC ( Figure 1 ). However, HpaBC has a broad substrate spectrum and can hydroxylate tyrosine, p-coumaric acid, tyrosol, tyrosine, 4-hydroxyphenylacetic acid, etc. This hydroxylation promiscuity of hydroxylase limits the synthesis efficiency of these hydroxylated aromatic compounds. Summary of the invention

[0006] The present invention aims to solve at least one of the technical problems existing in the prior art. To this end, the present invention provides a hybrid of 3-hydroxylase, which can effectively improve the production efficiency of levodopa, caffeic acid or hydroxytyrosol.

[0007] The present invention also provides biological materials related to the hybrid of the above 3-hydroxylase.

[0008] The invention also provides a kit.

[0009] The invention also provides a method for preparing a hybrid of 3-hydroxylase.

[0010] The invention also provides a method for synthesizing levodopa, caffeic acid or hydroxytyrosol.

[0011] The present invention also provides uses of the hybrid, the biological material or the kit.

[0012] A hybrid of a 3-hydroxylase according to the first aspect of the present invention comprises HpaB and HpaC.

[0013] The hybrid of the 3-hydroxylase according to the embodiment of the present invention has at least the following beneficial effects: HpaBC is a two-component enzyme, HpaB is a FAD / FMN-dependent flavonoid 3-hydroxylase, catalyzing the 3-hydroxylation reaction under the action of FAD / FMN; HpaC is an NADH-dependent flavonoid oxidase, providing FADH2 / FMNH2 for HpaB. The hybrid of the 3-hydroxylase of the embodiment overcomes the limitation of the catalytic efficiency of the hydroxylase in the prior art, significantly improves the production efficiency of L-DOPA, caffeic acid or hydroxytyrosol, and has a good application prospect.

[0014] In the present invention, the term "3-hydroxylase hybrid" refers to a fusion protein of HpaB and HpaC, or a protein combination of HpaB and HpaC. For example, "3-hydroxylase hybrid" can be a gene encoding HpaB. hpaB and HpaC encoding genes hpaC Insert a connecting peptide sequence between them to express a fusion protein; the "3-hydroxylase hybrid" can also be the coding gene of HpaB hpaB and HpaC encoding genes hpaC The protein combination obtained by inserting the 5'-UTR sequence between them.

[0015] According to some embodiments of the present invention, the HpaB includes at least one of HpaB or mutants thereof derived from Escherichia coli, Klebsiella pneumoniae, Photorhabdus luminescens, Burkholderia cepacia, Pseudomonas aeruginosa, Salmonella enterica, and Enterobacter hallii.

[0016] According to some embodiments of the present invention, the HpaC includes at least one of HpaC derived from Escherichia coli, Klebsiella pneumoniae, Photorhabdus luminescens, Burkholderia cepacia, Pseudomonas aeruginosa, Salmonella enterica, and Enterobacter hallii, or mutants thereof.

[0017] According to some embodiments of the present invention, the HpaB and HpaC in the hybrid are selected from the following combinations: B1) HpaB from Klebsiella pneumoniae and HpaC from Salmonella enterica serovar Typhimurium; B2) HpaB from Klebsiella pneumoniae and HpaC from Pseudomonas aeruginosa; B3) HpaB from Burkholderia cepacia and HpaC from Salmonella enterica; B4) HpaB from Burkholderia cepacia and HpaC from Pseudomonas aeruginosa; B5) HpaB from Burkholderia cepacia and HpaC from Photorhabdus luminescens; B6) HpaB from Burkholderia cepacia and HpaC from Enterobacter hallii; B7) HpaB from Pseudomonas aeruginosa and HpaC from Pseudomonas aeruginosa; B8) HpaB from Pseudomonas aeruginosa and HpaC from Enterobacter hallii; B9) HpaB from Pseudomonas aeruginosa and HpaC from Photorhabdus luminescens; B10) HpaB from Pseudomonas aeruginosa and HpaC from Salmonella enterica serovar Typhimurium; B11) HpaB from Pseudomonas aeruginosa and HpaC from Burkholderia cepacia; B12) HpaB from Pseudomonas aeruginosa and HpaC from Escherichia coli; B13) HpaB from Pseudomonas aeruginosa and HpaC from Klebsiella pneumoniae; B14) HpaB mutant HPaB from Pseudomonas aeruginosa S210A and HpaC from Salmonella enterica serovar Enterobacter; B15) HpaB mutant HPaB from Pseudomonas aeruginosa S210G and HpaC from Salmonella enterica serovar Enterobacter; B16) HpaB mutant HPaB from Pseudomonas aeruginosa A211W and HpaC from Salmonella enterica serovar Enterobacter; B17) HpaB from Photorhabdus luminescens and HpaC from Escherichia coli; B18) HpaB from Photorhabdus luminescens and HpaC from Salmonella enterica serovar Enterobacter; B19) HpaB from Photorhabdus luminescens and HpaC from Klebsiella pneumoniae; B20) HpaB from Photorhabdus luminescens and HpaC from Burkholderia cepacia; B21) HpaB from Photorhabdus luminescens and HpaC from Pseudomonas aeruginosa; B22) HpaB from Photorhabdus luminescens and HpaC from Enterobacter hallii; B23) HpaB from Photorhabdus luminescens and HpaC from Photorhabdus luminescens; B24) HpaB mutant from Photorhabdus luminescens S210G and HpaC from Klebsiella pneumoniae; B25) HpaB mutant from Photorhabdus luminescens S210A and HpaC from Klebsiella pneumoniae; B26) HpaB from Burkholderia cepacia and HpaC from Klebsiella pneumoniae; B27) HpaB from Burkholderia cepacia S217W and HpaC from Klebsiella pneumoniae.

