Heratoridae arthrosporium fungus and application thereof in prevention and treatment of pine wood line disease

Abstract

The invention discloses a strain of arthrosporium spp. And application thereof in prevention and treatment of pine wood line disease. The invention relates to Arthrobotrys heuanensis 18GD1705A, which is preserved in China General Microbiological Culture Collection Center (CGMCC) on November 15, 2021, the address of the Arthrobotrys heuanensis is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, the postal code is 100101, and the preservation number is CGMCC No.23851. The Arthrobotrys heuanensis 18GD1705A has the advantages that the Arthrobotrys heuanensis 18GD1705A can be used for preparing a microbial inoculant; according to the method disclosed by the invention, the river-source arthrosporium is inoculated into pine seedling bodies, and the nematodes are caught by utilizing a three-dimensional viscous bacterium net formed by special hypha metamorphosis and can also be killed by forming a structure similar to a contraction ring through singular contraction. Meanwhile, before the pine wood nematodes colonize the pine trees, the river source arthrosporium inoculant is inoculated into the pine trees, so that the tree vigor of the pine seedlings can be effectively enhanced, and a better prevention effect is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Arthrospora heyuanensis fungus and application thereof in preventing and controlling pine wood wilt disease. Background Art

[0002] Pine wilt disease, also known as pine wilt disease, is a disease caused by pine nematodes. The pathogenic nematodes are tiny and often enter the body of pine plants with the help of vector insects, causing physiological disorders in host plants and leading to the death of a large number of pine plants in a short period of time. China first discovered that pine nematode disease invaded Nanjing, Jiangsu in 1982. By the end of 2020, a total of 18 provincial and 726 county-level areas across the country had become pine nematode epidemic areas. In recent years, the number of pine species infected by pine nematode disease has continued to increase, and the scope of the disease has expanded to the north and southwest. Its rapid onset and difficulty in prevention and control have brought huge losses to my country's forestry economy and ecology, and seriously threatened the safety of my country's forestry ecological environment. At present, the methods for preventing and controlling pine nematodes are relatively simple, mainly focusing on timely cleaning of susceptible plants and killing pine nematode carriers Monochamus alternatus. However, these methods not only pollute the environment, make carrier insects and pathogenic nematodes resistant to drugs, but also consume a lot of resources. These problems have attracted the attention of relevant scholars, and they have begun to explore new prevention and control methods. At this time, biological control is particularly critical.

[0003] Current methods for controlling pine wood nematodes and shortcomings of existing technologies:

[0004] 1. Chemical control:

[0005] (1) Although this method can achieve good results against pathogenic pine wood nematodes, chemical agents are prone to environmental pollution, residues, and may kill natural enemies of pine wood nematodes, causing secondary pests to become rampant again.

[0006] (2) Long-term use of a single chemical agent for prevention and control can easily cause pine wood nematodes to develop resistance to the agent.

[0007] (3) The penetration and spread of pesticides by spraying is very limited and cannot kill pine wood nematodes, nor can it prevent healthy pine trees from being infected with pine wood nematodes.

[0008] (4) Some chemical agents have poor stability during the control of pine wood nematodes, which will affect the control effect.

[0009] (5) Pine wood nematodes reproduce quickly and can spread rapidly in the forest, making them difficult to control. If pesticides are not used correctly, the effectiveness of control will be greatly reduced.

[0010] 2. Physical prevention:

[0011] The method of felling pine wood nematode-infected trees may pose a risk of spreading the disease to other healthy pine trees during the operation, and will consume a lot of manpower and material resources.

[0012] 3. Biological control:

[0013] When trapping pine wood nematodes or their vector insects, only a small number of them will be trapped, resulting in low control efficiency. The cost of manufacturing traps is high in the early stage, and they need to be regularly maintained and cleaned by humans in the later stage, which is time-consuming and labor-intensive.

