Protective agent, sample collection protection card as well as preparation method and application of sample collection protection card

Abstract

The invention relates to a protective agent, a sample collection protection card as well as a preparation method and application of the sample collection protection card. The protective agent is prepared from the following components: a buffer agent, SDS (Sodium Dodecyl Sulfate), octyl glucoside, Pluronic F-127, polysaccharide, a complexing agent, protease K, an antioxidant and an antimicrobial agent. The sample collection protection card containing the protective agent can effectively preserve trace cell samples, so that subsequent accurate and effective detection of genetic materials carried by single cells is facilitated.

Description

Technical Field

[0001] The present application relates to the field of biological sample collection, and in particular to a protective agent, a sample collection protection card, and a preparation method and application thereof. Background Art

[0002] With the continuous development of biomedical technology, higher requirements have been put forward for the collection, transportation and preservation of various types of biological samples. As a new type of sample collection and preservation tool, sample protection cards have the advantages of simple operation, low cost, easy transportation, and long preservation time. They have been widely used in clinical diagnosis, scientific research experiments and other fields.

[0003] In the field of clinical diagnosis, sample protection cards can be used to collect and preserve samples such as blood, saliva, and tissues, providing convenience for disease screening, genetic testing, and virus testing. Especially in some resource-scarce areas, the use of sample protection cards can effectively reduce the cost of sample transportation and preservation and improve the accessibility of testing. In the field of scientific research experiments, sample protection cards can be used to collect and preserve biological samples such as blood, cells, and tissues, providing valuable sample resources for research in genomics, proteomics, and cell biology. The use of sample protection cards can simplify the sample collection and preservation process, reduce the risk of contamination, and improve the repeatability of experiments. In the field of field surveys and environmental monitoring, sample protection cards can also be used to collect and preserve animal and plant samples, environmental samples, etc., providing convenience for biodiversity surveys, pathogen monitoring, and other work. However, in the above-mentioned detection applications, the collected and preserved blood, body fluids, tissues, and other samples contain a large number of cells, and have a certain tolerance to cell inactivation and DNA degradation. There are relatively mature sample collection and preservation methods.

[0004] There are some sample protection cards on the market that are used for common body fluid sample types such as blood and saliva. These samples contain a large number of cells and are less difficult to preserve. There are no sample protection cards for trace cell samples. It is difficult to preserve extremely trace cell samples. The amount of nucleic acid DNA they contain is extremely low, they are easily degraded, and the cost of storage and transportation is high.

[0005] In high-sensitivity analyses such as single-cell research, rare cell detection, liquid biopsy, and assisted reproduction, there are still some situations where it is necessary to collect and preserve extremely small amounts of cell samples from sources such as blood, body fluids, tissues, and reproductive cells. The cell content of such samples is as low as single digits, and trace cells are prone to inactivation and loss. DNA is also more susceptible to degradation by environmental factors, and existing methods for collecting and preserving conventional samples cannot be effectively applied. In the application direction of single-cell analysis, such as single-cell genomics, the genomic information of a single cell is analyzed through single-cell DNA sequencing, which can reveal genetic heterogeneity between cells and is often used in cancer research, developmental biology, and other fields.

[0006] Detection of rare immune cells: In immunological research, the detection of rare subpopulations of immune cells (such as certain specific T cells or B cells) involves trace cell samples. In peripheral blood, rare lymphocytes only account for 0.1%–0.5% of lymphocytes.

[0007] In the field of liquid biopsy, the main detection object is the extremely small amount of circulating tumor cells (CTC) separated from the blood, which helps to detect cancer early or monitor the effect of treatment. Since the concentration of CTC in the blood is extremely low, it is usually necessary to perform highly sensitive detection on trace tumor cell samples.

[0008] In preimplantation testing (PGT), gametes or embryos are biopsied to obtain some genetic material for chromosome and gene testing to diagnose whether there are single gene defects, aneuploidy or chromosome structural abnormalities, etc., and normal embryos are selected to be implanted in the uterus to obtain healthy offspring. PGT biopsy the trophectoderm of the blastocyst grown to the 5th-6th day, and uses a biopsy needle to aspirate 3-5 cells for subsequent genetic testing. In prenatal diagnosis, a small amount of amniotic fluid or chorionic cells is extracted for genetic analysis, and the sample usually contains only trace cells.

[0009] In summary, the collection, preservation, and transportation of trace cells from blood, body fluids, tissues, germ cells, etc., as well as the detection of genetic material carried by single cells, urgently require a simple-to-operate and effective trace cell sample collection and protection card. Summary of the invention

[0010] Based on this, it is necessary for one embodiment of the present application to provide a protective agent and a sample collection protection card containing the protective agent, which can effectively preserve extremely small amounts of cell samples to facilitate subsequent accurate and effective detection of genetic material carried by single cells.

[0011] The technical solutions include the following:

[0012] The protective agent comprises the following components: a buffer, SDS, octyl glucoside, Pluronic F-127, a polysaccharide, a complexing agent, proteinase K, an antioxidant and an antimicrobial agent.

[0013] In one embodiment, the protective agent satisfies one or more of the following conditions:

[0014] The buffer comprises Tris;

[0015] The polysaccharide comprises one or more of arabinan polysaccharide, dextran, trehalose, hydroxyethyl starch and fructan;

[0016] The complexing agent includes EDTA;

[0017] The antioxidant includes N-acetylcysteine ​​and / or butylated hydroxyanisole;

[0018] The antimicrobial agent includes NaN 3 .

[0019] In one embodiment, the protective agent comprises the following components:

[0020] 40 mg / mL-60 mg / mL buffer, 60 mg / mL-110 mg / mL SDS, 0.5%w / v-2%w / v octylglucoside, 0.01%w / v-1%w / v Pluronic F-127, 0.5%w / v-2%w / v arabinan, 0.01 M -0.06 MEDTA, 0.5 mg / mL-5 mg / mL proteinase K, 0.5 mol / L-1.5 mol / L N-acetylcysteine, 0.01%w / v-0.1%w / v butylated hydroxyanisole, and 0.02%w / v-0.05%w / v NaN 3 .