[0018] According to some embodiments of the present invention, the amino acid sequence of HpaB derived from Escherichia coli is shown in GenBank ACT46003.1; and / or, and / or, the amino acid sequence of HpaC derived from Escherichia coli is shown in GenBank ACT46002.1; and / or, the amino acid sequence of HpaB derived from Klebsiella pneumoniae is shown in GenBank CDO16163.1; and / or, the amino acid sequence of HpaC derived from Klebsiella pneumoniae is shown in GenBank CDO16164.1; and / or, the amino acid sequence of HpaB derived from Photorhabdus luminescens is shown in GenBank AAO17197.1; and / or, the amino acid sequence of HpaC derived from Photorhabdus luminescens is shown in GenBank AAO17198.1; and / or, the amino acid sequence of HpaB derived from Burkholderia cepacia is shown in GenBank SDV46363.1; and / or, the amino acid sequence of HpaC derived from Burkholderia cepacia is shown in GenBank SDV46364.1; and / or, the amino acid sequence of HpaB derived from Pseudomonas aeruginosa is shown in GenBank PKG21040.1; and / or, the amino acid sequence of HpaC derived from Pseudomonas aeruginosa is shown in GenBank PKG21041.1; and / or, the amino acid sequence of HpaC derived from Salmonella enterica is shown in GenBank GAR62209.1; and / or, the amino acid sequence of HpaC derived from Enterobacter hallii is shown in GenBank PJG38871.1.

[0019] According to some embodiments of the present invention, the mutant HpaB derived from Pseudomonas aeruginosa S210AThe serine at position 210 in the amino acid sequence shown in GenBank PKG21040.1 was replaced by alanine.

[0020] According to some embodiments of the present invention, the mutant HpaB derived from Pseudomonas aeruginosa S210G The serine at position 210 in the amino acid sequence shown in GenBank PKG21040.1 was replaced by glycine.

[0021] According to some embodiments of the present invention, the mutant HpaB derived from Pseudomonas aeruginosa A211W The alanine at position 211 in the amino acid sequence shown in GenBank PKG21040.1 was replaced by tryptophan.

[0022] According to some embodiments of the present invention, the mutant HpaB derived from Photorhabdus luminescens S210G The serine at position 210 in the amino acid sequence shown in GenBank AAO17197.1 was replaced by glycine.

[0023] According to some embodiments of the present invention, the mutant HpaB derived from Photorhabdus luminescens S210A The serine at position 210 in the amino acid sequence shown in GenBank AAO17197.1 was replaced by alanine.

[0024] According to some embodiments of the present invention, the HpaB encoding gene hpaB and the HpaC encoding gene hpaC The connecting element sequence is inserted between hpaB and stated hpaC The HpaB is expressed at the hpaB The HpaC is expressed by hpaC Expressed.

[0025] According to some embodiments of the present invention, the connecting element sequence includes at least one of a linker sequence and a 5'-untranslated region sequence (5'-UTR).

[0026] According to some embodiments of the present invention, the connector is a flexible connecting peptide.

[0027] According to some embodiments of the present invention, the flexible connecting peptide consists of at least one of amino acids G and S.

[0028] According to some embodiments of the present invention, the length of the flexible connecting peptide is 3 to 15 amino acids.

[0029] According to some embodiments of the present invention, the amino acid sequence of the connecting peptide is (G2S) n 、(G3S) n 、(G4S) n ; where n is 1, 2 or 3.

[0030] According to some embodiments of the present invention, the nucleotide sequence of the 5'-UTR sequence is TTTCGGAATTAAGGAGGTAATAAAT or TTTCGGAATTAAGAGGGAGAGGAAT.