[0014] In the process of biological control of pine wood nematode disease, it is very important to use natural enemies of nematodes, including fungi, bacteria, rickettsia, actinomycetes, predatory nematodes, planarians, springtails, mites, earthworms, etc. Among them, 75% of the natural enemies of nematodes are fungi. At present, fungi are the most studied and easier to promote. According to the habits of fungi infecting nematodes, they can be divided into four major groups: predatory nematode fungi, endoparasitic fungi, opportunistic fungi and toxin-producing fungi. Among them, predatory nematode fungi have attracted much attention because of their ability to capture nematodes with their specialized sticky hyphae, sticky branches, sticky balls, sticky nets, non-contractile rings, contractile rings and crown capsules. Since the discovery of predatory nematode fungi in 1839, many scholars at home and abroad have done a lot of research on its predatory characteristics, biochemical mechanisms and clinical applications. It was found that it is widely distributed in natural soil, farmland soil and various organic residues, and has a strong ability to adapt to the environment. Nematode-trapping bacteria specialize their vegetative hyphae to form a predator. When nematodes pass by, they are captured mechanically or by adhesion, and then they kill and digest the nematodes by secreting related enzymes and other substances. This can control the number of pine wood nematodes to a certain extent, effectively reduce the incidence of pine wood nematode disease, and has great development and application prospects in the prevention and control of pine wood nematodes. At present, the most common nematode-trapping bacteria are Arthrobotrys oligospora and Arthrobotrys cladodes, which are considered to be a potential effective biological product for the prevention and control of parasitic nematodes.

[0015] The Arthrospore fungus isolated from pine trees can grow stably in pine trees and can prey on nematodes in pine trees, which is truly a natural product. It not only saves manpower and material resources, has no impact on the environment and trees, but also helps reduce chemical pollution and maintain ecological balance. At present, the application of nematode-predating bacteria to control soil nematodes is the focus of biological control, but there is no report on the use of Arthrospore to control pine wood nematodes in pine trees. Summary of the invention

[0016] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a biocontrol fungus that is easy to use in the control of pine wood nematodes, has significant control effects, grows and reproduces quickly, is friendly to the ecological environment and has no pollution, saves costs, and can enhance tree vigor and prevent the occurrence of pine wood nematodes.

[0017] Arthrobotrys heyuanensis 18GD1705A was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on November 15, 2021, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No. 23851.

[0018] The second object of the present invention is to provide a biological product containing the above-mentioned Arthrosporum heyuanensis 18GD1705A as an active ingredient.

[0019] The third object of the present invention is to provide the use of the above-mentioned Arthrospora heyuanensis 18GD1705A or biological products in preventing and controlling pine wood nematode disease.

[0020] The fourth object of the present invention is to provide a method for controlling pine wood nematodes, which comprises applying the above-mentioned Arthrospora heyuanensis 18GD1705A or biological products into pine trees to control pine wood nematodes.

[0021] Preferably, the wound on the pine stem is inoculated with a bacterial solution of Arthrospora heyuanensis 18GD1705A or a spore solution thereof.

[0022] A further preferred method is to use a sterile scalpel to make a 1 cm wound on the stem of the pine seedling at a downward angle of about 80°, fill the wound with sterile cotton to receive the Heyuan joint spore 18GD1705A spore suspension, then connect the Heyuan joint spore 18GD1705A suspension, and finally wrap the wound with a sealing film.

[0023] Compared with the prior art, the advantages of the present invention are:

[0024] 1. The culture conditions of Heyuan Artemisia selengensis are simple, the preparation of spore suspension is easy to operate, and it is convenient to use. It is a natural product, non-toxic and pollution-free.

[0025] 2. Injecting spore suspension at normal temperature and pressure can make the Heyuan knot spore fungus colonize quickly in the tree body. The special modified hyphae three-dimensional sticky fungal net or contraction ring-like structure produced by it can constrict and kill nematodes without affecting the environment and the tree body, which helps to reduce chemical pollution and maintain ecological balance.

[0026] 3. Injecting it into healthy pine trees in advance can enhance the vigor of the pine trees and play a good preventive effect.

[0027] 4. Spores of the river source can grow stably in the xylem of pine trees and can prey on pine wood nematodes in the host environment.

[0028] The present invention inoculates the Heyuan knot spore fungus into the pine seedlings, and uses the three-dimensional sticky fungus net formed by the special hyphae metamorphosis to capture nematodes, and can also kill nematodes by constricting them through the formation of a structure similar to a contraction ring. At the same time, inoculating the Heyuan knot spore fungus agent into the pine tree before the pine wood nematodes have colonized the pine tree can effectively enhance the tree vigor of the pine seedlings and play a good preventive effect.

