Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular marker for early screening cervical cancer and detecting primers

A molecular marker, cervical cancer technology, applied in the field of molecular biology and medicine, can solve the problems of genetic background difference, operation method and experimental reagent heterogeneity, etc., to achieve convenient specific amplification, strong specificity, The effect of easy amplification conditions

Active Publication Date: 2015-12-23
SHANDONG UNIV QILU HOSPITAL
View PDF2 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Researchers at home and abroad have made exciting progress in the early screening of cervical cancer by using tumor suppressor gene methylation detection. However, there are large differences between different studies of the same gene. The reasons may be as follows: 1. Specificity of gene methylation sites; 2. Differences in genetic background of genes; 3. Heterogeneity of operation methods and experimental reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for early screening cervical cancer and detecting primers
  • Molecular marker for early screening cervical cancer and detecting primers
  • Molecular marker for early screening cervical cancer and detecting primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0047] The present invention will be further described below in conjunction with the accompanying drawings and embodiments.

[0048] 1. DNA extraction of cervical exfoliated cells:

[0049] The exfoliated cells of the cervix of the patient were taken and extracted with the QlA & DNA Mini Kit (Qiagen GmbH, Germany) kit, and the resulting DNA solution was 80 μL;

[0050] 2. Serum free DNA methylation modification:

[0051] Take 1 μg of extracted exfoliated cell DNA and modify it with QIAampEpiTectBis μL fiteKits (Qiagen GmbH, Germany) kit, and finally obtain 30 μL of modified DNA solution;

[0052] 3. Construction and optimization of real-time quantitative methylation-specific PCR (QMSP) reaction system:

[0053] 1). Real-time primer sequence:

[0054] Primer for JAM3-M4: MF:CGTAGTTAGGGTTGGGATTC (SEQ ID NO: 6)

[0055] MR: GAAATCCGACGACTATCCGA (SEQ ID NO: 7),

[0056] Primer for β-actin: MF:TGGTGATGGAGGAGGTTTAGTAAGT (SEQ ID NO: 16)

[0057] MR: AACCAATAAAACCTACTCCCTCCCTAA ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker for early screening cervical cancer and detecting primers. The molecular marker is a molecular marker JAM3-M4 with the nucleotide sequence as follows: SEQ ID No.1; and the sequences of the primers are as follows: the forward primer of JAM3-M4 has the sequence as shown in SEQ ID No.6, and a reverse primer of JAM3-M4 has the sequence as shown in SEQ ID No.7. The invention firstly finds that the methylation degree of the M4 position of a JAM3 gene is related to cervical lesion, so that the molecular marker can be used for early screening cervical cancer. The invention also discloses the primers and a kit for detecting the molecular marker for early screening cervical cancer.

Description

technical field [0001] The invention relates to a molecular marker and a detection primer for early screening of cervical cancer, belonging to the fields of molecular biology and medicine. Background technique [0002] Cervical cancer is one of the common gynecological malignancies. There are about 528,000 new cases and 266,000 deaths in the world every year, and about 85% of them occur in developing countries. The incidence rate in China remains high at 7.5 / 100,000 and the death rate is 3.4 / 100,000. In some backward areas that lack reasonable screening, the incidence rate is even as high as 81 / 100,000. According to preliminary estimates, by 2030, there will be approximately 474,000 cervical cancer deaths per year, of which more than 95% may occur in backward and developing countries. Therefore, it is of great significance to find molecular markers for early screening of cervical cancer, screen out cervical precancerous lesions and cancer patients, and implement effective ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6886C12Q2600/154
Inventor 孔北华殷爱军
Owner SHANDONG UNIV QILU HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More