[0031] According to some embodiments of the present invention, the amino acid sequence of the hybrid may also be an amino acid sequence obtained by replacing, deleting or adding one or more residues to the amino acid sequence of HpaB and / or HpaC; and the function of the hybrid is the same or similar to that of the HpaB and / or HpaC. The function is the function of producing levodopa, caffeic acid and / or hydroxytyrosol. After replacing, deleting or adding one or more residues, it has at least 90% homology with the amino acid sequence of HpaB and / or HpaC. For example, it may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0032] According to the second aspect of the present invention, the biological material related to the above-mentioned hybrid is any one of C1) to C4): C1), a nucleic acid molecule encoding the hybrid described in the embodiment of the first aspect of the present invention; C2), an expression cassette containing the nucleic acid molecule described in C1); C3), a recombinant vector containing the nucleic acid molecule described in C1) or the expression cassette described in C2); C4), a recombinant biological cell containing the nucleic acid molecule described in C1), the expression cassette described in C2) or the recombinant vector described in C3).

[0033] According to some embodiments of the present invention, the nucleic acid molecule comprises any one of C11) to C13): C11), the nucleotide sequence of the gene encoding HpaB is shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9; and / or the nucleotide sequence of the gene encoding HpaC is shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12; C12), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence of C11), and encoding the above-mentioned hybrid; C13), hybridizes with the nucleotide sequence defined in C11) under stringent conditions, and encodes a DNA molecule of the above hybrid.

[0034] According to some embodiments of the present invention, the nucleotide sequence of the gene encoding HpaB from Escherichia coli is shown in SEQ ID NO: 1; the nucleotide sequence of the gene encoding HpaC from Escherichia coli is shown in SEQ ID NO: 2; the nucleotide sequence of the gene encoding HpaB from Klebsiella pneumoniae is shown in SEQ ID NO: 3; the nucleotide sequence of the gene encoding HpaC from Klebsiella pneumoniae is shown in SEQ ID NO: 4; the nucleotide sequence of the gene encoding HpaB from Photorhabdus luminescens is shown in SEQ ID NO: 5; the nucleotide sequence of the gene encoding HpaC from Photorhabdus luminescens is shown in SEQ ID NO: 6; the nucleotide sequence of the gene encoding Burkholderia cepacia is shown in SEQ ID NO: 7; the nucleotide sequence of the gene encoding HpaC from Burkholderia cepacia is shown in SEQ ID NO: 8; the nucleotide sequence of the gene encoding HpaB from Pseudomonas aeruginosa is shown in SEQ ID NO: 9; the nucleotide sequence of the gene encoding HpaC from Pseudomonas aeruginosa is shown in SEQ ID NO: 10; the nucleotide sequence of the gene encoding HpaC from Salmonella enterica is shown in SEQ ID NO: 11; the nucleotide sequence of the gene encoding HpaC from Enterobacter hallii is shown in SEQ ID NO: 12.

[0035] According to some embodiments of the present invention, in C1), a linker sequence is included between the coding genes of HpaB and HpaC to regulate the expression levels of HpaB and HpaC.

[0036] According to some embodiments of the present invention, the connecting element includes at least one of a 5'-UTR sequence and a linker sequence.

[0037] According to some embodiments of the present invention, the nucleotide sequence of the 5'-UTR sequence is TTTCGGAATTAAGGAGGTAATAAAT or TTTCGGAATTAAGAGGGAGAGGAAT.

[0038] According to some embodiments of the present invention, the expression cassette refers to a DNA capable of expressing the hybrid in a host cell. The DNA may include not only a promoter for initiating transcription of the hybrid encoding gene, but also a terminator for terminating transcription of the protein encoding gene. Further, the expression cassette may also include an enhancer sequence.

[0039] According to some embodiments of the present invention, the vector includes an expression vector and a cloning vector.

[0040] According to some embodiments of the present invention, the vector may be a plasmid, a cosmid, a phage or a viral vector. For example, the vector may be an expression vector pZEABP.

[0041] According to some embodiments of the present invention, the recombinant vector may be a recombinant vector obtained by inserting a nucleic acid molecule encoding the hybrid into the multiple cloning site of the vector.

[0042] According to some embodiments of the present invention, biological cells include prokaryotic cells and eukaryotic cells. The prokaryotic cells include bacteria or algae. The eukaryotic cells include fungi, mammalian cells or insect cells. The bacteria may be Escherichia coli; E.coli DH5α. The biological cells do not contain reproductive material.

[0043] According to some embodiments of the present invention, the recombinant biological cell is a recombinant biological cell obtained by introducing the nucleic acid molecule C1), the expression cassette C2) or the recombinant vector C3) into the biological cell. E.coli Recombinant Escherichia coli obtained by introducing the recombinant vector into DH5α.