[0029] Arthrobotrys heyuanensis 18GD1705A was deposited in the General Microbiology Center of China Culture Collection Administration (CGMCC) on November 15, 2021, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No. 23851. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the phylogenetic tree constructed based on ITS in this study;

[0031] Figure 2 a: front and back of colony on MEA medium; b: three-dimensional sticky bacterial net; c: constriction of hyphae killing pine wood nematodes; df: three-dimensional bacterial net entangles pine wood nematodes; gI: conidiophores and conidia: bf, i = 20 um; g, h = 10 um;

[0032] Figure 3 The effects and differences of Heyuan Arthrospore on controlling pine wood nematodes;

[0033] Figure 4 This is the effectiveness of Heyuan's knotty spores in controlling pine wood nematodes. DETAILED DESCRIPTION

[0034] The present invention will be further described below by way of examples. The following examples are only used to further explain the present invention and are not intended to limit the present invention.

[0035] Example 1. Isolation and purification of Arthrobotrys heyuanensis 18GD1705A.

[0036] 2% Malt Extract Agar Powder Medium (MEA): 20 g malt powder, 20 g agar powder, distilled water to 1000 ml, sterilize at 121°C for 20 min.

[0037] The bark samples of the infected wood of Pinus massoniana collected from Heyuan City, Guangdong Province were placed under a stereomicroscope for observation. When fungal fruiting bodies or hyphae of different colors and textures were observed, a sterile inoculation needle sterilized by the outer flame of an alcohol lamp was used to pick up part of the structure of the fruiting body or hyphae and inoculated on a 2% malt powder agar medium (MEA) medium, and the medium was sealed and placed in a dark condition of 25°C for cultivation. After the hyphae grew out, the tip of the hyphae was picked up with a sterile inoculation needle in a sterile environment, transferred to a blank MEA medium, and purified and cultured in a dark environment of 25°C. After the colonies grew out, the color and morphology of the colonies were observed to determine whether the colonies were contaminated by miscellaneous bacteria. After 2-3 transfers and purifications, it was confirmed to be a single colony, and it was considered that pure culture was obtained, that is, the strain Arthrobotrys heyuanensis 18GD1705A of the present invention was obtained.

[0038] Example 2: Identification of Arthrobotrys heyuanensis 18GD1705A

[0039] (1) Molecular identification

[0040] The DNA of Arthrobotrys heyuanensis 18GD1705A was extracted using a fungal genomic DNA extraction kit. Then, PCR amplification was performed using the universal primers BT2a (GGTAACCAAATCGGTGCTGCTTTC) and BT2b (ACCCTCAGTGTAGTGACCCTTGGC) for amplification of the TUB gene region. The PCR amplification reaction used a 25 μL reaction system: 12.5 μL TaqMaster Mix polymerase mixture, 10.5 μL PCR-grade deionized water, 0.5 μL forward system primer, 0.5 μL reverse system primer, and 1 μL DNA extraction solution. The PCR amplification conditions were: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, and super extension at 72℃ for 10 min, in which the denaturation, annealing, and extension steps were repeated 35 cycles. After the reaction, the amplified product was analyzed by 1.5% agarose gel, the sample lane bands were observed and recorded, and the PCR recovery product with clear bands was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to obtain its TUB sequence. The Beta-tubulin gene sequence of strain Arthrobotrys heyuanensis 18GD1705A is as follows:

[0041] (SEQ ID NO.1)

[0042] The obtained sequences were compared with the target sequences by BLAST, and similarity sequences were searched on Genbank. After downloading the relevant sequences, the maximum likelihood (ML) phylogenetic tree was constructed using MEGAX software, and the Bootstrap was set to 1000 repetitions. From the constructed phylogenetic tree ( Figure 1 ), strain Arthrobotrysheyuanensis 18GD1705A formed a single branch with high support. Therefore, molecular systematic analysis confirmed that the fungus was a newly discovered species.

[0043] (2) Morphological identification

[0044] The strain Arthrobotrys heyuanensis 18GD1705A of the present invention has the following characteristics: Figure 2): The suitable growth temperature of this fungus on MEA medium is 25℃. The colony is fluffy, the hyphae are dense, and a white oval band is formed on the edge of the colony. The front and back of the colony are both white. The vegetative hyphae are colorless and moderately separated. The conidia of this fungus on 2% water agar plates are colorless, with 1 separation, obovate, and 7.63~17.43(11.01)×4.99~12.24(7.93)μm in size. The conidiophores are colorless, erect, solitary, separated, with few branches or no branches, and the stalks have short small tooth stalks, with 2~5 conidia at the top ( Figure 2 ). It can form a three-dimensional sticky fungus net through special hyphae metamorphosis to capture nematodes. It can also kill nematodes by constricting them by forming a structure similar to a contractile ring.