[0021] The sample collection protection card comprises a matrix material and the protective agent.

[0022] In one embodiment, the protective agent is contained on the substrate material.

[0023] In one embodiment, the matrix material includes one or more of a polytetrafluoroethylene membrane, a nitrocellulose membrane, and a polyvinylidene fluoride membrane.

[0024] In one embodiment, the polytetrafluoroethylene film has a fine mesh honeycomb structure and a multi-layer film structure.

[0025] In one embodiment, the polytetrafluoroethylene membrane includes the following components: polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile.

[0026] In one embodiment, the components including the polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile are mixed, and then the polytetrafluoroethylene linear fibers are prepared by electrospinning technology, and then the polytetrafluoroethylene membrane is prepared by heat pressing.

[0027] In one embodiment, the total concentration of polytetrafluoroethylene, polyvinyl alcohol and polyacrylonitrile in the obtained mixed solution is 5% w / v-15% w / v.

[0028] In one embodiment, the diameter of the polytetrafluoroethylene linear fiber is 100 nm-2 μm.

[0029] The method for preparing the sample collection protection card comprises the following steps:

[0030] The matrix material, optionally, a polytetrafluoroethylene membrane is soaked with the protective agent and dried.

[0031] The sample collection protection card is used in scenarios or methods where extremely small amounts of cells are used as samples.

[0032] In one embodiment, the scenarios using extremely small amounts of cells as samples include at least one of the following: single cell analysis, rare immune cell detection, liquid biopsy, and preimplantation testing (PGT).

[0033] In one embodiment, the method using a very small amount of cells as a sample comprises at least one of the following: single cell whole genome amplification, PCR amplification and sequencing.

[0034] The method for collecting samples includes adding the collected samples to the sample collection protection card and drying them.

[0035] In one embodiment, the sample includes a trace amount of cell sample.

[0036] In one embodiment, the sample includes a trace amount of cell sample of at least one type of blood, body fluid, tissue and reproductive cells.

[0037] Compared with the traditional technology, this application has the following beneficial effects:

[0038] The present application provides a protective agent and a sample collection protection card containing the protective agent. The sample collection protection card is made of polymer materials, especially polytetrafluoroethylene membrane, as a matrix material, and is soaked and made with highly efficient extremely small amounts of cells and DNA protection reagent components to collect and protect trace cell samples. The protective agent contained in the sample collection protection card includes components that gently lyse cells, release sample DNA, and protect sample DNA from degradation. It has the ability to enrich DNA and extend the storage time of DNA. It has the functions of effective ingredients such as protein denaturation, cell membrane rupture, DNA adsorption and fixation, and weakening oxidative degradation of DNA, thereby ensuring that the target DNA is stored on the storage card for a long time without reducing the PCR efficiency. The sample collection protection card also has the ability to inactivate bacteria, viruses, etc., which can reduce the risk of personnel contacting potential pathogenic microorganisms, and at the same time facilitate the transportation and long-term storage of samples at room temperature, ensuring the safety of long-distance transportation. After the sample is collected, the DNA contained in the cell can be released and simply eluted, and subsequent single-cell amplification and downstream PCR detection, high-throughput sequencing, etc. can be carried out.

[0039] The collection and protection card of this application can be used for the collection and protection of various types of extremely small cell samples. It is a low-cost and universal integrated collection and preservation solution, and can also be used in other fields of life sciences. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions in the embodiments of the present application and to more completely understand the present application and its beneficial effects, the following is a brief introduction to the drawings required for the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present application, and those skilled in the art can obtain other drawings based on these drawings without creative work.

[0041] Figure 1 This is a microscopic image of a polytetrafluoroethylene membrane.

[0042] Figure 2 This is a microscopic image of nitrocellulose membrane.

[0043] Figure 3 This is the electrophoresis result of the multiplex PCR product of Experimental Example 1.

[0044] Figure 4 This is the electrophoresis result of the multiplex PCR product of Experimental Example 2.

[0045] Figure 5 Shows the chromosomes of different numbers of C2 (GM10958) cells.

[0046] Figure 6 The results are fluorescent quantitative qPCR.

[0047] Figure 7 The melting curve results of fluorescence quantitative qPCR are shown in Figure 2.

[0048] Figure 8 Chromosomes of C2 (GM10958) cells preserved on different matrix membranes. DETAILED DESCRIPTION

[0049] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail below. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application.

[0051] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0052] Explanation of the English abbreviations involved in this article:

[0053] CTCs: Circulating Tumor Cells, circulating tumor cells.

[0054] PGT: Preimplantation Genetic Testing, preimplantation genetic testing.

[0055] Pluronic F-127: Polyethylene-polypropylene glycol, polyoxyethylene polyoxypropylene ether triblock copolymer, poloxamer.

[0056] EDTA: Ethylene Diamine Tetraacetic Acid.

[0057] Tris: (hydroxymethyl) methyl aminomethane THAM, trishydroxymethylaminomethane.

[0058] SDS: Sodium dodecyl sulfate.

[0059] NaN 3 : Sodium azide, sodium azide.

[0060] NGS: Next Generation Sequencing, high-throughput sequencing.

[0061] Traditional preservation technology for extremely small amounts of cell samples still has many shortcomings, mainly facing the following problems:

[0062] It is difficult to preserve extremely small amounts of cells: the cell membranes, organelles, and other structures of a single cell sample are very fragile. Compared to samples containing a large number of cells, such as blood or tissue, extremely small amounts of cell samples are more susceptible to environmental factors, such as temperature fluctuations, humidity changes, light, and oxidation reactions. These factors may cause cells to degrade rapidly or even lose cell integrity within a short period of time after collection. Due to the extremely small number of cells, any form of damage or degradation will significantly affect the experimental results.