[0044] A kit according to the third aspect of the present invention includes the hybrid described in the first aspect or the biological material described in the second aspect. Since the kit adopts all the technical solutions of the hybrid described in the above embodiment, it has at least all the beneficial effects brought by the technical solutions of the above embodiment.

[0045] A method for preparing a hybrid according to a fourth aspect of the present invention comprises the following steps: The coding gene of the hybrid described in the embodiment of the first aspect of the present invention is expressed in a biological cell to obtain the hybrid.

[0046] A method for synthesizing levodopa, caffeic acid or hydroxytyrosol according to a fifth aspect of the present invention comprises the following steps: A biological cell capable of synthesizing L-DOPA, caffeic acid or hydroxytyrosol is allowed to express or contact the hybrid as described in the above embodiment of the first aspect.

[0047] According to some embodiments of the present invention, the hybrid is expressed in the biological cell by means of plasmid or chromosome integration.

[0048] According to some embodiments of the present invention, the preparation method further comprises: collecting the culture supernatant and separating L-dopa, caffeic acid or hydroxytyrosol.

[0049] According to some embodiments of the present invention, when used for synthesizing levodopa, the hybrid is the hybrid described in any one of B1) to B6).

[0050] According to some embodiments of the present invention, when used to synthesize levodopa, the biological cell can produce tyrosine.

[0051] According to some embodiments of the present invention, when used for synthesizing caffeic acid, the hybrid is the hybrid described in any one of B7) to B16).

[0052] According to some embodiments of the present invention, when used to synthesize caffeic acid, the biological cell can produce p-coumaric acid.

[0053] According to some embodiments of the present invention, when used for synthesizing hydroxytyrosol, the hybrid is a hybrid described in any one of B17) to B27).

[0054] According to some embodiments of the present invention, when used to synthesize hydroxytyrosol, the biological cell can produce tyrosol.

[0055] According to the sixth aspect of the present invention, the use of the hybrid described in the first aspect, the biological material described in the second aspect, or the kit described in the third aspect in any one of D1) to D6); D1) Production of levodopa; D2) Preparation of products for the production of levodopa; D3) produces caffeic acid; D4) Preparation of products for producing caffeic acid; D5) Production of hydroxytyrosol; D6) Preparation of products for producing hydroxytyrosol.

[0056] According to some embodiments of the invention, the product is selected from a kit.

[0057] According to some embodiments of the present invention, for the use described in D1) or D2), the hybrid is the hybrid described in any one of B1) to B6).

[0058] According to some embodiments of the present invention, for the use described in D3) or D4), the hybrid is the hybrid described in any one of B7) to B16).

[0059] According to some embodiments of the present invention, for the use described in D5) or D6), the hybrid is the hybrid described in any one of B17) to B27).

[0060] Other features and advantages of the present invention will be set forth in the description which follows, and in part will be apparent from the description, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which: Figure 1 Schematic diagram of the biosynthetic pathway of L-DOPA, caffeic acid and hydroxytyrosol. DETAILED DESCRIPTION

[0062] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0063] If the specific conditions are not specified in the examples, the experiments were carried out under conventional conditions or conditions recommended by the manufacturer. If the manufacturers of the reagents or instruments are not specified, they are all conventional products that can be purchased commercially.

[0064] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0065] "And / or" is used to indicate that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0066] In the embodiments of the present invention, the amino acid sequence of E. coli EcHpaB is shown in GenBank ACT46003.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 1; the amino acid sequence of E. coli EcHpaC is shown in GenBank ACT46002.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 2; Klebsiella pneumoniae ( Klebsiella pneumoniae ) The amino acid sequence of KpHpaB is shown in GenBank CDO16163.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 3; the amino acid sequence of Klebsiella pneumoniae KpHpaC is shown in GenBank CDO16164.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 4; Photorhabdus luminescens ( Photorhabdus luminescens ) The amino acid sequence of PlHpaB is shown in GenBank AAO17197.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 5; the amino acid sequence of Photorhabdus luminescens PlHpaC is shown in GenBank AAO17198.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 6; Burkholderia cepacia ( Chitinasiproducens palmae ) The amino acid sequence of CpHpaB is shown in GenBank SDV46363.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 7; the amino acid sequence of Burkholderia cepacia CpHpaC is shown in GenBank SDV46364.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 8; Pseudomonas aeruginosa ( Pseudomonas aeruginosa ) The amino acid sequence of PaHpaB is shown in GenBank PKG21040.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 9; the amino acid sequence of PaHpaC of Pseudomonas aeruginosa is shown in GenBank PKG21041.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 10; Salmonella enterica ) The amino acid sequence of SeHpaC is shown in GenBank GAR62209.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 11; Enterobacter hallii ( Enterobacter hormaechei ) The amino acid sequence of EhHpaC is shown in GenBank PJG38871.1, and the codon-optimized nucleotide sequence encoding it is shown in SEQ ID NO: 12.