[0045] The Arthrobotrys heyuanensis 18GD1705A of the present invention was deposited in the General Microbiology Center (CGMCC) of the China Culture Collection Administration on November 15, 2021, at No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, and the deposit number is: CGMCC No. 23851.

[0046] Example 3: Outdoor biological control effect of Arthrobotrys heyuanensis 18GD1705A on pine wood nematodes

[0047] The outdoor biological control experiment was divided into 5 groups: the AhN group that was first inoculated with Heyuan Arthrospore 18GD1705A and then with pine wood nematode, the NAh group that was first inoculated with pine wood nematode and then with Heyuan Arthrospore 18GD1705A, the Ah group that was only inoculated with Heyuan Arthrospore 18GD1705A, the N group that was only inoculated with pine wood nematode, and the Control group that was only inoculated with sterile water.

[0048] (1) Preparation of fungal spore suspension: Take MEA medium covered with hyphae of Heyuan Arthrospora 18GD1705A, add 2.5 ml of sterile water, then use a sterile cotton swab to scrape the hyphae on the surface of the medium, pour it into a 15 ml sterile centrifuge tube, add 2.5 ml of sterile water to rinse the surface of the medium, then use a vortex oscillator to shake it thoroughly for 4 minutes, then pour it into a funnel padded with sterile cotton wool, filter it into a conical flask, and then rinse the centrifuge tube and the filter residue with appropriate amount of sterile water, finally put the conical flask in a 4°C refrigerator for 6 hours, transfer an appropriate amount of supernatant to obtain a spore suspension. Observe the number of spores using a hemocytometer, and take the average value after counting 3 times. Number of spores / ml = number of spores in 80 small grids / 80*400*10 4 After calculating the concentration of the spore suspension, adjust the spore concentration to 4*10 by increasing or decreasing the amount of sterile water. 6 U / mL (first stage inoculation) or 7*10 6U / ml (second stage inoculation).

[0049] (2) Preparation of pine wood nematode suspension: The reared pine wood nematodes are drained out using the Baermann funnel method and collected in a centrifuge tube. The centrifuge tube containing the suspension is placed in a centrifuge and centrifuged at 3000 rpm / min for 3 min. The upper layer of liquid is then removed by suction to remove impurities in the suspension, and an appropriate amount of sterile water is added to obtain a nematode suspension. The concentration of the nematode suspension is calculated by preparing a temporary slide specimen, and the average value is taken after counting 5 times. After calculating the concentration of the pine wood nematodes in the suspension, the nematode concentration is adjusted to 5000 U / ml (first stage inoculation) or 10000 U / ml (second stage inoculation) by increasing or decreasing the amount of sterile water.

[0050] (3) Inoculate the suspension into the Masson pine seedlings

[0051] Phase 1:

[0052] The spore suspension of Heyuan Arthrocys 18GD1705A was inoculated into 70 pine seedlings, of which 20 were inoculated with only the spore suspension. The operation method is as follows: Use a sterile scalpel to make a wound with a horizontal depth of about 1mm, a vertical length of about 1cm, and a width of about 0.5cm on the stem at an angle of 80 degrees downward, and the wound is about 9cm away from the soil surface. Then fill the wound with an appropriate amount of sterile cotton, and then use a pipette to absorb 120ul of the spore suspension with a concentration of 400w / mL into the sterile cotton, and finally quickly wrap the wound with a sealing film.

[0053] Inoculate the pine wood nematode suspension into 70 pine seedlings, of which 20 were controls that received only the nematode suspension. The same operation method was used as above, and the wound was adjusted to about 12 cm from the soil surface. Use an appropriate amount of sterile cotton to fill the wound to receive the suspension, then use a pipette to inoculate 120 ul of the nematode suspension at a concentration of 5000 U / ml, and finally quickly wrap the wound with a sealing film.

[0054] Phase 2:

[0055] After 14 days, 120ul of 10000U / ml nematode suspension was inoculated on 50 pine seedlings that had been inoculated with spore suspension of Heyuan Arthrospora 18GD1705A, and the wound was about 12cm away from the soil surface. 120ul of 700w / ml spore suspension was inoculated on 50 pine seedlings that had been inoculated with pine wood nematodes, and the wound was about 9cm away from the soil surface.

[0056] At the same time, mechanical injury blank control groups were set up in the first and second stages, and 120ul of sterile water was introduced into 20 pine seedlings, with the wounds about 9cm and 12cm away from the soil surface.