[0063] The storage and transportation costs of trace cells are high: trace cell samples usually need to be stored and transported at low temperatures (-20℃-70℃) to prevent sample degradation. Cold chain transportation involves expensive equipment and strict management, which significantly increases transportation costs.

[0064] The nucleic acid DNA contained in trace amounts of cells is easily degraded: the amount of DNA contained in a single cell is extremely low, about 6 pg / cell, and DNA is easily affected by various chemicals, enzymes, etc., causing its structure to be destroyed. The main ways of DNA degradation are enzyme catalysis, cleavage of N-glycosidic bonds, oxidation reactions, and hydrolysis reactions. There are biological molecules in the environment that are easily degradable to DNA, such as proteins, DNA nucleases, etc. In addition, when single cell samples are stored at low temperatures, DNA degradation will also occur as the samples are frozen and thawed. For applications that require high-quality nucleic acids, such as DNA chip detection and high-throughput sequencing, it will affect the accuracy and repeatability of subsequent experiments.

[0065] Therefore, one embodiment of the present application provides a protective agent, which includes the following components: a buffer, SDS, octyl glucoside, Pluronic F-127, a polysaccharide, a complexing agent, proteinase K, an antioxidant and an antimicrobial agent.

[0066] In the present application, the buffer is used to adjust the pH of the system. In a specific example, the buffer includes Tris.

[0067] In this application, SDS is a surfactant that can destroy cell membranes, dissolve cells and release DNA molecules. Octyl glucoside and Pluronic F-127 are components that quickly lyse cell tissues, better gently lyse single cells and release DNA. Proteinase K can digest proteins bound to DNA to release DNA. Antimicrobial agents can effectively inhibit the growth of bacteria, fungi and other microorganisms to ensure the safety of samplers.

[0068] In this application, the complexing agent is capable of chelating Mg 2＋ , Ca 2＋ The chelating agent comprises EDTA, which is a metal ion that inhibits the degradation of DNA by deoxyribonuclease (DNase) and stably stores DNA. In a specific example, the chelating agent comprises EDTA.

[0069] In a specific example, the polysaccharide includes one or more of arabinan polysaccharide, dextran, trehalose, hydroxyethyl starch and fructan. Preferably, the polysaccharide is arabinan polysaccharide, which is combined with other reagents such as octyl glucoside and Pluronic F-127 components to achieve better DNA recovery and protection effects. Arabinan polysaccharide is a hydrophilic polysaccharide that can form a highly branched three-dimensional network structure by itself. It helps maintain the natural conformation of DNA by interacting with DNA and surrounding water molecules, and can shield restriction nucleases (such as DNase) from degradation of DNA.

[0070] In a specific example, the antioxidant includes N-acetylcysteine ​​and / or butylated hydroxyanisole. Preferably, the antioxidant is N-acetylcysteine ​​and butylated hydroxyanisole. N-acetylcysteine ​​can protect DNA from oxidative damage that may occur during the cleavage process by reducing oxidative stress, thereby maintaining the integrity of DNA.

[0071] In one specific example, the antimicrobial agent includes NaN 3 NaN 3 It is a powerful antimicrobial agent that can effectively inhibit the growth of bacteria, fungi and other microorganisms, ensuring the safety of samplers.

[0072] In a specific example, 40 mg / mL-60 mg / mL buffer, 60 mg / mL-110 mg / mL SDS, 0.5%w / v-2%w / v octylglucoside, 0.01%w / v-1%w / v Pluronic F-127, 0.5%w / v-2%w / v polysaccharide, 0.01 M -0.06 M EDTA, 0.5 mg / mL-5 mg / mL proteinase K, 0.5 mol / L-1.5 mol / L N-acetylcysteine, 0.01%w / v-0.1%w / v butylated hydroxyanisole, and 0.02%w / v-0.05%w / v NaN 3 .

[0073] In a specific example, in the protective agent, the concentration of the buffer can be selected as but not limited to 40 mg / mL, 45 mg / mL, 50 mg / mL, 55 mg / mL, 60 mg / mL, or a range consisting of any two of the above values.

[0074] In a specific example, in the protective agent, the concentration of SDS can be selected as but not limited to 60 mg / mL, 65 mg / mL, 70 mg / mL, 75 mg / mL, 80 mg / mL, 85 mg / mL, 90 mg / mL, 95 mg / mL, 100 mg / mL, 105 mg / mL, 110 mg / mL, or a range consisting of any two of the above values.

[0075] In a specific example, in the protective agent, the concentration of octyl glucoside can be selected as but not limited to 0.5% w / v, 0.75% w / v, 1% w / v, 1.25% w / v, 1.5% w / v, 1.75% w / v, 2% w / v, or a range consisting of any two of the above values.

[0076] In a specific example, in the protective agent, the concentration of Pluronic F-127 can be selected as but not limited to 0.01% w / v, 0.05% w / v, 0.1% w / v, 0.5% w / v, 1% w / v, or a range consisting of any two of the above values.

[0077] In a specific example, in the protective agent, the concentration of arabinan polysaccharide can be selected as but not limited to 0.5% w / v, 0.8% w / v, 1% w / v, 1.2% w / v, 1.5% w / v, 2% w / v, or a range consisting of any two of the above values.

[0078] In a specific example, in the protective agent, the concentration of EDTA can be selected as but not limited to 0.01 M, 0.02 M, 0.03 M, 0.04 M, 0.05 M, 0.06 M, or a range consisting of any two of the above values.

[0079] In a specific example, in the protective agent, the concentration of proteinase K can be selected as but not limited to 0.5 mg / mL, 1 mg / mL, 1.5 mg / mL, 2 mg / mL, 2.5 mg / mL, 3 mg / mL, 3.5 mg / mL, 4 mg / mL, 4.5 mg / mL, 5 mg / mL, or a range consisting of any two of the above values.

