Method for detecting material sources of meat products on basis of short-sequence high-throughput sequencing

A meat product, high-throughput technology, applied in the field of molecular biology, can solve the problems of inaccurate results and difficulties, and achieve the effect of high accuracy, ensuring efficiency and the accuracy of identification

Inactive Publication Date: 2015-11-04
SHANGHAI PASSION BIOTECHNOLOGY CO LTD
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional morphological identification methods are only applicable to meat samples in complete form. Once processed, such as fish fillets, minced meat, etc., those characteristics used for identification may be destroyed, and morphological identification will become difficult and lead to inaccurate results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting material sources of meat products on basis of short-sequence high-throughput sequencing
  • Method for detecting material sources of meat products on basis of short-sequence high-throughput sequencing
  • Method for detecting material sources of meat products on basis of short-sequence high-throughput sequencing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Material source identification of embodiment 1 canned meat products

[0027] 1. Take the canned meat products, and carry out DNA extraction on the meat products in the cans. The DNA extraction kit of Axygen Biotechnology Co., Ltd. of the United States is used for extraction. The extraction steps are as follows:

[0028] 1) Take 20 mg of meat products, transfer them into a mortar pre-cooled in an ice-water bath, and quickly and vigorously grind them into a homogenate.

[0029] 2) After adding 350 μl Buffer PBS and 0.9 μl RNase A, grind gently for 30 seconds.

[0030] 3) Collect 350 μl of ground tissue homogenate and transfer to a 2 ml centrifuge tube. If the homogenate volume is less than 350 μl, add PBS to 350 μl.

[0031] 4) Add 150 μl Buffer C-L and 20 μl Proteinase K. Immediately vortex for 1 min to mix well. After brief centrifugation, place the centrifuge tube in a 56°C water bath for 10 min. (Do not add Proteinase K directly to Buffer C-L).

[0032] 5) Add 3...

Embodiment 2~4

[0050] Examples 2-4 are verified with the identification of known fresh animal tissues, high-pressure processed meat products, and jerky

[0051] Get the fresh animal tissue of known source, high-pressure processed meat product and meat jerky respectively as the meat product sample to be tested, carry out experiment according to the same method steps in Example 1 respectively, verify the accuracy of the method in Example 1 (step are the same, so they will not be repeated), and the COI sequence information of the three meat product samples are respectively obtained as follows:

[0052] Fresh animal tissue:

[0053] The COI sequence (SEQ ID NO:6) is as follows:

[0054] AACTGGAGTAAAAGTCTTCAGCTGACTGGCCACTCTGCACGGCGGTGCCATTAAATGAGAAACCCCTCTCCTGTGGGCGCTAGGCTTCATTTTCCTCTTTACAGTTGGAGGATTGACCGGAATCGTTCTAGCTAATTCTTCTCTAGACATTATGCTTCACGACACATATTATGTCGTCGCCCACTTCCACTATGTCCTCTCAATAGGAGCCGTTTTCGCCATTGTTGCCGGCTTCGTCCACTGATTCCCCCTATTCTCAGGGTACACGCTTCACGACACTTGAACAAAAATCCACTTTGGGGTTATATTTGTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology and discloses a method for detecting material sources of meat products on the basis of short-sequence high-throughput sequencing. The method comprises the following steps that 1, genome DNA of the meat products to be detected is extracted; 2, universal primer sequences shown as SEQ ID NO:1 and SEQ ID NO:2 are designed and synthesized; 3, PCR amplification is carried out with the genome DNA of the meat products to be detected as a template to purify PCR products; 4, the PCR products are quantified, samples of the same quantity are mixed, a standard library is constructed, and then high-throughput sequencing is carried out; 5, COI sequence information of the meat products to be detected is obtained according to the sequencing result, so that the material sources of the meat products to be detected are obtained. By the utilization of the method, the material composition and the sources of the meat products can be identified, species can be well distinguished due to the difference between base sequences in the COI gene sequence, and the method is high in accuracy for identifying the material sources of the meat products.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a method for detecting the source of meat product materials based on short-sequence high-throughput sequencing. Background technique [0002] With the development of the economy and the improvement of people's living standards, the consumption of meat and meat products has developed extremely rapidly. Due to the huge difference in the value of different types of meat, there are more and more phenomena of mislabeling and shoddy products. Determining the meat used in products and verifying product label information can protect consumer rights, combat counterfeiting and mislabeling, and ensure the quality of imported and exported products. And to determine the meat used in the product must have a reliable and accurate meat species identification method. [0003] The species identification of meat mainly includes morphological methods and molecular biological methods. The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6888C12Q1/6869
Inventor孙子奎高文学丁方美王峰方婉
OwnerSHANGHAI PASSION BIOTECHNOLOGY CO LTD