[0067] In the embodiment of the present invention, the coding sequence of the HpaB / HpaC hybrid obtained after codon optimization in E. coli was commissioned to a commercial company for full gene synthesis and connected to the expression vector pZEABP (Journal of Industrial Microbiology Biotechnology 42 (2015) 627-636). It should be noted that hpaB and hpaC When the insertion sequence of the intergenic region of the gene is a linker peptide sequence (such as (G4S)3linker), hpaB The stop codon at the 3' end needs to be deleted; if it is a 5'-UTR sequence, it needs to be retained hpaB The stop codon at the 3' end.

[0068] Specifically, Kp hpaB and hpaC (Selected from SehpaC , PahpaC )'s intergenic region was inserted into (G4S)3linker and ligated with the expression vector pZEABP to obtain hybrid expression vectors pZEA-KpHpaB-L-SeHpaC and pZEA-KpHpaB-L-PaHpaC, respectively.

[0069] Cp hpaB and hpaC (Selected from SehpaC , PahpaC , PlhpaC , EhhpaC ) was inserted into the intergenic region of the gene and then ligated with the expression vector pZEABP to obtain the hybrid expression vectors pZEA-CpHpaB-UTR-SeHpaC, pZEA-CpHpaB-UTR-PaHpaC, pZEA-CpHpaB-UTR-PlHpaC, and pZEA-CpHpaB-UTR-EhHpaC, respectively.

[0070] PahpaB and hpaC (Selected from PahpaC , EhhpaC , PlhpaC , SehpaC, CphpaC, EchpaC, KphpaC)'s intergenic region was inserted into the 5'-UTR sequence (TTTCGGAATTAAGGAGGTAATAAAT) and then ligated with the expression vector pZEABP to obtain the hybrid expression vectors pZEA-PaHpaB-UTR-PaHpaC, pZEA-PaHpaB-UTR-EhHpaC, pZEA-PaHpaB-UTR-PlHpaC, pZEA-PaHpaB-UTR-SeHpaC, pZEA-PaHpaB-UTR-CpHpaC, pZEA-PaHpaB-UTR-EcHpaC, and pZEA-PaHpaB-UTR-KpHpaC, respectively.

[0071] By point mutation technology, the 210th Ser of PaHpaB in the hybrid expression vector pZEA-PaHpaB-UTR-SeHpaC was mutated to Ala or Gly, or the 211th Ala was mutated to Trp, respectively, to obtain the hybrid expression vector pZEA-PaHpaB S210A -UTR-SeHpaC, pZEA-PaHpaB S210G -UTR-SeHpaC and pZEA-PaHpaB A211W -UTR-SeHpaC.

[0072] Pl hpaB and hpaC (Selected from EchpaC , SehpaC , KphpaC , CphpaC , PahpaC , EhhpaC , PlhpaC ) gene spacer region was inserted into the 5'-UTR sequence (TTTCGGAATTAAGGAGGTAATAAAT) and then ligated with the expression vector pZEABP to obtain the hybrid expression vectors pZEA-PlHpaB-UTR-EcHpaC, pZEA-PlHpaB-UTR-SeHpaC, pZEA-PlHpaB-UTR-KpHpaC, pZEA-PlHpaB-UTR-CpHpaC, pZEA-PlHpaB-UTR-PaHpaC, pZEA-PlHpaB-UTR-EhHpaC, and pZEA-PlHpaB-UTR-PlHpaC, respectively.

[0073] By point mutation technology, the 210th Ser of PlHpaB in the hybrid expression vector pZEA-PlHpaB-UTR-KpHpaC was mutated to Ala or Gly, respectively, to obtain the hybrid expression vector pZEA-PlHpaB S210G -UTR-KpHpaC, pZEA-PlHpaBS210A -UTR-KpHpaC.

[0074] CphpaB and KphpaC The gene spacer region was inserted into the UTR sequence (TTTCGGAATTAAGAGGGAGAGGAAT) and ligated with the expression vector pZEABP to obtain the hybrid expression vector pZEA-CpHpaB-UTR-KpHpaC.

[0075] By point mutation technology, the Ser 217 of CpHpaB in the hybrid expression vector pZEA-CpHpaB-UTR-KpHpaC was mutated to Trp to obtain the hybrid expression vector pZEA-CpHpaB S217W -UTR-KpHpaC.