[0080] In a specific example, in the protective agent, the concentration of N-acetylcysteine ​​can be selected as but not limited to 0.5 mol / L, 0.8 mol / L, 1.0 mol / L, 1.2 mol / L, 1.5 mol / L, or a range consisting of any two of the above values.

[0081] In a specific example, in the protective agent, the concentration of butylated hydroxyanisole can be selected as but not limited to 0.01% w / v, 0.02% w / v, 0.05% w / v, 0.08% w / v, 0.1% w / v, or a range consisting of any two of the above values.

[0082] In one specific example, in the protective agent, NaN 3 The concentration may be selected as but not limited to 0.02% w / v, 0.03% w / v, 0.04% w / v, 0.05% w / v, or a range consisting of any two of the above values.

[0083] The innovative protective agent component for extremely small amounts of cells and DNA in this application is used to evenly apply the chemical reagent components to the surface of the membrane by immersion method. Its main functions include cell lysis, DNA recovery and protection. A combination of octyl glucoside and Pluronic F-127 is used to gently lyse single cells and release DNA. The nucleic acid complexing agent EDTA is then used to bind the DNA to the matrix membrane. The entire process is carried out quickly under room temperature conditions, avoiding high-temperature lysis and multiple transfer processing steps in traditional methods. Antioxidants butylated hydroxyanisole and N-acetylcysteine ​​are used to improve cell activity and DNA integrity, EDTA is used to inhibit DNA degradation, proteinase K is used to digest nucleases (such as DNase) to prevent DNA degradation, and arabinan polysaccharides are used to form a stable hydration layer to protect DNA molecules through its high hydrophilicity, ensuring that the integrity of DNA is not affected during the storage process. This is crucial for subsequent DNA extraction and high-quality analysis (such as PCR, sequencing, etc.). In addition, the introduction of NaN 3 Inactivate potentially biohazardous bacteria, fungi, viruses or other microorganisms to prevent cross contamination and harm to testers.

[0084] In view of the difficulty in preserving extremely small amounts of cells, an embodiment of the present application also provides a sample collection protection card, which has a more efficient DNA enrichment capability and the ability to prolong DNA preservation time, and has the functions of protein denaturation, cell membrane rupture, DNA adsorption and fixation, and weakening oxidative degradation of DNA and other effective ingredients, thereby ensuring that the target DNA is stored on the preservation card for a long time without reducing the PCR efficiency. The sample collection protection card also has the ability to inactivate bacteria, viruses, etc., which can reduce the risk of personnel contacting potential pathogenic microorganisms, while also ensuring the safety of long-distance transportation.

[0085] In a specific example, the sample collection protection card includes a matrix material and the protective agent.

[0086] In a specific example, the matrix material contains a protective agent. The various protective agent components added to the sample collection protection card not only effectively solve the main difficulties in sample preservation and transportation, but also provide a more economical and efficient solution, which is suitable for various research and application scenarios of extremely small amounts of cells, especially for whole genome amplification of extremely small amounts of cells.

[0087] In a specific example, the matrix material includes one or more of a polytetrafluoroethylene membrane, a nitrocellulose membrane, a polyvinylidene fluoride membrane, and filter paper. Preferably, the matrix material is a polytetrafluoroethylene membrane.

[0088] In a specific example, the polytetrafluoroethylene film has a fine mesh honeycomb structure and a multi-layer film structure.

[0089] In a specific example, the diameter of the polytetrafluoroethylene linear fibers in the polytetrafluoroethylene membrane is 100 nm-2 μm.

[0090] In a specific example, the polytetrafluoroethylene film includes the following components: polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile. In other specific examples, the polytetrafluoroethylene film may further include other components.

[0091] In a specific example, components including polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile are mixed, and then the polytetrafluoroethylene membrane is prepared by using electrospinning technology and hot pressing technology.

[0092] The innovative protection card matrix structure of this application uses electrospinning to produce polytetrafluoroethylene linear fibers with a diameter of 100 nm-2 μm, which are hot-pressed and woven into a nanoscale fiber network to form a multilayer membrane composite with a fine mesh honeycomb structure. Compared with traditional filter paper materials and single structures, the mesh honeycomb structure has a larger specific surface area and higher affinity, which can adsorb trace cells and maintain their stability, and more effectively adsorb and fix the DNA contained in the cells to prevent DNA degradation and loss. At the same time, the membrane made of polytetrafluoroethylene fiber has good chemical corrosion resistance and can resist the effects of strong acids, strong alkalis and organic solvents. This allows it to maintain structural integrity during cell collection and subsequent processing, and is not easily damaged by chemical reagents. The mesh multilayer membrane structure can better isolate the external environment to improve the mechanical protection of extremely trace cell samples and prevent damage to samples during transportation.

[0093] In a specific example, the electrospinning parameters are: temperature at 20°C-30°C, voltage at 10 kV-30 kV, and flow rate at 0.5 mL / h-2 mL / h.

[0094] In a specific example, in the obtained mixed solution, the total concentration of polytetrafluoroethylene, polyvinyl alcohol and polyacrylonitrile is 5% w / v-15% w / v, which can be selected as but not limited to 5% w / v, 6% w / v, 7% w / v, 8% w / v, 9% w / v, 10% w / v, 11% w / v, 12% w / v, 13% w / v, 14% w / v, 15% w / v, or a range consisting of any two of the above values.

[0095] In a specific example, the sample collection protection card can be a circular sheet with a diameter of 0.5 cm, which is stored in a 200 μL centrifuge tube.

[0096] An embodiment of the present application further provides a method for preparing the sample collection protection card, comprising the following steps: soaking a polytetrafluoroethylene film with the protective agent and drying the film.