[0057] (4) Observe and record the growth status of Masson pine

[0058] The day of access to the suspension of Heyuan Arthrospore and pine wood nematode was counted as the first day. The growth status of the pine seedlings was recorded once a week thereafter, and the appearance of the Masson pine seedlings' tips and needles was observed to determine the infection and survival of the pine seedlings. At the same time, photos were taken every fourteen days to record the growth status of the pine seedlings. The observation and recording period after access to the suspension was 11 weeks.

[0059] (5) Isolation of fungi and pine wood nematodes again after 11 weeks

[0060] For pine seedlings inoculated with Heyuan Arthrospora 18GD1705A and pine wood nematodes, we conducted stereoscopic examination and surface disinfection and then separated them to determine whether Arthrospora fungi could successfully colonize and prevent pine wood nematodes from infecting Masson pine, and further determine that the pathogen causing the death of Masson pine was pine wood nematodes. The specific methods are as follows:

[0061] Examine the diseased pine seedlings after inoculation under a microscope to observe whether there is resin secretion at the wound and inside and outside the bark, whether there are surviving pine wood nematodes, whether there are colonies of Arthrospora fungi, and whether the wood has blue discoloration. If white colonies are found, use a sterile inoculation needle to pick a small amount of colonies and put them into MEA medium, and culture them at 25℃ in the dark for 7 days.

[0062] For pine seedlings that did not develop disease after inoculation, cut stems about 5 cm long with the wounds of the fungus and pine wood nematodes as the center for surface disinfection. Soak in 6.25% sodium hypochlorite solution for 1 min, 75% alcohol for 1 min, and rinse in sterile water for 30 s, and repeat 3 times. After surface disinfection, cut logs from 3 parts of the wound area and non-wound area, respectively, and inoculate the logs from the same part into MEA culture medium, and culture the culture medium at 25°C in the dark for 7 days. Finally, observe whether the fungal colonies of the genus Arthrospora are formed by stereomicroscope.

[0063] The experimental results showed that under the cover of sealing film, Heyuan Articulospore 18GD1705A can successfully colonize the bark or xylem of Masson pine seedlings. Firstly inoculating Heyuan Articulospore can, on the one hand, also enhance the vigor of pine seedlings and delay the process of pine wood nematode infection, which can delay for about one month; on the other hand, it can effectively reduce the mortality of pine seedlings. For example, the mortality rate of group N, which was only inoculated with pine wood nematodes, reached 85%, the mortality rate of group C, which was only inoculated with sterile water, was 15%, and all the seedlings in group Ah, which was only inoculated with Heyuan Articulospore 18GD1705A, survived. The mortality rate of pine seedlings in group NAh, which was first inoculated with nematodes and then with Heyuan Articulospore 18GD1705A, reached 90%, while the mortality rate of pine seedlings in group AhN, which was first inoculated with Heyuan Articulospore 18GD1705A and then with nematodes, was 28%. Although active pine wood nematodes were still present on 6.67% to 15.73% of the surviving pine seedlings after three months, the Heyuan Arthrospora 18GD1705A could effectively enhance the vigor of the pine seedlings and achieve a good preventive effect if it was introduced before the pine wood nematodes infect and colonize the pine seedlings ( Figure 3 , 4 ).

[0064] The above is only a preferred embodiment of the present invention and should not be regarded as limiting the present invention. It should be pointed out that, for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present application, which should be regarded as the protection scope of the present application.

Claims

1. Arthrobotrys heyuanensis 18GD1705A, deposit number: CGMCC No.23851.

2. A biological product, characterized in that The invention contains the Arthrosporum heyuanensis 18GD1705A or its spores as claimed in claim 1 as an active ingredient.

3. Use of the heyuanense 18GD1705A described in claim 1 or the biological product described in claim 2 in preventing and controlling pine wood nematode disease.

4. A method for controlling pine wood nematodes, characterized in that: The method comprises applying the Heyuan Arthrospore 18GD1705A described in claim 1 or the biological product described in claim 2 to pine trees to prevent and control pine wood nematodes.

5. The method according to claim 4, characterized in that The method is to inoculate the Heyuan Arthralgia 18GD1705A bacterial liquid or spore liquid on the wounds of the pine tree stems.

6. The method according to claim 5, characterized in that A sterile scalpel was used to make a 1 cm wound on the stem of the pine seedling at a downward angle of about 80°, and the wound was filled with sterile cotton to receive the spore suspension of Heyuan Arthroconidia 18GD1705A, and then the Heyuan Arthroconidia 18GD1705A suspension was connected, and finally the wound was wrapped with a sealing film.

Images