[0076] In the embodiment of the present invention, the fermentation medium is: Yeast Extract 2.5 g / L, Na2HPO4·7H2O 12.8 g, KH2PO4 3 g / L, NaCl 0.5 g / L, NH4Cl 1.0 g / L, glucose 20 g / L, 10 mL trace element solution / L. Trace element solution: 10 g / L FeSO4·7H2O, 1.35 g / L CaCl2, 2.2 g / L ZnSO4·7H2O, 0.58 g / LMnSO4·4H2O, 1 g / L CuSO4·5H2O, 0.1 g / L (NH4)6Mo7O 24 ·4H2O, 0.2 g / L Na2B4O7·10H2O, and 35% (wt) HCl, and the trace element solution was sterilized by filtration using a 2 μm filter.

[0077] Example 1 KpHpaB or CpHpaB hybrid and its use in the production of L-DOPA The expression plasmids of different hybrids were transformed into the tyrosine-producing Escherichia coli TYR-14B1 (Frontiers in Microbiology, 12(2021)710405) constructed in the laboratory to obtain recombinant E. coli producing L-DOPA. A fresh single colony on the LB plate was picked and placed in 5 mL LB medium and incubated at 37 o C. Culture at 200 rpm for about 14 h. Pipette a certain volume of seed solution and transfer it to 50 mL of fermentation medium to make the initial OD 600 The fermentation was carried out at 37°C and 200 rpm for 72 h. Samples were taken and the concentration of L-DOPA was determined by HPLC.

[0078] The results are shown in Table 1.

[0079] Table 1 L-DOPA synthesis by hybrid and recombinant E. coli

[0080] It can be seen that the hybrids composed of KpHpaB or CpHpaB and other HpaC significantly promoted the synthesis of L-DOPA. Compared with the commonly used E. coli HpaBC in the literature, the L-DOPA production was increased by 3.43~3.72 times.

[0081] Example 2 PaHpaB hybrid and its application in producing caffeic acid From Rhodotorula glutinosae tal The gene (GenBank: KF765779.1) was commissioned to a commercial company for full gene synthesis and ligated into the pZBKBP vector (pBBR1 replicon, kan resistance) to obtain the caffeic acid biosynthesis pathway plasmid pZBK-RgTAL.

[0082] The different hybrid expression plasmids and the caffeic acid synthesis pathway plasmid pZBK-RgTAL stored in the laboratory were co-transformed into the tyrosine-producing Escherichia coli TYR-14B1 (Frontiers in Microbiology, 12(2021)710405) constructed in the laboratory to obtain caffeic acid-producing recombinant Escherichia coli. Pick a fresh single colony on the LB plate and place it in 5 mL LB medium at 37 o C. Culture at 200 rpm for about 14 h. Pipette a certain volume of seed solution and transfer it to 50 mL of fermentation medium to make its initial OD 600 The fermentation was carried out at 37°C and 200 rpm for 72 h. The caffeic acid concentration was determined by HPLC.

[0083] The results are shown in Table 2.

[0084] Table 2 Caffeic acid synthesis by hybrid and recombinant Escherichia coli

[0085] It can be seen that the hybrid composed of PaHpaB and other HpaC significantly promoted the synthesis of caffeic acid. Compared with the commonly used E. coli HpaBC in the literature, the caffeic acid production was greatly improved. A211W The hybrid composed of the mutant and SeHpaC had the best effect.

[0086] Example 3 PlHpaB or CpHpaB hybrid and its use in the production of hydroxytyrosol The aro10-(G4S)3-yahK fragment was sent to a commercial company for full gene synthesis and connected to the pZBKBP expression vector (pBBR1 replicon, kan resistance) to obtain the tyrosol synthesis pathway expression plasmid pZBK-aro10-(G4S)3-yahK. aro10 (GenBank: AAB64816.1) from Saccharomyces cerevisiae, yahK (GenBank: NP_414859.1) from Escherichia coli.

[0087] The different hybrid expression plasmids and the tyrosol synthesis pathway expression plasmid pZBK-aro10-(G4S)3-yahK preserved in the laboratory were co-transformed into the tyrosine-producing bacteria Escherichia coli TYR-14B1 (Frontiers in Microbiology, 12(2021)710405) constructed in the laboratory before to obtain recombinant Escherichia coli producing hydroxytyrosol.

[0088] Pick a fresh single colony from the LB plate and place it in 5 mL LB medium at 37 o C. Culture at 200 rpm for about 14 h. Pipette a certain volume of seed solution and transfer it to 50 mL of fermentation medium to make the initial OD 600 The fermentation was carried out in a shaking incubator at 37°C and 200 rpm for 72 h. Samples were taken and the hydroxytyrosol concentration was determined by HPLC.

[0089] The results are shown in Table 3.