[0097] One embodiment of the present application also provides the application of the sample collection protection card in a scenario or method of collecting samples including extremely small amounts of cells as samples;

[0098] In a specific example, scenarios using extremely small amounts of cells as samples include at least one of the following: single cell analysis, rare immune cell detection, liquid biopsy, and preimplantation testing (PGT).

[0099] In a specific example, the method using a very small amount of cells as a sample includes at least one of the following: single-cell whole genome amplification, PCR amplification, and sequencing.

[0100] An embodiment of the present application also provides a method for collecting samples, wherein the collected samples are added to the sample collection protection card and dried.

[0101] In one specific example, the sample includes a very small amount of cell sample.

[0102] In a specific example, the sample includes a trace amount of cell sample of at least one type of blood, body fluid, tissue, and reproductive cells.

[0103] The above-mentioned collection protection card is used to collect various types of trace cell samples from blood, body fluids, tissues, reproductive cells, etc. When using, add the single cell sample to the round sheet, fix the collection protection card and dry it for 5-10 minutes, and then send the sample for testing or place it in a -20℃-70℃ refrigerator for long-term storage.

[0104] After the DNA is processed by the sample collection protection card, it can be directly recovered from the protection card through simple TE elution, which reduces DNA loss and improves recovery efficiency and DNA purity. The recovered DNA is compatible with a variety of downstream applications, such as single-cell whole genome amplification, PCR amplification, sequencing, etc.

[0105] The embodiments of the present application will be described in detail below in conjunction with examples. It should be understood that these examples are only used to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manual or normal conditions in this area, can also be based on the conditions recommended by the manufacturer, or refer to experimental methods known in the art.

[0106] In the following specific embodiments, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument test accuracy or operation accuracy are allowed.

[0107] Example 1

[0108] A sample collection protection card is made of a polytetrafluoroethylene film, which is cut into circular sheets with a diameter of 0.5 cm and stored in a 200 μL centrifuge tube. The circular sheet membrane is soaked in a collection protection liquid component and dried to obtain a sample collection protection card.

[0109] The method for preparing a polytetrafluoroethylene film comprises the following steps:

[0110] A polytetrafluoroethylene dispersion (CAS No.: 9002-84-0) was mixed with polyvinyl alcohol (PVA, CAS No.: 9002-89-5) and polyacrylonitrile (PAN, CAS No.: 25014-41-9) in a mass ratio of 4:1:1 to prepare a blended spinning solution with a total concentration of 15% (w / v). The solution was electrospun at a temperature of 20-30°C, a voltage of 10-30 kV, and a flow rate of 0.5-2 mL / h to produce polytetrafluoroethylene linear fibers with a diameter of 100 nm-2 μm. Subsequently, a hot press was used to heat press the linear fibers at 300°C and 5MPa to form a polytetrafluoroethylene membrane with a multilayer membrane structure with a fine mesh honeycomb structure, such as Figure 1 shown.

[0111] The collection protection solution includes the following components: 40 mg / mL Tris, 80 mg / mL SDS, 0.04 M EDTA, 2.5 mg / mL proteinase K, 1 mol / L N-acetylcysteine, 0.05% (w / v, weight / volume) butylated hydroxyanisole, 0.03% (w / v, weight / volume) NaN 3 The preparation method comprises adding the above components into nuclease-free water and mixing them.

[0112] Example 2

[0113] A sample collection protection card, which is different from embodiment 1 in that it collects protection liquid.

[0114] Specifically, collecting the protective solution includes:

[0115] 40 mg / mL Tris, 80 mg / mL SDS, 0.5% (w / v) octylglucoside, 0.01% (w / v) Pluronic F-127, 0.04 M EDTA, 2.5 mg / mL proteinase K, 0.5% (w / v) arabinan, 1 mol / L N-acetylcysteine, 0.05% (w / v) butylated hydroxyanisole, 0.03% (w / v) NaN 3 .

[0116] Example 3

[0117] A sample collection protection card, which is different from embodiment 1 in that it collects protection liquid.

[0118] Specifically, collecting the protective solution includes:

[0119] 40 mg / mL Tris, 80 mg / mL SDS, 2% (w / v) octylglucoside, 1% (w / v) Pluronic F-127, 0.04 M EDTA, 2.5 mg / mL proteinase K, 2% (w / v) arabinan, 1 mol / L N-acetylcysteine, 0.05% (w / v) butylated hydroxyanisole, 0.03% (w / v) NaN 3 .

[0120] Example 4

[0121] A sample collection protection card, which is different from embodiment 1 in that it collects protection liquid.

[0122] Specifically, collecting the protective solution includes:

[0123] 50 mg / mL Tris, 100 mg / mL SDS, 1.25% (w / v) octylglucoside, 0.5% (w / v) Pluronic F-127, 0.03 M EDTA, 3 mg / mL proteinase K, 1.25% (w / v) arabinan, 1.2 mol / L N-acetylcysteine, 0.08% (w / v) butylated hydroxyanisole, 0.04% (w / v) NaN 3 .

[0124] Example 5

[0125] A sample collection protection card, which is different from Example 3 in that: the material is nitrocellulose membrane.

[0126] The method for preparing nitrocellulose membrane comprises the following steps:

[0127] Using nitrocellulose (CAS No.: 9004-70-0) and ethyl acetate (CAS No.: 141-78-6) and acetone (CAS No.: 67-64-1), 10 g of nitrocellulose was added to every 100 mL of mixed solvent (50 mL of ethyl acetate + 50 mL of acetone) to prepare a blended spinning solution. The solution was electrospun at a temperature of 20-30°C, a voltage of 10-30 kV, and a flow rate of 0.5-2 mL / h to produce nitrocellulose linear fibers with a diameter of 100 nm-2 μm. Subsequently, a hot press was used to process the linear fibers at 60°C and 5 MPa to form a nitrocellulose membrane with a multilayer membrane structure with a fine mesh honeycomb structure, such as Figure 2 shown.

