Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Edible sea cucumber species identification method based on DNA mini-barcode technology

A micro-barcode and species identification technology, applied in the field of molecular biology, can solve problems such as destruction and inability to extract COI genes, and achieve the effects of simple operation, species identification, and high accuracy

Active Publication Date: 2018-05-11
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in some processed foods, the complete COI gene cannot be extracted due to the damage of its DNA. At this time, the extraction of a part of the COI gene (100bp-300bp) can also accurately identify the species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Edible sea cucumber species identification method based on DNA mini-barcode technology
  • Edible sea cucumber species identification method based on DNA mini-barcode technology
  • Edible sea cucumber species identification method based on DNA mini-barcode technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0012] The present invention is further described by means of examples, but the present invention is not limited only to the following examples.

[0013] This embodiment is to evaluate the accuracy of the DNA micro-barcode amplification efficiency and identification of sea cucumbers through the following tests.

[0014] 1. Primer Design

[0015] Download the COI gene sequences of different species of edible sea cucumbers from the NCBI website, and use

[0016] MEGA6.0 software performs multiple alignments on sequences, removes identical sequences, and finds conserved regions. A pair of DNA micro-barcode primers MiniCOI-F: CATGGCTTTCCCTCGAATGAA, MiniCOI-R: TAACTCCTGGGGTTCGCATCT were designed using conserved regions combined with primmer5.0 software.

[0017] Table 1 PCR primers and their annealing temperature

[0018]

[0019] 2. Extraction of Genomic DNA from Samples

[0020] The improved CTAB method was used to extract sea cucumber DNA from 28 sea cucumber samples with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an edible sea cucumber species identification method based on a DNA mini-barcode technology. According to the method, PCR amplification is performed through sea cucumber genome DNA extraction by use of a DNA mini-barcode primer, a PCR product with the length of 257 bp is obtained, wherein the DNA mini-barcode primer is MiniCOI-F:CATGGCTTTCCCTCGAATGAA; MiniCOI-R:TAACTCCTGGGGTTCGCATCT. Finally, DNA mini-barcode fragment sequences obtained through sequencing are compared in the NCBI (National Center for Biotechnology Information), and strain identification is performed according to matching similarity of the sequences. The method is simple and convenient to operate and high in accuracy and can identify processed commercial sea cucumbers with disappeared morphologicalfeatures, and a technical support is provided for maintaining benefits of enterprises and consumers and normal market orders.

Description

technical field [0001] The invention belongs to the field of molecular biology, in particular, the invention relates to a method for identifying edible sea cucumber species based on DNA micro-barcode technology. Background technique [0002] Sea cucumber belongs to the class Holothrioider of the phylum Echinodermata, and is divided into 3 subclasses, 6 orders and 25 families. At present, there are more than 1,500 species of sea cucumbers known in the world, among which there are about 60 species of sea cucumbers with high economic and edible value. As the largest consumer market for sea cucumbers, there are currently more than 20 kinds of sea cucumbers available for consumption in my country. Sea cucumber is considered as a high-protein, low-fat rare seafood in my country. It has high nutritional value and delicious taste. It is rich in more than 50 kinds of nutritional components such as protein, amino acid, multivitamins, essential fatty acids and trace elements. It also...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6869
CPCC12Q1/6869C12Q1/6888C12Q2531/113C12Q2535/101
Inventor 陈颖邢冉冉胡冉冉
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products