[0090] Table 3 Hydroxytyrosol synthesis by hybrid and recombinant Escherichia coli

[0091] It can be seen from this that compared with the commonly used E. coli HpaBC in the literature, the hybrid composed of PlHpaB and other HpaC significantly promoted the synthesis of hydroxytyrosol. S210A The mutant / KpHpaC had the best effect. CpHpaB / KpHpaC could also promote the synthesis of hydroxytyrosol. S217W The effect of the hybrid composed of mutant / KpHpaC was more obvious.

[0092] In addition to the expression vectors and tyrosine-producing strains described in this embodiment, any expression vectors and tyrosine-producing strains may be used.

[0093] In addition to the methods mentioned in this example, a whole cell culture method can also be used to produce L-DOPA, caffeic acid or hydroxytyrosol.

[0094] In addition to the above embodiments, the hydroxylase gene can also be integrated into the chromosome of E. coli to construct the corresponding recombinant E. coli. Those skilled in the art can also select other host cells for corresponding treatment as needed.

[0095] The embodiments of the present invention are described in detail above in conjunction with the embodiments, but the present invention is not limited to the above embodiments, and various changes can be made within the knowledge scope of ordinary technicians in the relevant technical field without departing from the purpose of the present invention.

Claims

1. A hybrid of 3-hydroxylase, characterized in that Contains HpaB and HpaC.

2. The hybrid according to claim 1, characterized in that The HpaB comprises at least one of HpaB or mutants thereof derived from Escherichia coli, Klebsiella pneumoniae, Photorhabdus luminescens, Burkholderia cepacia, Pseudomonas aeruginosa, Enterobacter typhimurium, and Enterobacter holmesii; The HpaC comprises at least one of HpaC derived from Escherichia coli, Klebsiella pneumoniae, Photorhabdus luminescens, Burkholderia cepacia, Pseudomonas aeruginosa, Salmonella enterica, and Enterobacter hallii, or mutants thereof; Preferably, the HpaB and HpaC in the hybrid are selected from the following combinations: B1) HpaB from Klebsiella pneumoniae and HpaC from Salmonella enterica serovar Typhimurium; B2) HpaB from Klebsiella pneumoniae and HpaC from Pseudomonas aeruginosa; B3) HpaB from Burkholderia cepacia and HpaC from Salmonella enterica; B4) HpaB from Burkholderia cepacia and HpaC from Pseudomonas aeruginosa; B5) HpaB from Burkholderia cepacia and HpaC from Photorhabdus luminescens; B6) HpaB from Burkholderia cepacia and HpaC from Enterobacter hallii; B7) HpaB from Pseudomonas aeruginosa and HpaC from Pseudomonas aeruginosa; B8) HpaB from Pseudomonas aeruginosa and HpaC from Enterobacter hallii; B9) HpaB from Pseudomonas aeruginosa and HpaC from Photorhabdus luminescens; B10) HpaB from Pseudomonas aeruginosa and HPaC from Salmonella enterica serovar Typhimurium; B11) HpaB from Pseudomonas aeruginosa and HpaC from Burkholderia cepacia; B12) HpaB from Pseudomonas aeruginosa and HpaC from Escherichia coli; B13) HpaB from Pseudomonas aeruginosa and HpaC from Klebsiella pneumoniae; B14) HpaB mutant from Pseudomonas aeruginosa S210A and HpaC from Salmonella enterica serovar Enterobacter; B15) HpaB mutant from Pseudomonas aeruginosa S210G and HpaC from Salmonella enterica serovar Enterobacter; B16) HpaB mutant from Pseudomonas aeruginosa A211W and HpaC from Salmonella enterica serovar Enterobacter; B17) HpaB from Photorhabdus luminescens and HpaC from Escherichia coli; B18) HpaB from Photorhabdus luminescens and HpaC from Salmonella enterica serovar Enterobacter; B19) HpaB from Photorhabdus luminescens and HpaC from Klebsiella pneumoniae; B20) HpaB from Photorhabdus luminescens and HpaC from Burkholderia cepacia; B21) HpaB from Photorhabdus luminescens and HpaC from Pseudomonas aeruginosa; B22) HpaB from Photorhabdus luminescens and HpaC from Enterobacter hallii; B23) HpaB from Photorhabdus luminescens and HpaC from Photorhabdus luminescens; B24) HpaB mutant from Photorhabdus luminescens S210G and HpaC from Klebsiella pneumoniae; B25) HpaB mutant from Photorhabdus luminescens S210A and HpaC from Klebsiella pneumoniae; B26) HpaB from Burkholderia cepacia and HpaC from Klebsiella pneumoniae; B27) Mutant HpaB from Burkholderia cepacia S217W and HpaC from Klebsiella pneumoniae.