[0128] The material has low manufacturing cost and simple process, and is currently widely used in biological experiments. However, nitrocellulose has poor chemical stability, is easily dissolved by certain solvents, is sensitive to high temperatures, and has poor thermal stability. Nitrocellulose has low mechanical strength and is easy to break. Therefore, when making a multilayer membrane composite structure, it is easy to cause local micro-collapse due to the nature of the material itself, affecting the membrane performance. The overall effect is not as good as that of polytetrafluoroethylene membrane.

[0129] Experimental Example 1

[0130] Subsequently, C1 (GM10995) microcells were collected, and the microcell samples were added to the sample collection protection card in Example 1-4 and stored in a 200 μL centrifuge tube. Dry for 5-10 min and place at room temperature for 3 days. Then, QIAGEN's REPLI-g® Single Cell kit was used to directly amplify the whole genome of the microcells, measure the product concentration, and use multiple PCR to check the quality of the whole genome amplification products. The whole genome amplification products were amplified using the multiple PCR method with 8 pairs of primers (Table 1) and electrophoresis tested.

[0131] Table 1 Information of 8 pairs of primers

[0132]

[0133] The results are shown in Table 2 and Figure 3 It is shown that only Tris, SDS, EDTA, proteinase K, N-acetylcysteine, butylated hydroxyanisole, NaN 3After whole genome amplification of the collection protection card prepared by the protective solution Example 1, the DNA concentration was low, and there were no obvious bands in the electrophoresis after multiple PCR quality control, indicating that the protection effect on extremely trace cells was poor. In Examples 2, 3, and 4, different concentrations of octyl glucoside, Pluronic F-127, and arabinan polysaccharide were added, and the concentration of the whole genome amplification product was normal, and there were obvious bands in the electrophoresis after multiple PCR quality control, especially Example 3. The above results show that the protective solution component used for soaking and preparing sample collection protection cards in this application has good cell lysis and DNA protection effects.

[0134] Table 2 The protective effect of different collection protection solution combinations on trace cells

[0135]

[0136] Experimental Example 2

[0137] The sample collection protection card of Example 3 was used to protect extremely small amounts of cells of different cell lines.

[0138] The samples of different cell lines and different numbers of trace cells were collected using the micro-sample collection protection card, which was a circular sheet with a diameter of 0.5 cm and stored in a 200 μL centrifuge tube. When used, the single cell sample was added to the circular sheet. Dry for 5-10 min, store at room temperature for 3 days, and then perform whole genome amplification, measure product concentration, and use multiple PCR to perform quality inspection on the whole genome amplification product.

[0139] At the same time, 10 single cells of each of the three types of cells were taken as controls and placed in 200 μL centrifuge tubes for immediate whole genome amplification, and multiplex PCR was used to check the quality of the whole genome amplification products. The cells to be tested were three types of human B lymphocytes purchased from Coriell, namely C1 (GM10995), C2 (GM10958), and C3 (GM10959).

[0140] ① Cell line recovery: prepare culture medium and prepare appropriate complete culture medium according to the cell type. Take out the cell cryovials, take out the cryovials of 3 cell lines from liquid nitrogen, and quickly shake and thaw in a 37°C water bath. Add culture medium, add the cell suspension in the cryovial to a sterile centrifuge tube containing preheated culture medium (usually in a ratio of 1:9), and mix gently. Centrifuge at 1000 rpm for 5 min and remove the supernatant. Resuspend the cells, resuspend the cell pellet with an appropriate amount of fresh culture medium, and then transfer to a cell culture flask or plate. Culture, place the cells at 37°C, 5% CO 2 Incubate overnight in an incubator.

[0141] ② Cell passaging: discard the supernatant and remove the culture medium in the culture flask. Wash with PBS, gently wash the cells with calcium-free and magnesium-free PBS to remove the residual culture medium. Digest, add digestion solution containing 0.25% Trypsin-EDTA, and place in a 37℃ incubator until the cells are completely detached (usually 1-2 min). Terminate digestion and add an equal volume of culture medium containing serum to neutralize Trypsin. Count: Take a small portion of the cell suspension for counting, and determine the passaging ratio based on cell density and growth conditions.

[0142] ③ Cell counting: Take an appropriate amount of cell suspension for dilution and use a hemocytometer to count the cells.

[0143] ④ Single cell isolation (using a mouth pipette): Adjust the cell suspension to an appropriate concentration to ensure that the cells are dispersed. Use a mouth pipette to aspirate the cell suspension, and try to aspirate only single cells. Take 1, 3, 5, and 10 cells respectively and aspirate them directly into the mouth pipette, and then gently blow them onto the ultra-micro cell sample collection protection card of the present invention (the protection card is placed in a 200 μL centrifuge tube). Let it stand at room temperature for 10 min, and then place it at room temperature for 3 days. In addition, take 10 cells of each of the three types, transfer them to a 200 μL centrifuge tube using a mouth pipette, and use QIAGEN's REPLI-g® Single Cell kit to directly perform single-cell amplification of the entire genome.

[0144] ⑤ Whole genome amplification: The samples stored in the sample collection protection card were placed at room temperature for 3 days, and then whole genome amplification was performed using the REPLI-g® Single Cell kit (QIAGEN, Cat. No. 150343). First, 4 μL of phosphate buffer was added to the 200 μL centrifuge tube where the sample collection protection card was located, and then 3 μL of lysis buffer (Table 3) was added, and the tube was incubated at 65°C for 10 min (heat cover 105°C). After the reaction, 3 μL of neutralization buffer was added.

[0145] Table 3 Lysis buffer preparation

[0146]

[0147] Then prepare the reaction mixture Mix according to Table 4, add nuclease-free water and amplification reaction buffer, vortex and mix, centrifuge briefly, then add isothermal amplification enzyme, mix with a pipette, and centrifuge briefly. Add 40μL of cell reaction mixture Mix, flick the tube wall to mix, and centrifuge briefly. Place on the PCR amplification instrument, incubate at 30℃ for 8 h, 65℃ for 3 min (hot cover 70℃).

[0148] Table 4 Preparation of whole genome amplification reagents

[0149]

[0150] The concentration of the amplified product was determined. The amplified reaction product was diluted 10 times and the DNA concentration of the amplified product was determined using Qubit. The results are shown in Table 5.

[0151] Table 5 Whole genome amplification concentrations of extremely small amounts of different cell lines

[0152]

[0153] ⑥ The whole genome amplification products were amplified using the multiplex PCR method with 8 pairs of primers (Table 1) and then subjected to electrophoresis test. The electrophoresis results were as follows: Figure 4 shown.

[0154] According to the above results, the sample collection protection card was used to collect and test 1, 3, 5 and 10 single cell samples of 3 human cell lines stored at room temperature for 3 days. After whole genome amplification using commercial kits, 8 pairs of primers were used for multiple PCR. Different cell numbers can amplify 8 bright bands, which is consistent with the results of the control group cells. This shows that the sample collection protection card has a good effect on the protection of extremely small amounts of cells, and compared with conventional methods, it can withstand 3 days of room temperature storage.

[0155] Experimental Example 3

[0156] Example 3 Detection of chromosome aneuploidy in extremely small amounts of cells on a sample collection protection card.

[0157] Human B lymphocyte C2 (GM10958) purchased from Coriell was used for subculture and diluted. One, three, five and ten single cells were prepared using a mouth pipette and transferred to a sample collection protection card (placed in a 200 μL centrifuge tube) for storage and lysis, and then placed at room temperature for 24 h. Another 10 single cells of human B lymphocyte C2 (GM10958) were directly transferred to a 200 μL centrifuge tube as a control. The cell samples of the two treatment methods were amplified by whole genome using QIAGENPicoPLEX™ WGA Kit. Then NGS library construction was performed: DNA fragmentation, DNA fragment end connection adapter, fragment screening, library amplification and purification. The constructed library was sequenced on SE100-NGS machine, and the sequencing data volume was about 5M raw reads (0.5×-0.9×).

[0158] Analysis of sequencing results: The valid sequences matched to each chromosome are analyzed for copy number variation using the circular binary segmentation (CBS) algorithm. The sequencing data is compared and analyzed, and the number of reads is counted in 10kb windows. GC correction and window merging are then performed to obtain the total number of reads after the merged window is normalized. Then, the number of sequences after normalization of the sample is compared with the reference database, and the LogRR value of each window is calculated. The LogRR value reflects the difference between the window fragments of the sample and the reference database, that is, the CNV situation of each window fragment. Finally, the mean difference of the LogRR values ​​between adjacent windows is used to construct a t statistic analysis, thereby accurately obtaining the segmentation points of the variant segment and determining the specific CNV variation information.

[0159] Table 6 Sequencing data indicators of different numbers of single-cell samples

[0160]

[0161] according to Figure 5 According to the results in Table 6, after 1, 3, 5, and 10 single-cell samples were collected using the sample collection protection card, they were placed at room temperature for 24 h and tested. The chromosome aneuploidy test of the cell samples was normal, and there was no significant difference in the quality control between different cell numbers, which met the quality control requirements. This shows that the sample collection protection card has a good protective effect on extremely small amounts of cells and does not require low-temperature storage, which can meet the requirements of routine testing for single-cell samples.

[0162] Experimental Example 4

[0163] Example 3 Detection of circulating tumor cells (CTCs) collected by sample collection protection cards.

[0164] Blood sample collection: For patients diagnosed with non-small cell lung cancer, approximately 10 mL of blood samples were collected using a blood collection tube containing an anticoagulant (EDTA) for the collection of CTCs for testing.

[0165] CTCs enrichment: The microfluidic chip platform ClearCell FX1 was selected for the enrichment of CTCs. The platform uses inertial microfluidics to separate CTCs by the physical properties of cells (such as size and density). The sample inlet of the ClearCell FX1 system is connected, and the blood sample is pumped into the microfluidic chip to separate CTCs using inertial microfluidics. When the sample flows in the microchannel of the chip, the cells are separated by fluid dynamics due to their size and density. The enriched CTCs are placed on the sample collection protection card of the present invention and placed in a 200 μL centrifuge tube for storage and subsequent processing. Before testing, 10 μL of LowTE eluent is added to the 200 μL centrifuge tube containing the sample collection protection card to elute the DNA contained in the CTCs for subsequent testing.

[0166] Detection of CTCs: KRAS and EGFR genes were selected for qPCR detection of CTCs cells. The primer sequences are as follows:

[0167] KRAS:

[0168] F primer: 5'- GCCTGCTGAAAATGACTGAAT -3', SEQ ID NO: 1;

[0169] R primer: 5'-AGAATGGTCCTGCACCAGTAA-3', SEQ ID NO: 2.

[0170] EGFR:

[0171] F primer: 5'-TCCACTGCTTTCCACTGG-3', SEQ ID NO: 3;

[0172] R primer: 5'-TGTGGAGATGAGCAGGGTCT-3', SEQ ID NO: 4.

[0173] The memory gene selected is GAPDH gene, primer sequence:

[0174] F primer: 5'- TGCACCACCAACTGCTTAGC -3', SEQ ID NO: 5;

[0175] R primer: 5'-GGCATGGACTGTGGTCATGAG-3', SEQ ID NO: 6.

[0176] Thermo Fisher's PowerUp™ SYBR Green premix was used for qPCR detection, and the system was prepared according to Table 7. Then qPCR detection was performed: 95℃ 5 min; 95℃ 10 s, 60℃ 20 s (40 cycles); melting curve analysis: from 65℃ to 95℃ to ensure amplification specificity. Each indicator was repeated 3 times, and nuclease-free water was used as a negative control.