3. The hybrid according to claim 2, characterized in that The amino acid sequence of HpaB derived from Escherichia coli is shown in GenBank ACT46003.1; and / or, the amino acid sequence of HpaC derived from Escherichia coli is shown in GenBank ACT46002.1; and / or, the amino acid sequence of HpaB derived from Klebsiella pneumoniae is shown in GenBank CDO16163.1; and / or, the amino acid sequence of HpaC derived from Klebsiella pneumoniae is shown in GenBank CDO16164.1; and / or, the amino acid sequence of HpaB derived from Photorhabdus luminescens is shown in GenBank AAO17197.1; and / or, the amino acid sequence of HpaC derived from Photorhabdus luminescens is shown in GenBank AAO17198.1; and / or, the amino acid sequence of HpaB derived from Burkholderia cepacia is shown in GenBank SDV46363.1; and / or, the amino acid sequence of HpaC derived from Burkholderia cepacia is shown in GenBank SDV46364.1; and / or, the amino acid sequence of HpaB from Pseudomonas aeruginosa is shown in GenBank PKG21040.1; and / or, the amino acid sequence of HpaC from Pseudomonas aeruginosa is shown in GenBank PKG21041.1; and / or, the amino acid sequence of HpaC from Salmonella enterica is shown in GenBank GAR62209.1; and / or, the amino acid sequence of HpaC from Enterobacter hallii is shown in GenBank PJG38871.1; and / or, the mutant HpaB from HpaB of Pseudomonas aeruginosa S210A Obtained by performing an amino acid substitution of S210A at position 210 of the amino acid sequence shown in GenBank PKG21040.1; and / or, the mutant HpaB derived from Pseudomonas aeruginosa S210G Obtained by performing an amino acid substitution of S210G at position 210 of the amino acid sequence shown in GenBank PKG21040.1; and / or, the mutant HpaB derived from Pseudomonas aeruginosa A211W Obtained by performing an amino acid substitution of A211W at position 210 of the amino acid sequence shown in GenBank PKG21040.1; and / or, the mutant HpaB of HpaB derived from Photorhabdus luminescens S210G Obtained by performing an amino acid substitution of S210G at position 210 of the amino acid sequence shown in GenBank AAO17197.1; and / or, the mutant HpaB derived from Photorhabdus luminescens S210A The amino acid sequence of GenBank AAO17197.1 was replaced by S210A at position 210.

4. The hybrid according to claim 1, characterized in that The HpaB encoding gene hpaB and the HpaC encoding gene hpaC Insert the connecting element sequence between them; Preferably, the connecting element sequence includes at least one of a linker sequence and a 5'-untranslated region sequence.

5. A biological material related to the hybrid according to any one of claims 1 to 4, characterized in that The biological material is any one of C1) to C4): C1), a nucleic acid molecule encoding the hybrid according to any one of claims 1 to 4; C2), an expression cassette containing the nucleic acid molecule described in C1); C3), a recombinant vector containing the nucleic acid molecule described in C1) or the expression cassette described in C2); C4), a recombinant biological cell containing the nucleic acid molecule described in C1), the expression cassette described in C2) or the recombinant vector described in C3).

6. The biomaterial according to claim 5, characterized in that The nucleic acid molecule comprises any one of C11) to C13): C11), the nucleotide sequence of the gene encoding HpaB is shown in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 or SEQ ID NO: 9; and / or the nucleotide sequence of the gene encoding HpaC is shown in SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12; C12), a DNA molecule having 80%, 85% or 90% or more homology with the nucleotide sequence of C11), and encoding the hybrid; C13), hybridizes with the nucleotide sequence defined in C11) under stringent conditions, and encodes a DNA molecule of the hybrid.

7. A kit, characterized in that: include: The hybrid according to any one of claims 1 to 4, or the biological material according to claim 5 or 6.

8. The method for preparing a hybrid according to any one of claims 1 to 4, characterized in that: The following steps are involved: The hybrid is obtained by expressing the coding gene of the hybrid according to any one of claims 1 to 4 in a biological cell.

9. A method for synthesizing levodopa, caffeic acid or hydroxytyrosol, characterized in that: The following steps are involved: A biological cell capable of synthesizing L-dopa, caffeic acid or hydroxytyrosol is allowed to express or contact the hybrid according to any one of claims 1 to 4.

10. Use of the hybrid according to any one of claims 1 to 4 or the biomaterial according to claim 5 or 6 in any one of D1) to D6); D1) Production of levodopa; D2) Preparation of products for the production of levodopa; D3) produces caffeic acid; D4) Preparation of products for producing caffeic acid; D5) Production of hydroxytyrosol; D6) Preparation of products for producing hydroxytyrosol.

Images