[0177] Table 7 qPCR system preparation

[0178]

[0179] Data analysis: Ct value calculation: Use the qPCR instrument to automatically calculate the threshold cycle number (Ct value) of the sample.

[0180] The results are as follows Figure 6-7 The results show that the use of sample collection protection cards to collect circulating tumor cells (CTCs) on the microfluidic chip platform directly lyses the DNA contained in trace CTCs and stores it on the protection card, eliminating the need for traditional DNA extraction and reducing the contamination and loss of DNA during the extraction process. The subsequent use of qPCR to detect KRAS and EGFR genes can accurately detect the mutation of related genes. This method can effectively detect tumor-related gene mutations in CTCs, providing a reference for tumor diagnosis, prognosis assessment, and treatment decisions.

[0181] Experimental Example 5

[0182] Example 5 Low-depth whole genome sequencing of extremely small amounts of cells on a sample collection protection card (nitrocellulose membrane).

[0183] Human B lymphocyte C3 (GM10959) purchased from Coriell was used, subcultured and diluted, and 5 single cells were prepared using a mouth pipette, and transferred to a sample collection protection card (nitrocellulose membrane, Example 5) and a sample collection protection card (polytetrafluoroethylene membrane, Example 3) placed in a 200 μL centrifuge tube for storage and lysis, and then placed at room temperature for 24 h. The treated cell samples were amplified for whole genome using the PicoPLEX™ WGA Kit from Rubicon Genomics. NGS library construction was then performed: DNA fragmentation, DNA fragment end connection adapter, fragment screening, library amplification and purification. The constructed library was sequenced using SE100-NGS, and the sequencing data volume was about 10 M raw reads (1×).

[0184] Table 8 Sequencing data indicators of different matrix membranes

[0185]

[0186] according to Figure 8 According to the results in Table 8, after 5 single-cell samples were collected using sample collection protection cards with different matrix membranes, they were placed at room temperature for 24 h and tested. The chromosome aneuploidy test of the cell samples was normal, and all quality controls met the requirements. The quality control data of the polytetrafluoroethylene membrane was better than that of the nitrocellulose membrane. This shows that the sample collection protection card has a good protective effect on extremely small amounts of cells and does not require low-temperature storage. It can meet the requirements of conventional testing for single-cell samples. Under the same conditions, the performance of the polytetrafluoroethylene membrane is better than that of the nitrocellulose membrane.

[0187] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0188] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims, and the description may be used to interpret the content of the claims.

Claims

1. A protective agent, characterized in that The following components are included: buffer, SDS, octyl glucoside, Pluronic F-127, polysaccharide, chelating agent, proteinase K, antioxidant and antimicrobial agent.

2. The protective agent according to claim 1, characterized in that The protective agent meets one or more of the following conditions: The buffer comprises Tris; The polysaccharide comprises one or more of arabinan polysaccharide, dextran, trehalose, hydroxyethyl starch and fructan; The complexing agent includes EDTA; The antioxidant includes N-acetylcysteine ​​and / or butylhydroxyanisole; The antimicrobial agent includes NaN3.

3. The protective agent according to claim 2, characterized in that The protective agent comprises the following components: 40 mg / mL-60 mg / mL buffer, 60 mg / mL-110 mg / mL SDS, 0.5%w / v-2%w / v octylglucoside, 0.01%w / v-1%w / v Pluronic F-127, 0.5%w / v-2%w / v arabinan, 0.01 M -0.06 M EDTA, 0.5 mg / mL-5 mg / mL proteinase K, 0.5 mol / L-1.5 mol / L N-acetylcysteine, 0.01%w / v-0.1%w / v butylated hydroxyanisole, and 0.02%w / v-0.05%w / v NaN3.

4. The sample collection protection card is characterized by: The invention comprises a matrix material and the protective agent according to any one of claims 1 to 3; optionally, the matrix material contains the protective agent.

5. The sample collection protection card according to claim 4, characterized in that: The matrix material includes one or more of a polytetrafluoroethylene membrane, a nitrocellulose membrane and a polyvinylidene fluoride membrane.

6. The sample collection protection card according to claim 5, characterized in that: The polytetrafluoroethylene film has a fine mesh honeycomb structure and a multi-layer film structure; Optionally, the polytetrafluoroethylene membrane comprises the following components: polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile; Optionally, after mixing the components including the polytetrafluoroethylene dispersion, polyvinyl alcohol and polyacrylonitrile, the polytetrafluoroethylene linear fibers are prepared by electrospinning technology, and the polytetrafluoroethylene membrane is prepared by heat pressing; Optionally, in the obtained mixed solution, the total concentration of polytetrafluoroethylene, polyvinyl alcohol and polyacrylonitrile is 5% w / v-15% w / v; Optionally, the mass ratio of the polytetrafluoroethylene, the polyvinyl alcohol and the polyacrylonitrile is 4:(1-2):(1-2); Optionally, the diameter of the polytetrafluoroethylene linear fiber is 100 nm-2 μm.

7. The method for preparing the sample collection protection card according to any one of claims 4 to 6, characterized in that: The steps include: soaking the matrix material with the protective agent and drying; Optionally, the matrix material comprises a polytetrafluoroethylene membrane.

8. Application of the sample collection protection card according to any one of claims 4 to 6 in a scene or method of collecting samples including extremely small amounts of cells; Optionally, the scenarios using extremely small amounts of cells as samples include at least one of the following: single cell analysis, rare immune cell detection, liquid biopsy, and preimplantation testing (PGT); Optionally, the method using extremely small amounts of cells as samples includes at least one of the following: single-cell whole genome amplification, PCR amplification, and sequencing.

9. A method for collecting samples, characterized in that: The collected sample is added to the sample collection protection card according to any one of claims 4 to 6 and dried.

10. The method according to claim 9, characterized in that The samples include very small amounts of cell samples; Optionally, the sample includes a trace amount of cell sample of at least one type of blood, body fluids, tissues and reproductive cells.

Images